Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2023 Oct 12;11(6):e01804-23. doi: 10.1128/spectrum.01804-23

Capsular polysaccharide determines the serotyping of Riemerella anatipestifer

Yanling Liu 1,2,3,#, Shuxin Luo 1,3,#, Zhishuang Yang 1,3, Mingshu Wang 1,2,3, Renyong Jia 1,2,3, Shun Chen 1,2,3, Mafeng Liu 1,2,3, Xinxin Zhao 1,2,3, Qiao Yang 1,2,3, Ying Wu 1,2,3, Shaqiu Zhang 1,2,3, Juan Huang 1,2,3, Xumin Ou 1,2,3, Sai Mao 1,2,3, Qun Gao 1,2,3, Di Sun 1,2,3, Bin Tian 1,2,3, Anchun Cheng 1,2,3,, Dekang Zhu 1,2,3,
Editor: Artem S Rogovskyy4
PMCID: PMC10714938  PMID: 37823636

ABSTRACT

Riemerella anatipestifer (R. anatipestifer) is a Gram-negative pathogen that causes significant economic losses to the farming industry. The polysaccharides that determine serotype are well understood in other bacteria; they have not yet been fully characterized in R. anatipestifer. In this study, we unexpectedly discovered a strain, RCAD0392, that is capable of cross-agglutination. Whole genome sequencing revealed base mutations disrupting a gene on its capsular polysaccharide synthesis gene cluster. By constructing homologous gene deletion mutants in CH-2, we demonstrated that deletion of this gene leads to altered serological phenotypes. India ink and transmission electron microscopy experiments revealed the disappearance of capsule on the surface of the bacteria, indicating the association of the gene with capsule synthesis. In addition, agar-gel precipitin tests showed that lipopolysaccharide binds to antisera of multiple serotypes, while the capsular polysaccharide only binds to the corresponding antisera. This suggests that capsular polysaccharide is the specific antigen that determines the serotype of R. anatipestifer.

IMPORTANCE

Riemerella anatipestifer (R. anatipestifer) is one of the most important veterinary pathogens with at least 21 serotypes. However, the exact polysaccharide(s) that determine R. anatipestifer serotype is still unknown. This study has provided a preliminary exploration of the relationship between capsular polysaccharides and serotyping in R. anatipestifer and suggests possible directions for further investigation of the genetic basis of serotypes in this bacterium.

KEYWORDS: Riemerella anatipestifer, capsule, serotyping, capsular polysaccharide, lipopolysaccharide

INTRODUCTION

Riemerella anatipestifer (R. anatipestifer) is a Gram-negative bacterium that infects ducks, geese, turkeys, and other avian species, causing severe septicemia and serositis. R. anatipestifer infection has caused significant economic losses in the duck industry worldwide. R. anatipestifer has at least 21 serovars (1), and the protective efficacy of vaccines has been limited due to the absence of cross-protection between serovars (2).

Based on the antigenic differences of capsular polysaccharide (CPS) and lipopolysaccharide (LPS), a bacterial species can be classified into different serovars by serotyping. At present, the serotyping of CPS and O-antigen have been widely used in the identification and typing of a variety of bacteria (3, 4). According to the antigenicity of capsular polysaccharides, there were more than 90 serovars of Streptococcus pneumoniae (5), 35 serovars of Streptococcus suis (6), 5 serovars of Pasteurella multocida (7), and 82 serovars of Klebsiella pneumoniae (8). According to the antigenicity of lipopolysaccharide, there were 16 serovars of Pasteurella multocida (9, 10) and 9 serovars of Klebsiella pneumoniae (3). Currently, serotyping of R. anatipestifer is based on surface polysaccharide antigens (11). Although there have been several studies focusing on genes related to LPS (12 14) and CPS (15) synthesis in R. anatipestifer, the molecular determinants of R. anatipestifer serotyping have not been elucidated.

