Unraveling Tamarindus indica Pulp-Derived Green Magnesium Oxide Nanoparticles for Cardioprotective Potential against Doxorubicin-Induced Cardiomyopathy: A Comprehensive Biochemical and Gene Expression Study

Abstract

The present work investigates a sustainable approach to synthesize magnesium oxide nanoparticles (MgO NPs) using an aqueous pulp extract derived from Tamarindus indica. The effective synthesis of MgO NPs was verified by characterizing methods such as UV–vis spectroscopy, X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy, and scanning electron microscopy–energy-dispersive X-ray spectroscopy (SEM-EDX). These nanoparticles possess small crystallite sizes, distinctive surface shapes, specific elemental compositions, and stabilizing and encapsulating constituents. Furthermore, total phenolic content (TPC) and total flavonoid content (TFC) tests revealed the existence of phytochemical components in MgO NPs. Significantly, these MgO NPs demonstrated exceptional antioxidant capabilities, as evidenced by their strong performance in antioxidant assays such as 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), nitric oxide (NO) scavenging, and iron chelation tests. They also exhibited a notable ability to inhibit red blood cell (RBC) hemolysis and lipid peroxidation. In toxicity assessments using Baby Hamster Kidney fibroblasts (BHK-21) and Vero cell lines, the MgO NPs displayed a safe profile. Additionally, in vivo studies on Doxorubicin (DOX)-induced cardiotoxicity revealed the cardioprotective properties of these NPs, accompanied by a detailed understanding of the underlying mechanisms. Pretreatment with MgO NPs effectively countered DOX-induced alterations in cardiac biomarkers, lipid profiles, cardiac enzymes, and lipid peroxidation. Furthermore, they modulated apoptosis-related markers (caspase-3 and p53), upregulated antiapoptotic (Bcl-2), and antioxidant (SOD) markers, suggesting their potential therapeutic value in addressing DOX-induced cardiomyopathy. In conclusion, this study underscores the promising cardioprotective, hypolipidemic, antioxidant, and antiapoptotic qualities of MgO NPs derived from tamarind pulp, offering valuable insights into their therapeutic applications and underlying biological mechanisms.

1. Introduction

Traditional herbal remedies have been employed since ancient times to address diverse ailments. Harnessing the potential of phytonutrients derived from plants appears promising, as these compounds have been extensively studied in preclinical research and have exhibited a wide array of medicinal properties.¹ The limited absorption and bioavailability of herbal remedies have posed significant limitations on their utilization, despite their acknowledged medicinal efficacy. Nanoengineering offers a potential solution by enabling the creation of compounds with optimal scale, form, and chemical characteristics.^2,3 In the context of phytomedicine, the green synthesis approach, which involves nanofabricating bioactive components, may improve their biodistribution, enable precision targeting of diseased cells, and lower dose needs to protect healthy tissues.⁴ Green synthesis methods, being nonharmful, cost-effective, and energy-efficient, typically yield stable, biocompatible nanoparticles suitable for both environmental and biomedical applications, mitigating risks associated with chemical processes, eliminating hazardous intermediates, and preventing secondary pollution.⁵ Due to their prospective as antioxidant and pharmacological agents in the biomedical field, metal oxide nanoparticles have lately been the subject of green synthesis using diverse plant extracts, including nanoformulation of metallic nanoparticles, metal oxides, and bimetal composites. By using environmentally acceptable, nontoxic, and economically advantageous one-step production techniques, the biomolecules and phytochemicals that occur in plant extracts induce the reduction of metal ions into nanosized particles. The utilization of magnesium oxide nanoparticles (MgO NPs) is increasingly recognized in many industrial and commercial applications owing to its unique physicochemical characteristics, including minimal toxicity, cationic capability, resisting corrosion, dielectric behavior, optical clarity, superior stability, and redox potential.⁶ Recently, MgO NPs have attracted significant attention in medical applications due to their remarkable biocompatibility and bioresorbable nature.⁶ The presence of magnesium ions, which are an essential component of human biology, further enhances their appeal. Additionally, the US Food and Drug Administration has recognized these nanoparticles as safe substances.⁷

Doxorubicin (DOX) is a widely used anthracycline for treating various malignancies including blood cancers and solid tumors. However, it has been linked to cardiomyopathy, which worsens with repeated exposure causing arrhythmias, ventricular dysfunction, cardiac muscle alterations, and heart failure, potentially requiring a heart transplant or even death.⁸ Despite extensive research over the past half-century, the precise molecular signaling mechanisms underlying the cardiotoxic effects of DOX remain unresolved. This lack of understanding makes it challenging to predict and prevent severe adverse events in specific individuals. DOX-induced cardiomyopathy primarily occurs through the production of reactive oxygen species (ROS) resulting in increased lipid peroxidation and depletion of antioxidant enzymes. Other potential factors contributing to cardiomyopathy include apoptosis, contractile dysfunction, mitochondrial malfunction, deficiencies in iron handling, disruptions of Ca²⁺ homeostasis, aberrant gene and protein levels, and alterations in lipid metabolism.⁹ Several agents, such as angiotensin-converting enzyme inhibitors, β blockers, dexrazoxane, amifostine, folinic acid, mesnex, and erythropoietin, have been studied as potential combination therapies to mitigate DOX-induced oxidative damage.¹⁰ However, further validation in extensive clinical settings involving humans is still needed. Due to the significant burden of cancer and its associated cardiotoxicity, there is an urgent need to develop strategies that provide prolonged cardioprotection against DOX-induced cardiomyopathy while maintaining the efficacy of chemotherapeutic drugs. Consequently, this objective has become the primary focus of academic and pharmaceutical research.¹¹ Sustainable release of DOX requires innovative drug carriers such as nanogels, micelles, organic/inorganic/metal-based nanoparticles, dendrimers, carbon-based materials, nanofibers, liposomes, and carbon nanotubes.^12,13 Magnesium is an essential element found in the body, serving as a cofactor in over 300 enzymatic activities that regulate various biochemical processes. In the context of the cardiovascular system, magnesium plays a crucial role, particularly in the modern era, as inadequate magnesium intake often results in a higher prevalence of magnesium deficiency. This deficiency increases the risk of cardiovascular dysfunction and mortality.¹⁴ This has sparked our latest research interest in the green-chemistry-based nanoformulation of magnesium oxide, which involves incorporating bioactive functional components as agents for bioreduction and stabilization of MgO NPs.

Prior work on the phytochemistry of Tamarindus indica fruit pulp found that it had greater levels of bioactive polyphenols, flavonoids, and cardiac glycosides, which support its effectiveness as a potent antioxidant, cardioprotective, and lipid-lowering agent in an experimental animal model.¹⁵ Admittedly, at this point, there is no sufficient evidence to verify the assertion that this herbal nanoformulation can serve as a cardioprotective treatment. As a result, an endeavor has been initiated to determine if pre- and cotreatment with MgO NPs prepared from T. indica fruit pulp results in a significant improvement in myocardial damage in response to DOX-induced cardiomyopathy. To the extent possible, the disclosed synthesis approach for MgO NPs utilizing T. indica pulp has not been recorded in the scientific literature. By implementing this strategy, it is also feasible to determine crucial details about the feasibility of the synthesized NPs for diverse applications ahead.

2. Methods

2.1. Chemicals and Reagents

Unless otherwise specified, the substances and reagents used in this investigation were of analytical quality. Methanol, ethanol, gallic acid, quercetin, Folin–Ciocalteu reagent (FCR), dimethyl sulfoxide (DMSO), 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), Trolox, Ferrozine, sodium nitroprusside (SNP), N-(1-naphthyl) ethylene diamine dihydrochloride (NED), sulfanilamide, nitro blue tetrazolium (NBT), sodium hydroxide, and trichloroacetic acid (TCA) were utilized in the in vitro experiments and purchased from Merck (Darmstadt, Germany), Sigma-Aldrich Co. (St. Louis) and Tokyo Chemical (Japan). Serum biochemical investigation was conducted by using an AST liquiUV kit, Triglyceride liquicolor kit, Cholesterol liquicolor kit, and HDL liquicolor kit (Human, Germany). For the analysis of mRNA expression, 95% ethanol (Sisco Research Laboratories, 150 India), a first-strand cDNA synthesis kit (Promega), Luna Universal Probe qPCR Master Mix (New England Biolabs, Japan), and an RNA extraction kit (Monarch, New England Biolab) were used.