In this study, we focused on the molecular basis of RA serotyping. During routine surveillance, we identified a clinical isolate, RCAD0392, that cross-agglutinated with several antisera of different serotypes. Whole genome sequencing revealed that a base deletion disrupted the D1J34_RS08130 gene (corresponding to G148_RS04320 of RA CH-2) on the CPS synthesis gene cluster. Further phenotypic testing using India ink and transmission electron microscopy confirms that the CPS is the specific antigen that likely distinguishes serovars of R. anatipestifer. Our study provides a basis for serotyping of R. anatipestifer using the CPS genotyping system and reveals the molecular basis of R. anatipestifer serotyping.

MATERIALS AND METHODS

Bacterial strains and growth conditions

The bacterial strains, plasmids and primers used in this study are listed in Tables 1 and 2, respectively. The R. anatipestifer strains were grown in tryptic soy broth (TSB), GC broth (GCB) or tryptic soy agar (TSA) (Oxoid Ltd., Basingstoke, UK) at 37°C supplemented in 5% CO2. Escherichia coli strains were cultured in Luria Bertani (LB) broth at 37°C. Antibiotics were added, when necessary, to a final concentration of 40 µg/mL for erythromycin (Erm) and 100µg/mL for ampicillin. All antibiotics were obtained from Dalian Meilun Biotech Co., Ltd. (Dalian, China). The bacterial growth was monitored by measuring absorbance at 600 nM (OD600).

TABLE 1.

The strains used in this study a

Strain or plasmid Descriptions Resources or references
R. anatipestifer RCAD0392 Wild strain Laboratory collection
R. anatipestifer CH-2 Wild strain Laboratory collection
CH-2 ΔG148_RS04320 G148_RS04320 deletion mutant of CH-2 strain This study
cG148_RS04320 G148_RS04320 complemented mutant of CH-2 strain This study
R. anatipestifer CCUG 18373 Serovar 1 CCUG
R. anatipestifer CCUG 25001 Serovar 2 CCUG
R. anatipestifer CCUG 25002 Serovar 3 CCUG
R. anatipestifer CCUG 25004 Serovar 5 CCUG
R. anatipestifer CCUG 25005 Serovar 6 CCUG
R. anatipestifer CCUG 25054 Serovar 8 CCUG
R. anatipestifer CCUG 25006 Serovar 9 CCUG
R. anatipestifer CCUG 25008 Serovar 10 CCUG
R. anatipestifer CCUG 25013 Serovar 11 CCUG
R. anatipestifer CCUG 25055 Serovar 12 CCUG
R. anatipestifer CCUG 25012 Serovar 13 CCUG
a

CCUG, Culture Collection of the University of Gothenburg.

TABLE 2.

Primers used in this study

Primers Sequence (5’−3’) Source
G148_RS04320 UPP1 CTGGGGGCGAAAAAAAATTGCC This study
G148_RS04320 UPP2 CCTGCCTGCGTGTAGCTGAAAAATACCAACCTAAAAACAAAGAGAACCG This study
ErmP1 CGGTTCTCTTTGTTTTTAGGTTGGTATTTTTCAGCTACACGCAGGCAGG This study
ErmP2 GCAAATATACAAATTTAAAAGCATCTACGAAGGATGAAATTTTTCAGG This study
G148_RS04320 DOWNP1 CCTGAAAAATTTCATCCTTCGTAGATGCTTTTAAATTTGTATATTTGC This study
G148_RS04320 DOWNP2 CAAACATTGCTGCTGATTGTCTC This study
G148_RS04320 P1 GCGACAAATTAGTATGGTTG This study
G148_RS04320 P2 CTACTTATCTAAAGACTCAAACACA This study
cG148_RS04320 P1 CATGCCATGGGCGACAAATTAGTATGGT This study
cG148_RS04320 P2 CCGCTCGAGCTACTTATCTAAAGACTCA This study

Whole genome sequencing and bioinformatics analyses

The whole-genome DNA was extracted by the Bacterial Genome Extraction Kit (Tiangen Biochemical Technology Co., Ltd, Beijing, China) according to the manufacturer’s instructions. Paired-end and PacBio libraries were constructed using the TruSeq DNA PCR-Free Sample Preparation Kit (Illumina, USA) and PacBio SMRTbell Template Prep Kit (Pacific Biosciences) following the manufacturer’s protocol. These libraries were sequenced using paired-end Illumina (Illumina HiSeq 2500) and PacBio (PacBio RS II platform). The genome was assembled by CANU (version 1.5) (16) with PacBio reads, and corrected twice using pilon (version 1.22) (17) with Illumina reads. The annotation was performed using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) (18). To investigate the genomic variation of RCAD0392 against RACH-2, snippy version 4.6.0 (https://github.com/tseemann/snippy, default parameters) was used to map the reads to RA-CH-2 genome (Refseq accession: NC_020125.1) and call variants. Large structural variations were detected using the breseq split-read analysis tool with default parameters (19).