2.2. Collection of T. indica Pulp

The fruits of T. indica were procured from Riazuddin Bazar, a native marketplace in Chittagong. They then underwent vigorous washing with tap water. The fruit pulp was completely separated from the seeds before being cleaned several times to eliminate any remaining debris. The pulp was completely blended through drying in an oven at 40 °C.

2.3. Preparation of Extract

The blended pulp was thoroughly mixed in deionized water in a 1:10 ratio and heated for 6 h at 100 °C in an electro-mantle heater. The aqueous extract was then condensed at 40 °C in a rotary evaporator after being filtered with Whatman No. 1 filter paper. The aqueous extracts of T. indica pulp were subsequently preserved to synthesize magnesium oxide nanoparticles.

2.4. Nanofabrication of MgO NPs

The methodology detailed in a prior study¹⁶ was applied to biosynthesize MgO NPs from the pulp aqueous extract. Briefly, 10 mL of the conserved pulp aqueous extract was combined with 50 mL of a 0.5 M Mg(NO₃)₂.6H₂O solution, and the mixture was stirred at 60 °C for 30 min by using a magnetic stirrer. The reaction was then allowed to continue for 2 h at 80 °C after adding drops of 1 M NaOH solution until a discernible white precipitate developed. The precipitates were rinsed multiple times with deionized water and kept at −80 °C following centrifugation for 20 min at 5500g. To round off the process of optimizing conditions for producing MgO nanoparticles, the precipitates were freeze-dried into powders in a LABCONCO 2.5 L refurbished freeze-dryer/lypophilizer at −84 °C and 0.133 mbar vacuum pressure (Figure 1).

Figure 1.

Green synthesis of MgO NPs from T. indica pulp.

2.5. Characterization of MgO NPs

A UV–vis spectrophotometer (Shimadzu UV-160A; range 190–1100 cm^–1) was employed to characterize the biogenic Pulp MgO NPs and analyze their physical properties. Using highly developed analytical instrumentation at Bangladesh Atomic Energy Commission, we performed X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy, and scanning electron microscopy with energy-dispersive X-ray (SEM-EDX) examination. The Explorer GNR was used to characterize the structural properties of MgO NPs, with monochromatic Cu Kα radiation (1.5419 Å) at a voltage of 40 kV and current of 30 mA, with a 2θ angle (30–80°) pattern and a scan speed of 2°/min. The analysis of surface functional groups was conducted using an FTIR spectrophotometer (IRAffinity-1S, Shimadzu, Japan) within the range of 400–4000 cm^–1. The surface topography and elemental makeup of MgO NPs were investigated using a SEM equipped with EDX (model: EVO18, Carl Zeiss Microscopy).

2.6. Quantitative Phytochemical Analysis of MgO NPs

2.6.1. Estimation of Total Phenolic Content

Pulp MgO NPs were analyzed for their total phenolic content (TPC) using the Folin–Ciocalteu method with slight modifications.¹⁷ Pulp MgO NPs (300 μL) were mixed with 1.5 mL of 10% FCR and 1.2 mL of 7.5% Na₂CO₃, making a total volume of 3 mL. After incubation at 40 °C for 30 min in a shaking water bath, the absorbance of the resulting blue complex was measured at 760 nm using a Shimadzu UV-160A spectrophotometer compared to a water blank. The TPC was quantified in milligrams per gram of the MgO NPs sample, using a standard curve ranging from 25 to 200 μg/mL gallic acid in methanol.

2.6.2. Estimation of Total Flavonoid Content

The total flavonoid content (TFC) of Pulp MgO NPs was determined using the aluminum chloride (AlCl₃) colorimetric assay, as described by Chang et al.¹⁸ In this method, 500 μL of each MgO NPs solution was mixed with 1.5 mL of 95% ethanol, 100 μL of 10% AlCl₃, 100 μL of 1 M potassium acetate, and 2.8 mL of distilled water. The mixture was then incubated at room temperature for 30 min. The absorbance of the reaction mixture was measured at 415 nm by using distilled water in place of 10% AlCl₃ as a blank. To construct the calibration curve, quercetin solutions in 80% ethanol with concentrations ranging from 12.5 to 200 μg/mL were used. The TFC values of MgO NPs derived from T. indica pulp were estimated based on the calibration curve and expressed as quercetin equivalents (QE) in milligrams per gram of sample (MgO NPs).

2.7. Determination of In Vitro Antioxidant Potential of MgO NPs

2.7.1. DPPH Free Radical Scavenging Activity

The study aimed to assess the efficacy of Pulp MgO NPs in neutralizing the stable 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical using a modified Blois et al. method.¹⁹ Pulp MgO NPs (12.5–400 μg/mL) were combined with 0.2 mM DPPH, and after 30 min of incubation at room temperature in the dark, the absorbance was measured at 517 nm. Ascorbic acid served as the standard, while a control without the sample was included. Lower absorbance indicated a higher free radical scavenging ability, and the inhibition percentage was calculated accordingly.

where A₀ is the absorbance of the control and A₁ is the absorbance of Pulp MgO NPs or the standard.

2.7.2. ABTS^•+ Scavenging Activity

The ABTS^•+ scavenging activity was evaluated using a modified approach based on Fellegrini et al.²⁰ Stable ABTS^•+ was generated by incubating a 7 mM aqueous solution of ABTS⁺ with 2.45 mM potassium persulfate in darkness for 12–16 h. Prior to the experiment, this solution was mixed with ethanol (approximately 1:49, v/v) and adjusted to achieve an absorbance of 0.700 ± 0.02 at 734 nm. To test the scavenging ability, 2 mL of the diluted ABTS^•+ solution was combined with 100 μL of MgO NPs (25–800 μg/mL) and vigorously mixed. After 20 min of incubation at room temperature, the absorbance at 734 nm was measured. The scavenging ability of MgO NPs toward ABTS^•+ was compared to the positive control Trolox. The inhibition percentage (%) was calculated using the following equation

where A₀ is the absorbance of the control and A₁ is the absorbance of Pulp MgO NPs or the standard.

2.7.3. Iron Chelating Activity

Pulp MgO NPs were assessed for their ability to chelate Fe²⁺ ions using a technique by Dinis et al.²¹ By reacting with Fe²⁺ ions, Ferrozine and MgO NPs competed for binding. After incubating a mixture of FeCl₂ solution and MgO NPs, Ferrozine was added, resulting in the formation of a stable magenta complex (Ferrozine-Fe²⁺). Absorbance measurements were taken after 10 min at room temperature and compared to those of the blank. Ascorbic acid served as the positive control, while solutions without samples and ascorbic acid served as the negative control. A lower absorbance indicated a stronger Fe²⁺ chelating ability of MgO NPs. The ability to chelate Fe²⁺ ions was calculated using the following equation

where A₀ is the absorbance of the control and A₁ is the absorbance of Pulp MgO NPs or the standard.

2.7.4. Nitric Oxide (NO) Scavenging Activity

An aqueous solution of sodium nitroprusside (SNP) generates nitric oxide (NO) when combined with oxygen at physiological pH, leading to the formation of nitrite ions. The Griess reagent was used to quantify nitrite ions and assess an antioxidant’s nitric oxide scavenging ability.²² In the study, a reaction mixture containing varying concentrations of Pulp MgO NPs was prepared with 10 mM SNP in 0.2 M phosphate-buffered saline (PBS) at pH 7.4. After a 150 min incubation at room temperature, the Griess reagent (composed of 1% sulfanilamide in 2% phosphoric acid and 0.1% N-(1-naphthyl ethylene diamine dihydrochloride)) was added to the reaction mixture and kept in the dark for 10 min. The reaction between nitrites and the reagent produced a purple azo dye, the absorbance of which was measured at 546 nm. Gallic acid served as the positive control for the evaluation of nitric oxide radical scavenging ability using a specific equation for calculation.

where A₀ is the absorbance of the control and A₁ is the absorbance of Pulp MgO NPs or the standard.