Based on the description of the previous study (20), we predicted the capsular gene clusters. Briefly, we retrieved entries involving capsular polysaccharide synthesis from the Pfam database by searching for keywords (https://www.ebi.ac.uk/interpro/entry/pfam/, Table 3). Next, we searched for these pfam profiles in the R. anatipestifer genome using the HMMER 3.3.2 (e-value cutoff <1e-10). This allowed a CPS gene cluster to be clearly identified in the genome.

TABLE 3.

Accession and description of all protein profiles searched in R. anatipestifer genomes to identify putative CPS synthesis clusters

Pfam accession Protein name Pfam name Description Class of Pfam
PF00005.30 KpsT ABC_tran ABC transporter Capsule synthesis
PF01061.27 KpsM ABC2_membrane ABC-2 type transporter Capsule synthesis
PF05159.17 Capsule_synth Capsule polysaccharide biosynthesis protein Capsule synthesis
PF04932.18 Wzy Wzy_C Polymerase Capsule synthesis
PF13425.9 Wzy O-antigen_lig Polymerase Capsule synthesis
PF13440.9 Wzx Polysacc_synt_3 Flippase Capsule synthesis
PF14667.9 Wzx Polysacc_synt_C Flippase Capsule synthesis
PF02563.19 Wza (OMP) Poly_export Outer membrane export protein Capsule export
PF01451.24 Wzb LMWPc Low molecular weight phosphotyrosine protein phosphatase Capsule export
PF02706.18 Wzc (IMP) Wzz Chain length regulator Capsule export
PF13614.9 Wzc (IMP) AAA31 Translocation of macromolecules Capsule export
PF00535.29 Glycosyl transferase Glycos_transf_2 Glycosyl transferase family 2 Sugar modifying-enzymes
PF01370.24 Epimerase Epimerase NAD dependent epimerase/dehydratase family Sugar modifying-enzymes
PF16363.8 GDP-mannose 4,6 dehydratase GDP_Man_Dehyd GDP-mannose 4,6 dehydratase Sugar modifying-enzymes
PF00583.28 Acetyltransferase Acetyltransf_1 Acetyltransferase (GNAT) family Sugar modifying-enzymes
PF02397.19 Bacterial sugar transferase Bac_transf Bacterial sugar transferase Sugar modifying-enzymes
PF00483.26 Nucleotidyl transferase NTP_transferase Nucleotidyl transferase Sugar modifying-enzymes

Genome sequence and raw reads of RCAD0392 are available in the National Center for Biotechnology Information (NCBI) database with BioProject no. PRJNA487674.

Construction of CH-2 ΔG148_RS04320 and the complemented strain

Gene knockout was performed as previously described (21). Briefly, primers G148_RS04320 UP P1/P2 and G148_RS04320 DOWN P1/P2 (Table 2) were used to amplify the upstream homologous arm fragment and the downstream homologous arm fragment of the RA CH-2 G148_RS04320 gene, respectively. Primers ERM P1/P2 (Table 2) were used to amplify the erm fragment from the genome of RA CH-1. Three PCR fragments UED (G148_RS04320 upstream, the erm cassette, and G148_RS04320 downstream) were amplified using the overlap PCR method. The RA CH-2 strains were grown in GCB medium at 37°C and their bacterial density was adjusted to an OD600 of 1. Three hundred microliters of the bacterial suspension was placed inside a 1.5 mL sterilized tube, supplemented with the UED fragment (1.2 µg), and incubated for 30 minutes at 37°C. After incubating for 3 hours at 37°C, 300 µL of the mixture were plated onto erythromycin-supplemented plates and incubated overnight at 37°C. Single colonies grown on erythromycin plates were isolated and screened using PCR.

For gene complementation, the G148_RS04320 gene was amplified using primers cG148_RS04320 P1/P2 (Table 1). After purification, PCR products were digested with NcoI and XhoI endonuclease (Takara Biology Co., Ltd, Dalian, China), and then ligated into the shuttle plasmid pLMF03 (22) that was digested with the same endonuclease. The recombinant plasmid pLMF03::G148_RS04320 was transformed into competent Escherichia coli DH5α cells, which were spread on LB plate supplemented with ampicillin, cultured and screened. Subsequently, the recombinant plasmid was transformed into CH-2 ΔG148_RS04320 by natural transformation. The recombinant colonies grown on the erythromycin and ampicillin plate were isolated and screened, and the correct ones were preserved.

Capsule staining

To identify the R. anatipestifer capsule, we performed negative staining with India ink and observed under light microscopy, following the previously described protocol (23). Briefly, the colony was mixed on a glass slide with a drop of India ink and spread thinly over the whole slide. After drying the slide under air, we saturated it with 1% crystal violet for 2 minutes, washed gently with deionized water, and then dried naturally.

Transmission electron microscopy (TEM)

To prepare for TEM analysis, the overnight bacterial culture was collected and washed twice using phosphate-buffered saline (PBS). The pellet was fixed with 2.5% glutaraldehyde for 2 hours followed by resuspension, and addition of suspension onto a copper grid covered with a formvar membrane. Then, the formvar membrane was stained with 20 g/L phosphotungstic acid for 1 minute. Samples were observed and analyzed by transmission electron microscope using a JEOL JEM-2500SE instrument (EOL Co., Ltd, Tokyo, Japan).

Polysaccharide extraction

The extraction and purification of CPS was performed according to the previous description (24). Briefly, the overnight bacterial cultures were diluted to OD600 = 0.65 and centrifuged at 9,600 × g for 5 minutes. The supernatant was removed and the pellet was resuspended in 4 mL of lysis buffer containing 60 mM Tris (pH 8), 10 mM MgCl2, 50 µM CaCl2, and incubated at 37°C for 1 hour followed by three freeze-thaw cycles at −80/37°C. DNase and RNase were added to the sample, which was then incubated at 37°C for 30 minutes. Sodium dodecyl sulfate (SDS) was added to the sample and incubated at 37°C for an additional 30 minutes. After incubation, the sample was heated at 100°C for 10 minutes. Proteinase K was added, and the mixture was incubated at 60°C for 1 hour. Then, the mixture was centrifuged at 9,600 × g for 5 minutes and the supernatant was collected. Ethanol was added at three times the volume of the supernatant and incubated at −20°C overnight. The material was then centrifuged at 6,200 × g for 45 minutes at 4°C and the supernatant was discarded. The precipitate was dried at room temperature, resuspended in PBS, and subjected to ultracentrifugation (Thermo Fisher Scientific Co., Ltd, USA) at 100,000 × g for 2 hours. The supernatant containing the CPS was aspirated.

The extraction and purification of LPS were performed according to the previous description (25). Briefly, the overnight bacterial cultures were harvested and washed three times with 1 mL of PBS. The bacterial suspension was adjusted to OD600 = 1 and then centrifuged. The pellet was then resuspended in 150 µL of lysis buffer containing 60 mM Tris (pH 6.8), 2% SDS, 4% 2-mercaptoethanol, and 10% glycerol. The sample was boiled for 10 minutes. Proteinase K was added, and the mixture was incubated at 60°C for 1 hour.

SDS-PAGE

CPS samples were separated on a 10% SDS gel at 80 V for 30 minutes and then 120 V for 90 minutes. The gel was stained with Alcian blue to visualize the presence of CPS.

Agar-gel precipitin test

To study the antigen-antibody interaction, the agar-gel precipitin test was performed using 1% agarose gel. Agar (1 g) was added to 8.5% NaCl (100 mL) and the solution was boiled using a microwave oven. The agar solution was then poured into culture dishes, and the thickness of gel is 2–3 mm. Seven wells were created, with one in the center and six surrounding wells. Standard antisera or mouse sera (20 µL) was added to the central well, CPS or LPS (20 µL) extracted from different strains was added to the surrounding wells. The agar gel plates were then put in a wet box at 37°C for 24 hours under saturated humidity.