2.8. Evaluation of Ex Vivo Antioxidant Potential

2.8.1. Antihemolytic Activity

Hemolysis, a consequence of free radical damage to red blood cell (RBC) membranes, can potentially be countered by antioxidants. The antihemolytic potential of Pulp MgO NPs was evaluated through a spectrophotometric procedure with minor modifications.²³ Blood from healthy Wistar albino rats was collected and processed, and the resulting erythrocyte suspension was treated with varying concentrations of MgO NP extracts in PBS. After being incubated with H₂O₂ to induce oxidative damage, the samples were further incubated and then centrifuged. The absorbance of the supernatant was measured at 540 nm to determine relative hemolysis, comparing it to the blood which served as the negative control. Ascorbic acid was used as the standard (50–800 μg/mL), and a blank solution was prepared with 0.2 M PBS and 0.82 M H₂O₂ served as positive control.

2.8.2. Inhibition of Lipid Peroxidation Assay

The lipid peroxidation inhibition assay was conducted following the Haenen and Bast method.²⁴ Rat liver was excised, homogenized, and centrifuged to obtain liposomes. A 10% liver homogenate was prepared using Wistar Albino rat (weight ∼150 g) and phosphate-buffered saline (50 mM, pH 7.4). The resulting supernatant served as liposomes for the in vitro lipid peroxidation assay, carried out under ice-cold conditions. In the assay, 0.5 mL of supernatant, 1 mL of 0.15 M KCl, and 0.3 mL of the test sample and standard (50–800 μg/mL) were mixed. Peroxidation was initiated by adding 300 μL of 0.5 mM FeCl₃. The mixture was incubated at 37 °C for 30 min, and the reaction was stopped with an ice-cold TBA-TCA-HCl-BHT solution. The reaction mixture was heated, cooled, and centrifuged to obtain the pink complex, whose intensity was measured at 532 nm using a spectrophotometer. The degree of lipid peroxidation was assessed by estimating the TBARS (TBA-reactive substances) content. Distilled water was used as the control without the sample. Percentage of lipid peroxidation inhibition in the samples was calculated using the formula

where A₀ is the absorbance of the control and A₁ is the absorbance of Pulp MgO NPs or the standard.

2.9. Cell Viability Assay

In brief, BHK-21 (baby hamster kidney fibroblast cell line) and Vero (kidney epithelial cell line from an African green monkey) cells were cultured in DMEM supplemented with 1% penicillin-streptomycin (1:1), 0.2% gentamycin, and 10% fetal bovine serum (FBS). These cells were seeded at a density of 1.5 × 104/100 μL into 96-well plates and maintained at 37 °C with 5% CO₂. The following day, each well received 25 μL of a filtered sample. After 48 h of incubation, cell viability was evaluated using a colorimetric cell proliferation test kit (CellTiter 96 AQueous One Solution Cell Proliferation Assay, Promega) according to the manufacturer’s instructions. Triplicate wells were used for each sample to ensure consistency in the results.

2.10. Study of In Vivo Animal Model

2.10.1. Animal Research Ethics

The Animal Ethics Evaluation Committee of the Faculty of Biological Sciences at the University of Chittagong granted approval for the use of animals in the study. Compliance with the regulations of the Animal Ethics Review Board (approval number EA/CUBS/2018-6) was strictly observed. Adult Wistar albino male rats weighing 180 ± 20 g were chosen as the experimental subjects. The rats were housed in polycarbonate cages with wood husk bedding, maintaining a humidity level of 55–60% and a temperature of 22 ± 2 °C, under a 12-h light-dark cycle. They had ad libitum access to a rat chow diet and clean drinking water.

2.10.2. Acute Oral Toxicity Screening

Following the principles of the “Organization for Environmental Control Development” (OECD: Guidelines 420; fixed-dose approach), we conducted an acute oral toxicity test in a standard laboratory setting. The test samples (MgO NPs) were orally administered to the respective animals (n = 5) at doses of 150, 300, and 600 mg/kg of body weight, while 5% DMSO was used as the control. Rats fasted for 3–4 h after receiving MgO NPs since they had already fasted the previous night. We closely monitored potential abnormal responses, including allergic symptoms (itching, swelling, and skin rash), behavioral changes, and mortality, during the first 30 min after administration and subsequently at 24 h intervals for 72 h as well as continuously for 14 days. The clinically effective dose was found to be one-tenth of the median lethal dosage (LD₅₀ > 0.6 g/kg).²⁵

2.10.3. Animal Model of DOX-Induced Cardiomyopathy

Wistar Albino rats were induced with DOX cardiomyopathy through eight intraperitoneal injections of DOX at a dosage of 2.5 mg/kg BW, administered twice a week for a total of 4 weeks, resulting in a cumulative dose of 20 mg/kg.²⁶ The objective of the research was to investigate the in vivo antioxidant and cardioprotective properties of tamarind pulp at two different doses (15 and 30 mg/kg BW) using the specified model. The study included five groups of animals, each comprising five subjects, who were given MgO NPs solution.

Normal control (NC): Rats were provided with a standard pellet diet without any supplements for a duration of 4 weeks, along with access to fresh tap water.

Disease control (DC): Rats received DOX intraperitoneal injections at a dosage of 2.5 mg/kg on days 4, 7, 11, 14, 18, 21, 25, and 28, resulting in a combined dose of 20 mg/kg of BW throughout the study. This treatment procedure was applied to all groups except for the normal control group.

Reference control (RC): Captopril (Cardopril -Square Pharmaceuticals Ltd.) 30 mg/kg BW/day was given orally through a gavage tube once a day for 4 weeks.

Pulp MgO NPs 15 mg (P-15): Pulp MgO NPs 15 (mg/kg BW/day) were given orally through a gavage tube once a day for 4 weeks.

Pulp MgO NPs 30 mg (P-30): Pulp MgO NPs 30 (mg/kg BW/day) were given orally through a gavage tube once a day for 4 weeks.

2.10.4. Acquisition of Hematological and Histological Samples

After 24 h of the final doxorubicin injection, the rats were anesthetized with diethyl ether, and blood was drawn from the retro-orbital plexus to assess their serum biochemical and plasma lipid profile. Approximately 5 mL of blood was collected in heparinized vials and left at ambient temperature for 15 min before being centrifuged at 3000 rpm for 10 min. The serum and plasma were then separated and stored at −80 °C for future analysis.

The study aims to assess oxidative stress biomarkers in myocardial tissue. The cardiac organ was obtained and finely cut into 1 cubic centimeter pieces. Homogenization was performed using an FSH-2A, YUEXIN YIQI China homogenizer with ice-cold 0.05 M phosphate-buffered saline (PBS). The resulting homogenate underwent centrifugation at 3000g for 10 min at 4 °C.

2.10.5. Measurement of Serum Cardiac Biomarkers

Blood samples were processed to obtain serum, which was subsequently analyzed for cardiac biochemical markers including cardiac Troponin I (cTnI), creatine kinase-myoglobin binding (CK-MB), and AST (aspartate aminotransferase). These rests were precisely measured according to the guidelines provided by the respective kit manufacturers. The analyses were performed at the diagnostic laboratory of the National Hospital, Chittagong, following established protocols.

2.10.6. Plasma Lipid Profile Analysis

The protocols used to determine the levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) in the plasma involved following the manufacturer-provided guidelines. The assays were performed using AMP diagnostic kits (Humalyzer 3000, Human, India) and commercial reagent kits (Randox Laboratories, Ireland).

2.10.7. Evaluation of Oxidative Stress in the Heart

The quantification of protein content associated with oxidative stress in cardiac tissues was conducted using established standard methods.

2.10.7.1. Measurement of Superoxide Dismutase (SOD)

The Misra and Fridovich method,²⁷ based on epinephrine auto-oxidation, was used to assess cardiac tissue superoxide dismutase (SOD) activity. In summary, 0.25 mL of ice-cold chloroform and 0.1 mL of supernatant were mixed, followed by the addition of 0.15 mL of ice-cold ethanol. After centrifugation at 3000 rpm for 10 min at 4 °C, 0.2 mL of the supernatant was combined with carbonate buffer, EDTA, and distilled water. The experiment was initiated by adding epinephrine, and the absorbance change per minute was measured at 480 nm for 3 min. The SOD activity of the experimental sample was expressed using the following formula:

where A₀ is the initial absorbance and A₁ is the final absorbance.

2.10.7.2. Measurement of Catalase (CAT)

CAT activity in cardiac tissue was assessed at 37 °C by measuring the rate of hydrogen peroxide (H₂O₂) disappearance at 240 nm, following the established method described by Hadwan et al.²⁸ For catalase activity initiation, 0.2 mL of supernatant was combined with 1.9 mL of phosphate buffer (pH 7.0), 0.1 mL of enzyme extract, and 1.0 mL of H₂O₂ solution. Quantification of catalase activity was done within 1 min at 240 nm. The CAT activity of the test sample was quantified using the following expression

where DA is the decrease in absorbance and ε is the molar extinction coefficient (43.6).

2.10.7.3. Measurement of Glutathione (GSH)

The estimation of Glutathione (GSH) levels was performed following a previously described method.²⁹ In summary, 80 μL of 5% tissue homogenate was mixed with a solution containing 20 μL of DTNB (10 mM) and 900 μL of sodium phosphate buffer (0.2 M). After a 2 min incubation at room temperature, the absorbance was measured at 412 nm against a blank. A blank without tissue lysates was used as a reference. The concentration of GSH was determined from the standard graph and expressed as μmol/mg protein.

2.10.7.4. Measurement of Lipid Peroxidation (LPO)/Malonaldehyde (MDA)

The method proposed by Ohkawa et al.³⁰ was used to quantify lipid peroxide concentration. Malondialdehyde (MDA), the primary catabolic derivative of peroxides from polyunsaturated fatty acids, was analyzed by using thiobarbituric acid (TBA). Rat cardiac tissue supernatant was prepared with Tris-HCl buffer and then homogenized with a 1 mL solution of Trichloroacetic acid (TCA) - Thiobarbituric acid (TBA) - Hydrochloric acid (HCl). The intensity of the formed MDA-TBA complexes was measured at 532 nm. The following formula was used to quantify the MDA level of the experimental sample

where Abs₅₃₂ is the absorbance at 532 nm, ε is the extinction coefficient (1.56), TV is the total volume of the sample, and W is the weight of the sample.

2.10.8. Gene Expression Analysis Using Quantitative Real-Time PCR

2.10.8.1. Isolation of Total RNA

The hearts of experimental animals underwent total RNA isolation using the Monarch Total RNA Miniprep Kit from New England BioLabs following an established protocol. Aseptically, 10 mg of cardiac tissue was transferred to a microcentrifuge tube, and 300 μL of 1x RNA protection reagent was added. The tissue was homogenized using the ULTRA-TURRAX 329 T8 tissue Grinder from IKA-WERKE, GMBH & CO. KG, Germany, with subsequent addition of 30 μL of proteinase K reaction buffer and incubation at 55 °C for 10 min. After centrifugation at 16,000g for 2 min, the supernatant was carefully transferred to an RNase-free microfuge tube. The RNA purification column with ethanol was centrifuged at 16,000g for 30 s, and the flow-through was discarded. The process was repeated twice, and the RNA was finally retrieved with nuclease-free water via centrifugation. RNA purity and integrity were assessed using Nanodrop (ND2000, Thermo Scientific) and agarose gel electrophoresis, respectively, followed by storage at −70 °C.

2.10.8.2. mRNA Reverse Transcription into Complementary DNA (cDNA)

The cDNA synthesis was performed using the GoScript Reverse Transcription System from Promega, following the manufacturer’s instructions. Initially, 3 μL of high-quality total RNA (5 μg/reaction) and 2 μL of Random Primer (0.5 μg/reaction) were mixed and activated at 70 °C for 10 min in a water bath. After cooling in ice water for 5 min, each tube was incubated in a preheated 70 °C heat block for 5 min. The resulting condensate was collected, and a final volume of 20 μL, containing 4 μL of GoScript 5x Reaction Buffer, 3 μL of MgCl₂ (1.5–5.0 mM), 1 μL of PCR Nucleotide Mix (0.5 mM each dNTP), 1 μL of GoScript Reverse Transcriptase, and nuclease-free water, was prepared. The reaction mix was thoroughly vortexed and annealed at 25 °C for 5 min before incubating at 42 °C for 60 min.

2.10.8.3. cDNA Amplification Using RT-qPCR

RT-qPCR was conducted on a qTOWER 3 Real-Time PCR system from Analytica Jena, Germany, using Promega’s GoTaq(R) qPCR Master Mix and specific primers (Table 1) for apoptotic pathway-related genes (Caspase-3, p53, and Bcl-2), antioxidant enzyme-related genes (Superoxide dismutase, SOD, Catalase, CAT, and Glutathione peroxidase, GPx), and the housekeeping gene β-actin (β-actin). The 20 μL reaction volume contained 10 μL of the master mix, 3 μL of cDNA, 2 μL (10 μM/L) of forward primer, 2 μL (10 μM/L) of reverse primer, and 3 μL of nuclease-free water. The PCR cycle setup included a hot start at 95 °C for 1 min, 40 cycles at 95 °C for 15 s (denaturation), and 60 °C for 20 s (annealing/extension), followed by a final cooling temperature of 10 °C for 5 min. The ΔΔCT value was calculated for each sample using the equation ΔΔCT = ΔCT (sample) – ΔCT (normal), where ΔCT represents the CT difference between the treated gene and housekeeping controls, obtained by minimizing the average CT of the controls. The expression levels of the examined genes were calculated using the formula 2−ΔΔCT. Gel electrophoresis using 1% agarose gel, 1× TBE buffer, ethidium bromide staining, and ultraviolet (UV) visualization were used to validate the PCR results, showing successful DNA band formation.

Table 1. Primer Names and Sequences Utilized for the qRT-PCR Analysis Investigating the Modulation of Genes Related to Doxorubicin-Induced Cardiotoxicity by T. indica Pulp-Derived MgO NPs.

gene symbol	gene name	sequence (5′ → 3′)
Cas-3	caspase-3 protein	F	CTGGACTGCGGTATTGAG
		R	GGGTGCGGTAGAGTAAGC
p53	tumor protein p53	F	CCTATCCGGTCAGTTGTTGGA
		R	TTGCAGAGTGGAGGAAATGG
Bcl-2	B-cell leukemia/lymphoma 2 protein	F	CGGGAGATCGTGATGAAGT
		R	CCACCGAACTCAAAGAAGG
SOD	superoxide dismutase	F	AGCTGCACCACAGCAAGCAC
		R	TCCACCACCCTTAGGGCTCA
CAT	catalase	F	ACGAGATGGCACACTTTGACAG
		R	TGGGTTTCTCTTCTGGCTATGG
Gpx1	glutathione peroxidase-1	F	AAGGTGCTGCTCATTGAGAATG
		R	CGTCTGGACCTACCAGGAACT

2.10.9. Analysis of Cardiac Histopathology

We evaluated the impact of Pulp MgO NPs on DOX-induced cardiotoxicity through histopathological examination. The heart tissues were dehydrated in a series of alcohol solutions for 48 h, embedded in paraffin blocks, and fixed in buffered formalin solution. The tissues were then sectioned into 5 μm sections using a semiautomated rotator microtome (Biobase Bk-2258, Laboratory Manual Microtome, China). These sections were placed on glass slides and incubated at 60–70 °C for 30 min. After deparaffinization with xylene and rehydration with various ethanol concentrations (100, 90, and 70%), the sections were stained using the H&E method (hematoxylin and eosin). The heart’s histopathological features were examined under an Olympus BX51 microscope, and images were recorded using an Olympus DP20 system.

3. Results

3.1. Characterization of Green Synthesized Pulp MgO NPs

3.1.1. Physical Appearance and UV–Vis Spectroscopic Analysis

The synthesis of MgO nanoparticles was successfully achieved by using T. indica aqueous pulp extracts. A noticeable transformation from dark brown to yellowish-brown occurred when Mg(NO₃)₂·6H₂O was mixed with T. indica aqueous pulp, signifying the effective fabrication of MgO NPs. The resulting yellowish-brown nanopowders were obtained after freeze-drying, as depicted in Figure 2a. To monitor the production of biogenic MgO NPs spectrophotometrically, the maximum surface plasmon resonance (SPR) was observed by analyzing the UV–vis absorption spectra within the range of 200–800 nm. The appearance of a prominent peak at approximately 300 nm in the absorption spectra (Figure 2b) confirmed the presence of MgO NPs in the solution.