Serological slide agglutination test

Serovars were determined by slide agglutination test using standard serotyping antisera (RIPAC-LABOR GmbH, Potsdam, Germany) against R. anatipestifer. In brief, 10 µL of the standard antiserum for R. anatipestifer serotyping was mixed with 10 µL bacteria suspension. The reaction was recorded as positive when clumping of bacteria was observed, while a negative reaction in a turbid liquid. When a strain produces agglutination reactions with multiple (more than one) antisera of different serovars, it is considered as cross-agglutination.

Preparation of anti-CPS positive serum

Six specific-pathogen-free female Kunming mice (Dashuo Science and Technology Co., Ltd., China) aged 6–8 weeks old and weighing 18–22 g, with similar body conditions, were randomly divided into three groups. Groups of two mice were immunized intraperitoneal with the appropriate antigen on day 0 and boosts were administered on days 7 and 14. Immunization groups were as follows: CPS (500 µg/mL); CPS (1 mg/mL). The control mice were immunized with sterile normal saline. Mice were blood collected, 7 days after the last immunization. According to NC3Rs (26), blood samples were obtained through retro-orbital bleeding after anesthesia. All animal experiments were approved by the Animal Ethics Committee of the Sichuan Agricultural University (approval 2022–031).

RESULTS

Identification and mutational analysis of the putative CPS synthesis gene cluster

We identified a CPS synthesis gene cluster, which contained three well-characterized genes, wza, wzc, and wzx. These genes predicted to encode outer membrane polysaccharide export proteins, protein-tyrosine kinase, and oligosaccharide flippase, respectively (Fig. 1A). Further genomic analysis revealed that the gene cluster locus was conserved across serovars (Fig. S1), with the recX gene located upstream and the rimO gene located downstream of this gene cluster (Fig. 1).

Fig 1.

Fig 1

Identification and mutational analysis of the CPS synthesis gene cluster. (A) Distribution of CPS synthesis-related genes in the CH-2 genome indicates a putative CPS gene cluster. (B) A deletion disrupts the D1J34_RS08130 gene in the CPS gene cluster of RCAD0392. (C) Multiple sequence alignment of the active site region of G148_RS04320 with other CpsE proteins.

To explore the genetic basis of cross-agglutination in strain RCAD0392, we focused on the genetic variation in its CPS synthesis gene cluster. Genome-wide variant calling (only 3963 variants with 2852 synonymous mutations, Table S1) indicated considerable genomic identity between RCAD0392 and RA CH-2. We found that a base deletion disrupts the D1J34_RS08130 gene (corresponding to G148_RS04320 of RA CH-2, Fig. 1B), which predicted to encode a polysaccharide biosynthesis protein that shared 42.77% identity and 96% coverage with the Streptococcus suis CPS synthesis protein CpsE (APZ79231.1) (Fig. 1C). Sequence alignment indicated that G148_RS04320 protein had a conserved active site of CpsE (27 29).

Deletion of G148_RS04320 causes R. anatipestifer to cross agglutinate

To investigate the role of D1J34_RS08130 gene (corresponding to G148_RS04320 of RA CH-2) in cross-agglutination of the isolate RCAD0392, we constructed a mutant strain (CH-2ΔG148_RS04320) and complementation strain (cCH-2ΔG148_RS04320). We successfully constructed both strains, as confirmed by PCR amplification (Fig. S2). Slide agglutination assays showed that the CH-2 ΔG148_RS04320 strain could agglutinate with multiple antisera (Fig. 2), similar to RCAD0392, whereas the CH-2 and cCH-2 ΔG148_RS04320 strains only agglutinate with serotype 2 antisera (Fig. S3). These results suggested that deletion of G148_RS04320 gene could cause changes of the surface polysaccharide antigens and thus affect serological-related phenotypes, leading to cross-agglutination.

Fig 2.