Figure 2.

(a) Photographic images of (a) T. indica pulp aqueous extract, (b) magnesium nitrate solution, (c) biogenic Pulp MgO NPs solution, and (d) pulp MgO nanopowders. (b) UV–vis spectrophotometric analysis of biogenic Pulp MgO NPs.

3.1.2. X-ray Diffraction (XRD) Analysis

The crystallographic characteristics of the biogenic MgO NPs derived from T. indica pulp were assessed through XRD analysis (Figure 3a). The obtained X-ray diffraction pattern revealed distinct Bragg reflections at 2θ values of 36.97, 42.94, 62.32, 74.73, and 78.64°, corresponding to the (111), (220), (220), (311), and (222) planes of pure magnesium oxide with a face-centered cubic structure (JCDPS No. 75-0447),³¹ signifying the presence of pure MgO nanoparticles. By applying Scherrer’s Equation, the average crystallite size of the pulp magnesium oxide nanoparticles was determined to be 13.78 ± 0.34 nm.

where D is the crystal particle size, k is the Sherrer constant (0.9), λ is the X-ray wavelength (0.15406 nm), β is the XRD peak half-height breadth, and θ is the Bragg diffraction angle.³²

Figure 3.

(a) XRD pattern of Pulp MgO NPs; (b) FT-IR spectra of MgO NPs from T. indica pulp; (c) SEM micrograph of Pulp MgO NPs at scale bar 10 μm, (d) EDX profile of Pulp MgO NPs; (e) elemental mapping analysis of magnesium; and (f) elemental mapping analysis of oxygen.

3.1.3. Fourier Transform Infrared (FT-IR) Spectroscopy

Fourier transform infrared (FT-IR) analysis was implemented to discover the biological molecules that influence the reduction, capping, and stability of the generated MgO NPs. The FTIR spectra of Pulp MgO NPs exhibited distinctive bands at specific wavenumbers of 3246, 2984, 2894, 1580, 1400, 1136, 936, and 536 cm^–1, as illustrated in Figure 3b. The absorption bands at 3246 cm^–1 were attributed to the stretching vibrations of polymeric hydroxyl O–H groups in alcohol and phenol, which signify the capping interaction of the hydroxyl group of phytochemicals present in T. indica pulp with MgO NPs. Additionally, the observed peaks at 2984 and 2894 cm^–1 are indicative of C–H stretching vibrations characteristic of the CH₂ moiety in phytochemicals. Moreover, the spectral peak at 1136 cm^–1 corresponds to the C–O stretching vibrations of phenol, acid, and flavonoids. Additionally, the peak at 1400 cm^–1 denotes the vibration of Mg–O, whereas the peak at 536 cm^–1 represents inorganic magnesium oxide.³³

3.1.4. Scanning Electron Microscopy (SEM) with Energy-Dispersive X-ray (EDX) Analysis

Pulp MgO NPs were analyzed by using scanning electron microscopy (SEM) for their morphological properties. The SEM image (Figure 3c) revealed agglomerated clusters randomly distributed with significant interspersed spacing across the surface. Energy-dispersive X-ray spectroscopy (EDX) (Figure 3d) confirmed the elemental composition of the Pulp MgO NPs, showing that the primary components of MgO NPs were Mg and O, with weight and atomic percentages of 51 and 49% and 38.7 and 61.3%, respectively, providing strong evidence of the crystalline structure. Similar to this, Mg and O were the primary ingredients of MgO NPs generated from a plant extract of Rosa floribunda, with weight and atomic proportions of 39.49 and 44.77%, and 28.33 and 48.81%, respectively.³⁴ Additionally, EDX mapping demonstrated a uniform strain distribution within the synthesized nanoparticles, as both magnesium (Figure 3e) and oxygen (Figure 3f) exhibited homogeneous distribution throughout the particle.

3.2. In Vitro Analysis of Pulp MgO NPs

3.2.1. Total Phenolic (TPC) and Total Flavonoid (TFC) Content

The total phenolic content (TPC) of Pulp MgO NPs was quantified using a calibration curve (Figure S1a) and a regression equation (y = 0.005x + 0.0374; R² = 0.9988). Similarly, the total flavonoid content (TFC) of Pulp MgO NPs was determined using the regression equation (y = 0.0061x + 0.0881; R² = 0.9985) established by the calibration curve (Figure S1b). The TPC and TFC values of the MgO NPs derived from pulp were found to be 172.28 ± 1.23 mg of GAE/g and 134.80 ± 1.03 mg of QE/g, respectively. These results are summarized in Table 2.

Table 2. Status of the Phytochemical Contents in Pulp MgO NPs.

sample name	total phenolic content (mg GAE/g)	total flavonoid content (mg QE/g)
Pulp MgO NPs	172.28 ± 1.23	134.53 ± 1.03

The data was obtained from triplicate samples, and the results are expressed as mean ± SD.

3.2.2. DPPH Free Radical Scavenging Assay

Figure 4a illustrates the DPPH free radical scavenging activity of Pulp MgO NPs and standard ascorbic acid. At a concentration of 400 μg/mL, Pulp MgO NPs exhibited a scavenging activity of 70.18 ± 0.15%, while standard ascorbic acid displayed a scavenging activity of 96.12 ± 0.32%. A concentration-dependent trend was observed, indicating an enhancement in the radical scavenging activity with an increasing sample concentration. The experiments were conducted in triplicate. The IC50 value of ascorbic acid was determined to be 8.39 μg/mL, while the IC50 of Pulp MgO NPs was found to be 208.7 μg/mL.

Figure 4.

In vitro antioxidant assays: (a) DPPH scavenging, (b) ABTS scavenging, (c) iron chelating, and (d) NO scavenging activities of Pulp MgO NPs; (e) ex vivo antioxidant assays by antihemolytic activity, and (f) inhibition of lipid peroxidation activities of Pulp MgO NPs.

3.2.3. ABTS^•+ Scavenging Assay

Figure 4b demonstrates the ABTS^•+ radical scavenging potential of Pulp MgO NPs and standard ascorbic acid. The scavenging activities of the biosynthesized MgO NPs showed a direct relationship with the concentration used. At a concentration of 800 μg/mL, Pulp MgO NPs exhibited a scavenging activity of 86.48 ± 0.72%, while Trolox displayed a scavenging activity of 98.50 ± 0.19%. Trolox exhibited an IC₅₀ value of 109.6 μg/mL, whereas the IC₅₀ values of Pulp MgO NPs were determined to be 260.7 μg/mL.

3.2.4. Iron Chelating Assay

To investigate the potential involvement of excess free iron in the generation and development of free radicals in biological systems, we conducted an iron chelating assay on our Pulp MgO NPs. The results depicted in Figure 4c demonstrate significant concentration-dependent metal ion chelating activity of both the standard ascorbic acid and Pulp MgO NPs. At a concentration of 400 μg/mL, ascorbic acid exhibited a maximum chelating activity of 96.10 ± 0.22% toward Fe²⁺ ions, while Pulp MgO NPs displayed a chelating activity of 70.10 ± 0.54% at the same concentration. The IC₅₀ values of ascorbic acid and Pulp MgO NPs were determined to be 12.46 and 67.40 μg/mL, respectively.

3.2.5. Nitric Oxide Scavenging Assay

This study examined the nitric oxide scavenging potential of Pulp MgO NPs and standard gallic acid over a concentration range of 25–800 μg/mL. The concentration of the tested samples was plotted against the percentage of free radical scavenging, as depicted in Figure 4d. The half-maximal inhibitory concentration (IC₅₀) values of gallic acid and Pulp MgO NPs were quantified as 228.4 and 686.2 μg/mL, respectively.

3.2.6. Ex Vivo Antioxidant Potential of Pulp MgO NPs

Pulp MgO NPs were tested for the inhibition of H₂O₂-induced hemolysis in rat blood and lipid peroxidation in rat liver cells. The observed phenomena of antihemolytic activity and lipid peroxidation inhibitory effect of MgO NPs exhibit a concentration-dependent relationship (Figure 4e,f). The maximum inhibitory impact of MgO NPs against lipid peroxidation in rat liver homogenate was reported at 800 μg/mL with an inhibition rate of 82.23 ± 0.05%, while the inhibitory activity of MgO NPs against rat erythrocyte hemolysis was 80.29 ± 0.02% at that level. Pulp MgO NPs had IC₅₀ values of 319.75 and 316.9 μg/mL, respectively, for inhibiting erythrocyte hemolysis and lipid peroxidation.

3.2.7. Cytotoxic Effect of Pulp MgO NPs

To determine the LD₅₀ values, the cytotoxicity of MgO NPs derived from T. indica aqueous pulp extract was assessed on BHK-21 and Vero cell lines, covering doses ranging from 62.5 to 1000 mg/mL (Figure 5). The survival rate of BHK-21 cells in the presence of Pulp MgO NPs at a concentration of 1000 mg/mL was 67.23%, while the survival rate of Vero cells at the same concentration was 48.56%. The LD₅₀ values for BHK-21 and Vero cells using Pulp MgO NPs were found to exceed 1000 and 800 mg/mL, respectively. These findings indicate that Pulp MgO NPs did not exhibit toxicity to BHK-21 or Vero cells at the tested doses.

Figure 5.

Cytotoxicity analysis of Pulp MgO NPs: (a) % of BHK-21 and Vero cell survival at different concentrations of Pulp MgO NPs, and photomicrographs (×20 magnification at scale bar = 1 mm) (b) BHK-21 and (c) Vero cell culture. Data were analyzed from triplicates and expressed as mean ± SD.

3.3. Effect of Pulp MgO NPs in Doxorubicin-Induced Cardiomyopathy

3.3.1. Evaluation of Acute Toxicity

Throughout the acute toxicity assessment, no mortality or morbidity was observed in rats receiving single oral doses of Pulp MgO NPs over a 14-day period. Additionally, no morphological abnormalities were detected in the skin, ocular organs, nasal structure, or pilosity parameters. There were no indications of tremors, seizures, salivation, diarrhea, lethargy, or abnormal behavior. Furthermore, no fatalities occurred among the experimental animals in any of the intervention groups during the study.

3.3.2. Effect of Pulp MgO NPs on Serum Troponin I, CK-MB, and AST

Figure 6 displays the outcomes of serum cardiac biomarker assessments. In comparison to the NC group, the DC group exhibited significantly elevated levels of cTnI, CK-MB, and AST, indicating cardiac cell injury. Notably, the RC (***P < 0.001), P-15 and P-30 (**P < 0.01) groups demonstrated a substantial reduction in serum cTnI levels (Figure 6a). Similarly, the RC and P-30 groups exhibited a significant decrease in serum CK-MB levels (**P < 0.01), while the P-15 (*P < 0.05) group did not show a moderate reduction (Figure 6b). Furthermore, a significant decrease in serum AST levels was evident in the RC (**P < 0.01), P-15 (*P < 0.05), and P-30 (**P < 0.01) groups (Figure 6c).

Figure 6.

Assessment of serum cardiac biomarkers in the experimental groups. (a) Cardiac Troponin I (cTnI), (b) creatine kinase- MB (CK-MB), and (c) aspartate aminotransferase (AST). Data were analyzed using one-way ANOVA followed by Dunnett’s multiple comparisons tests and reported as mean ± SD (n = 5). When compared to the disease control (DC) group, values are statistically significant at *P < 0.05; **P < 0.01; ***P < 0.001.

3.3.3. Effect of Pulp MgO NPs on Plasma Lipid Profile

Figure 7 illustrates the lipid profile results of plasma. A comparative analysis between the DC and NC groups demonstrated a statistically significant (***P < 0.001) increase in TC, TG, and LDL-C levels, along with a significant (**P < 0.01) decrease in HDL-C levels. Notably, groups RC (***P < 0.001), P-15, and P-30 (**P < 0.01) showed a substantial reduction in TC levels (Figure 7a), and groups RC (*P < 0.05) and P-30 (**P < 0.01) exhibited significantly reduced TG levels (Figure 7b). Furthermore, the RC (**P < 0.01), P-15 (*P < 0.05), and P-30 (**P < 0.01) groups demonstrated a significant decrease in LDL-C levels (Figure 7c). Importantly, the HDL-C levels were moderately higher in groups RC and P-30 (*P < 0.05) groups (Figure 7d).

Figure 7.

Effects of Pulp MgO NPs on the plasma lipid profile in the experimental groups. (a) Total cholesterol (TC), (b) triglycerides (TG), (c) low-density lipoprotein cholesterol (LDL-C), and (d) high-density lipoprotein cholesterol (HDL-C). Data were expressed as mean ± SD (n = 5) and analyzed using one-way ANOVA followed by Dunnett‘s multiple comparisons tests. Values are statistically significant at *P < 0.05; **P < 0.01; ***P < 0.001 when compared to the disease control (DC) group.

3.3.4. Effects of Pulp MgO NPs on Cardiac Oxidative Status

The illustration in Figure 8 clearly indicates that the DC group showed a notable decline in the enzymatic activities of SOD, CAT, and GSH and a significant increase in LPO compared to the NC group. Notably, RC (*P < 0.05) and P-30 (*P < 0.01) groups demonstrated a significant elevation in SOD level and both P-15 and P-30 (*P < 0.05) groups exhibited moderate enhancement in CAT level. Additionally, RC and P-30 (*P < 0.05) groups showed improvements in the GSH level. Importantly, all experimental groups significantly reduced the LPO/MDA level.

Figure 8.

Effects of Pulp MgO NPs on cardiac (a) SOD level (U/mg protein), (b) CAT level (μmol/mg protein), (c) GSH level (μmol/mg protein), and (d) MDA level (nmol/mg protein). Data were expressed as mean ± SD (n = 5) and analyzed using one-way ANOVA followed by Dunnett‘s multiple comparisons tests. Values are statistically significant at *P < 0.05; **P < 0.01; ***P < 0.001 when compared to the disease control (DC) group.

3.3.5. Effects of Pulp MgO NPs on the Expression of Cardiac Apoptosis and Antioxidant Enzyme-Related Genes

RT-PCR was utilized to quantify mRNA levels for Caspase-3, p53, Bcl-2, SOD, CAT, and GPx to measure the enzyme/protein activity. Figure 9a demonstrates the relative fold change data of the Caspase-3 gene. The DC group exhibited significantly heightened caspase-3 gene expression than the NC group (*P < 0.05). In comparison, the RC and P-30 (*P < 0.05) groups showed significant downregulation in caspase-3 mRNA compared to the DC group. In Figure 9b, a fold difference in p53 mRNA expression between the DC and NC groups was observed (**P < 0.01). Only P-30 groups had significantly (**P < 0.01) lowered the p53 expression. Figure 9c illustrates that the DC group downregulated Bcl-2 mRNA level more than the NC group (**P < 0.01). Compared to the DC group, the RC (*P < 0.05) and P-30 (**P < 0.01) groups showed considerable upregulation of Bcl-2 expression. In Figure 9d, the DC group exhibited a lower level of antioxidant SOD mRNA compared to the NC group (**P < 0.01). However, the RC, P-15, and P-30 groups had significantly higher levels (**P < 0.05) of SOD gene expression than the DC group. Figure 9e shows the results of the CAT mRNA expression in the experimental animals. The DC group had lower CAT expression than the NC group (**P < 0.01). In contrast, the RC and P-30 groups showed statistically significant upregulation (*P < 0.05) compared to the DC group. Lastly, Figure 9f illustrates GPx mRNA expression, where the DC group expressed a significantly lesser amount of GPx mRNA compared to the NC group (***P < 0.001). Meanwhile, both the RC and P-30 groups exhibited a significant amount (**P < 0.01) of GPx mRNA compared to the DC group.

Figure 9.

Relative fold change of mRNA expressions. Apoptotic (a) caspase-3 gene expression, (b) p53 gene expression, (c) BCL-2 gene expression. The data were analyzed using one-way ANOVA and Dunnett’s multiple comparisons tests after being represented as mean ± SD (n = 5). When compared to DC: disease control group, values are statistically significant at *P < 0.05; **P < 0.01; ***P < 0.001. Relative fold change of mRNA expressions. Antioxidant (d) superoxide dismutase (SOD) gene expression, (e) catalase (CAT) gene expression, and (f) glutathione peroxidase (GPx) gene expression. The data were analyzed using one-way ANOVA and Dunnett’s multiple comparisons tests after being represented as mean ± SD (n = 5). When compared to DC: disease control group, values are statistically significant at *P < 0.05; **P < 0.01; ***P < 0.001.

3.3.6. Effect of Pulp MgO NPs on Myocardial Histopathology

The evaluation of DOX-induced cardiomyopathy was conducted using H&E staining under a light microscope, as depicted in Figure 10. Histological analysis of cardiac tissue in the NC group revealed a typical and healthy morphological architecture. In contrast, the DC group exhibited significant pathophysiological aberrations in their cardiomyocytes, including myocardial edema, cardiac fiber disruption, cytoplasmic, and perinuclear vacuolization as well as myofibrillar disintegration. The findings of this study indicate a significant reduction in the observed pathological alterations within the treatment groups that followed. Notably, the P-15 group showed a significant decrease in the observed pathological changes, while the myocardial structure in the RC group and P-30 groups closely resembled that of the normal control (NC) group. These observations suggest a potential ameliorative effect of the treatments on DOX-induced cardiomyopathy, with the P-30 group and RC group demonstrating particularly promising results in preserving cardiac tissue morphology.³⁵

Figure 10.

Effect of Pulp MgO NPs on the histology of the heart of experimental rats (×40 at scale bar = 500 μm, H&E). (a) Normal control (NC) group, (b) disease control (DC) group, (c) reference control (RC) group, (d) Pulp MgO NPs 15 mg/kg BW (P-15) group, and (e) Pulp MgO NPs 30 mg/kg BW (P-30) group.

4. Discussion

Nanophytosynthesis is an innovative approach for the eco-friendly production of nanoparticles (NPs) due to its biodegradable and environmentally sustainable nature.³⁵ Nanobiotechnologists have developed novel carriers for delivering drugs with unique pharmacological effects, particularly for addressing cardiovascular disorders.³⁶ One such example is the use of green MgO NPs, which exhibit a strong affinity for proteins and can influence metabolism, cytotoxicity, and cellular functions.³⁷ In the current study, MgO NPs were synthesized through a biologically inspired method utilizing T. indica pulp, renowned for its potent cardioprotective properties. The investigation highlights the potential of MgO NPs in mitigating cardiac damage induced by DOX, both as a pretreatment and cotreatment strategy.

The observed color shift during synthesis was prompted by the conversion of Mg²⁺ to metallic magnesium (Mg⁰), which was facilitated by the bioactive component contained in the T. indica pulp aqueous extract. This phenomenon arises due to the breakdown of phytochemicals contained in the plant extract during the reduction and stabilization processes employed in nanoparticle fabrication.³⁸ UV spectroscopy serves as a crucial and effective technique for characterizing the optoelectronic and morphological properties, particularly size, of biogenic nanoparticles, often associated with surface plasmon resonance (SPR).³⁹ Metal nanoparticles between 2 and 100 nm in size are often characterized with a light spectrum spanning 300 to 800 nm,⁴⁰ with an absorption peak between 300 and 400 nm indicating the existence of metal oxide nanoparticles.⁴¹ The interaction of green nanoparticles with specific light wavelengths during SPR results in a distinctive color change. The size of biogenic MgO NPs can vary, ranging from smaller to larger, with SPR values falling within the range of 300 ≤ SPR ≥ 300.⁴² The notable SPR peak observed at 300 nm in this study signifies the successful synthesis of nanoscale MgO NPs. The fabrication of the NPs is iso-morphologically evident by a single peak appearing in the MgO NPs UV spectra.⁴³ The application of X-ray diffraction (XRD) is an essential component of biomedical investigations, as it enables a thorough examination of the crystalline arrangement, phase characteristics, lattice dimensions, and grain size of nanoparticles produced using environmentally friendly techniques.⁴⁴ The XRD analysis conducted on the biosynthesized Pulp MgO NPs yielded valuable insights into their nanoscale crystalline structure, lattice state, and phase purity. The study reveals distinct and prominent peaks, indicating a precise crystalline structure with discernible crystallographic alignments in the MgO NPs generated from plant-derived sources. The XRD pattern of this nature has been previously found in the studies conducted by Essien et al.³¹ and Younis et al.³⁴ The FTIR study revealed the presence of alkaloids, flavonoids, and polyphenols in close proximity to MgO NPs, which facilitated the reduction, capping, and stabilization of magnesium ions into nanoparticles (NPs).⁴⁵ The signal at 536 cm^–1 confirms the existence of metal–oxygen, which corresponds to Mg–O bonds and is consistent with prior findings.^46,47 Upon scrutinizing the surface properties through scanning electron microscopy (SEM), it was observed that the green synthesized MgO NPs exhibited agglomeration, possibly arising from the van der Waals forces and attraction between MgO NPs coated with bioactive compounds derived from T. indica pulp.⁴⁸ The EDX analysis confirms the authenticity of pure magnesium oxide nanoparticles, showcasing their exclusive composition of magnesium and oxygen with a uniform distribution of elemental constituents. The existence of O and Mg peaks with bending energies ranging from 0.5 to 1.5 keV implies that MgO NPs have been successfully synthesized.⁴⁹

In addition to mitigating DNA damage, tumor development, and cellular disintegration, antioxidants have been linked to decreased rates of cancer, cardiovascular disease, and oxidative stress. By combining bioactive phytochemicals with nanotechnology in a synergistic manner, the use of phytoproducts enclosed in nanoparticles has demonstrated great advancements in improving antioxidant activity.⁵⁰ The fundamental components accountable for the manifestation of antioxidant activity are phenolic compounds and flavonoids, whose combined concentrations demonstrate a positive correlation with their individual antioxidant capacities.⁵¹ It is essential to use established phytochemical screening procedures for roughly estimating the amount of phenolics and flavonoids, considering the inherent challenge of directly detecting their presence in the capping components of newly generated MgO NPs. During the assessment of the total phenolic content (TPC) and total flavonoid content (TFC), it was evident that the Pulp MgO NPs showcased a substantial presence of phenolic and flavonoid compounds. To ensure the rigorous evaluation of antioxidant activity in the sample, we utilized four distinct assays, recognizing that a single test may not provide an accurate assessment. Through standardized procedures, including DPPH, ABTS^•+, NO scavenging activity, and iron chelating assay, we observed remarkable antioxidant capacities in Pulp MgO NPs, compared with several well-known standards such as Ascorbic acid, Trolox, and gallic acid. The biosynthesis of metal oxide nanoparticles depends mostly on the keto–enol conversion of polyphenolic and flavonoid substances which exhibit significant antioxidant and radical scavenging properties.⁵² The key contributor to the antioxidant attributes of plants and their derivatives lies in phenolic compounds, characterized by conjugated ring structures and hydroxyl groups that enable them to actively counteract or stabilize free radicals involved in oxidative processes by means of hydrogenation or conjugation with oxidizing molecules.⁵³ The capacity of biologically synthesized MgO nanoparticles (NPs) to combat free radicals in different scavenging assays can be ascribed to the bioactive components found in the T indica pulp extract. These compounds, in conjunction with MgO, may function as antioxidants by transferring a single electron and a hydrogen atom.⁵⁴ Free radicals target the cellular membrane, leading to hemolysis due to chain reactions on erythrocytes. Membrane damage occurs through peroxidation of lipid moieties, especially polyunsaturated fatty acids, caused by free radical activities.⁵⁵ Phenolic compounds have the ability to partition the cell membrane, limiting the diffusion of free radicals and slowing their interactions. Flavonoids, in particular, have been shown to protect erythrocyte membranes by inhibiting lipid peroxidation and enhancing membrane integrity through binding.⁵⁶ The unique physicochemical characteristics and high surface-area-to-volume ratio of Pulp MgO NPs appear to facilitate interactions with erythrocyte membrane lipids, leading to a protective effect against hemolysis and lipid peroxidation, as indicated by our findings. Additionally, the cytotoxicity evaluation of Pulp MgO NPs toward BHK-21 and Vero cell lines revealed negligible adverse effects, thus highlighting their remarkable biocompatibility and promising applicability for integration into various biological systems. The present study encompasses an evaluation of the acute toxicity profile pertaining to varying doses of Pulp MgO NPs. Our findings unequivocally demonstrate that the chosen dosages exhibit a commendable level of safety and appropriateness for implementation within a Wistar Albino rat model of DOX-induced cardiomyopathy.

Cardiotoxicity was observed upon administering a cumulative dose of DOX at 20 mg/kg BW. This was evident from the increased levels of cardiac enzymes (cTnI, CK-MB, and AST), dyslipidemia indicated by elevated plasma lipids (TG, TC, and LDL-C) and reduced HDL-C levels, perturbations in oxidative stress markers (lipid peroxidation, SOD, CAT, and GSH) within cardiac tissues, upregulation of p53 and caspase-3 gene expression, downregulation of Bcl-2, SOD, GPx, and CAT gene expression, and damage to cardiomyocytes in the disease control (DC) group. Following a myocardial infarction or myocyte damage, cardiac enzymatic biomarkers such cTnI, CK-MB, and AST are released into the circulation, raising their levels in the serum and acting as indicators for severe cardiac disorders.⁵⁷ In this study, oral administration of Pulp MgO NPs at both doses led to a noteworthy decrease in serum cTnI, CK-MB, and AST levels. This normalization of cardiac biomarkers supports the cardioprotective potential of Pulp MgO NPs, possibly due to their ability to stabilize cell membranes.

Patients with cancer, especially those who are already prone to cardiovascular disease, may have negative effects from the abnormal lipid profiles brought on by DOX therapy.⁵⁸ Pretreatment with Pulp MgO NPs effectively safeguarded the lipid parameters (plasma TC, TG, LDL-C, and HDL-C), maintaining them near their baseline levels. This indicates that the Pulp MgO NPs exert their hypolipidemic activity by preventing cholesterol biosynthesis and enhancing the liver’s uptake of LDL from the bloodstream.⁵⁹

Endogenous antioxidants such as SOD, CAT, and GSH are produced in the face of oxidative stress resulting from DOX and play a vital part in minimizing free radicals.⁶⁰ In contrast, cardiac tissue lacks sufficient antioxidant enzymes to efficiently remove free radicals, leading to their accumulation and subsequent lipid peroxidation. Consequently, this process may induce cardiomyocyte apoptosis and elevate malondialdehyde (MDA) levels, serving as a marker for lipid peroxidation.⁶¹ The administration of Pulp MgO NPs at both doses significantly mitigated the DOX-induced alterations in antioxidant (SOD, CAT, and GSH) and MDA levels, as observed in our study.

The dysregulation of apoptosis, a crucial process of programmed cell death, is associated with various pathological conditions, including malignancy and acute myocardial infarction.⁶² Overexpression of cardiac-specific caspase-3 results in the formation of a larger infarct.⁶³ Additionally, the production of reactive oxygen species (ROS) activates p53, leading to increased cardiomyocyte death. Conversely, overexpression of Bcl-2, which inhibits cardiomyocyte apoptosis, leads to a significant reduction in infarct size during cardiac disorders.⁶⁴ RT-PCR analysis of cardiac tissues following DOX administration indicated significant downregulation of p53 and caspase-3, along with upregulation of Bcl-2 in the Pulp MgO NPs treated groups. This suggests that Pulp MgO NPs exhibit cellular antiapoptotic effects against DOX-induced myocardial apoptosis. Following DOX treatment, the expression of natural antioxidant enzymes, such as SOD, CAT, and GPx, is diminished in the heart, making it more susceptible to DOX-induced cardiac damage. In our study, the mRNA expression levels of SOD, CAT, and GPx genes exhibited a significant increase across all experimental groups, relative to the DC group. This upregulation is associated with the heightened activity of these potent antioxidant enzymes responsible for decomposing and reducing oxidative stress. These results strongly indicate that Pulp MgO NPs, synthesized through a green approach, effectively alleviate doxorubicin-induced cardiotoxicity by acting as robust antioxidant agents. Cardiomyocytes pretreated with Pulp MgO NPs showed attenuated DOX-induced histological changes. The findings of this study imply that the preservation of cardiomyocytes may be responsible for the decreased outflow of cardiac biomarkers into serum.

Therefore, the findings of this investigation provide empirical evidence in favor of the postulation that DOX-induced cardiotoxicity is intricately associated with the interplay of oxidative stress, hyperlipidemia, and apoptosis. Pulp MgO NPs exhibit a cardioprotective function by attenuating the detrimental consequences of DOX therapy via their antioxidative, hypolipidemic, and antiapoptotic properties.

5. Conclusions

The study aimed to evaluate the potential of greenly produced MgO NPs derived from T. indica pulp as cardioprotective agents. XRD and FTIR analyses confirmed the nanoparticles’ structure and functional components, while SEM-EDX revealed their agglomerated shape with uniform elemental distribution. The Pulp MgO NPs displayed significant antioxidant properties and were biocompatible with BHK-21 and Vero cells. In a rat model, the Pulp MgO NPs showed promise in mitigating doxorubicin-induced cardiotoxicity by enhancing antioxidant activities, reducing oxidative stress, normalizing lipid metabolism, and inhibiting apoptosis. Based on a comprehensive analysis of the experimental data, it becomes apparent that the administration of pulp MgO NPs at a dosage of 30 mg/kg of BW demonstrated more effectiveness in alleviating doxorubicin-induced cardiomyopathy. This is due to the fact that higher concentrations exhibit higher activity. These findings suggest MgO NPs from T. indica pulp could be potential natural resources for cardioprotection and warrant further investigation for clinical applications.

Glossary

List of Abbreviations

MgO NPs

magnesium oxide nanoparticles

UV–vis

UV visible spectroscopy

XRD

X-ray diffraction

FT-IR

Fourier transform infrared spectroscopy

SEM

scanning electron microscopy

EDX

energy-dispersive X-ray spectroscopy

TPC

total phenolic content

TFC

total flavonoid content

DPPH

2,2-diphenyl-1-picrylhydrazyl

ABTS

2,2′-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid)

NO

nitric oxide

RBC

red blood cell

DOX

doxorubicin

ROS

reactive oxygen species

FCR

Folin–Ciocalteu reagent

DMSO

dimethyl sulfoxide

SNP

sodium nitroprusside

NED

N-(1-naphthyl)ethylene diamine dihydrochloride

NBT

nitro blue tetrazolium

PBS

phosphate-buffered saline

LPO

lipid peroxidation

BHK-21

baby hamster kidney fibroblast cell line

Vero cell

kidney epithelial cell line from an African green monkey

DMEM

Dulbecco’s modified Eagle’s medium

FBS

fetal bovine serum

BW

body weight

cTnI

cardiac Troponin I

CK-MB

creatine kinase-myoglobin binding

AST

aspartate aminotransferase

TC

total cholesterol

TG

triglyceride

LDL-C

Low-density lipoprotein cholesterol

HDL-C

High-density lipoprotein cholesterol

SOD

superoxide dismutase

CAT

catalase

GSH

glutathione

MDA

malonaldehyde

TBA

thiobarbituric acid

TCA

trichloroacetic acid

RT-PCR

real-time polymerase chain reaction

EDTA

ethylene diamine tetraacetic acid

DTNB

5,5-dithio-bis(2-nitrobenzoic acid)

Cas-3

caspase-3

Bcl-2

B-cell lymphoma 2

GPx

glutathione peroxidase

TBE

tris borate EDTA

H& E

hematoxylin and eosin

SPR

surface plasmon resonance

Data Availability Statement

Data will be available upon request.

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.3c05851.

• Standard curve of total phenolic content (gallic acid) and total flavonoid content (quercetin) (Figure S1) (PDF)

Author Contributions

M.A.R. conceptualized and designed the research idea. F.Y.N., F.S., M.M., and M.K.J.R. performed the investigation. F.Y.N. and M.K.J.R. wrote the original draft and contributed to the formal analysis and data curation. T.R.C. worked on nano characterization. M.A.R., F.Y.N., and S.S. performed visualization, validation, and writing—review and editing. S.S. and A.M.A.A. improvised the manuscript. All of the authors reviewed the manuscript and agreed to submit it to ACS Omega.

The authors declare no competing financial interest.