Fig 2

Slide agglutination. Standard antiserum 1–3, 5, 6, and 8–13 for R. anatipestifer were mixed with bacterial suspension (RCAD0392, CH-2 ΔG148_RS04320, and positive strains). The numbers in the top left corner of each small picture indicate standard antiserum 1–3, 5, 6, and 8–13. The CH-2 ΔG148_RS04320 and RCAD0392 strains could agglutinate with all antiserum. The positive strains of types 1–3, 5 ,6, and 8–13 serum were, respectively, CCUG 18373, CCUG 25001, CCUG 25002, CCUG 25004, CCUG 25005, CCUG 25054, CCUG 25006, CCUG 25008, CCUG 25013, CCUG 25055, and CCUG 25012.

Deletion of G148_RS04320 gene leads to capsule deficiency in R. anatipestifer

To confirm the presence of the capsule, India ink staining and transmission electron microscopy were used to visualize the capsule on the surface of R. anatipestifer strains. As shown in Fig. 3A, The CH-2 and cCH-2 ΔG148_RS04320 strains were surrounded by a clear and transparent halo, indicating the presence of a capsule, while the CH-2 ΔG148_RS04320 strain was surrounded by a smaller halo or even no halo. TEM images also supported the presence of a capsule in CH-2 and cCH-2 ΔG148_RS04320 strains (Fig. 3B). Conversely, no capsule was detected for CH-2 ΔG148_RS04320. The result indicates that G148_RS04320 gene is involved in the capsule biosynthesis.

Fig 3.

Fig 3

Deletion of G148_RS04320 results in capsule deficiency. (A) Capsule stain. Light microscopy observation of CH-2, CH-2 ΔG148_RS04320, and cCH-2 ΔG148_RS04320 stained by India ink and crystal violet. Capsule was visible as a clear halo surrounding bacterial cells. (B) Transmission electron microscopy. TEM images of the CH-2, CH-2 ΔG148_RS04320, and cCH-2 ΔG148_RS04320 stained by phosphotungstic acid. The CH-2 and cCH-2 ΔG148_RS04320 strains were capsulated, while the CH-2 ΔG148_RS04320 strain was deficient in the ability to form a capsule.

LPS enables cross-agglutination of R. anatipestifer

To confirm the crucial role of LPS in cross-agglutination of R. anatipestifer, we extracted LPS from CCUG 25001 (serovar 2), CH-2, CH-2ΔG148_RS04320, cCH2ΔG148-RS04320 and RCAD0392 and analyzed them using agar-gel precipitin test (AGPT). The results showed that antisera 2 produced a precipitation line in agarose gels with LPS extracts of these five strains (Fig. 4), indicating that LPS extracts from these five strains were capable of binding to the anti-type 2 antisera. Therefore, we suspected that LPS may be a common antigen without serovar specificity. To further confirm our hypothesis, we performed AGPT using the LPS of strains CH-2, CH-2ΔG148_RS04320, cCH2ΔG148-RS04320, RCAD0392, CCUG 25004 (serovar 5), CCUG 25005 (serovar 6), and CCUG 25008 (serovar 10) with the types 5, 6, and 10 antisera. The results demonstrated that LPS extraction from all strains produced a fused precipitation line in the agarose gel with the types 5, 6, and 10 antisera (Fig. 4; Table S2), indicating that LPS could bind to a wide range of antisera and was a common antigen rather than a specific antigen determining the serotype.

Fig 4.

Fig 4

Agar-gel precipitin analysis of LPS with the antisera types 2, 5, 6, and 10. The central hole shows the standard types 2, 5, 6, and 10 antisera. The peripheral holes are labeled with roman numbers I–VII and represent LPS extractions from CCUG 25001 (serotype 2), CH-2, CH-2ΔG148_RS04320, cCH-2ΔG148_RS04320, RCAD0392, CCUG 250–04 (serotype 5), CCUG 25005 (serotype 6), and CCUG 25008 (serotype 10), respectively; hole IX shows physiological saline.

CPS determines R. anatipestifer serotype

To validate the relationship between CPS and R. anatipestifer serological phenotype, CPS extracts from CH-2, CH-2ΔG148_RS04320, cCH2ΔG148-RS04320, and RCAD0392 were analyzed by SDS-PAGE and Alcian blue. As shown in Fig. 5, all four strains exhibited a capsular-like polysaccharide. The CPS of the high molecular weight is reduced in lane 2. Then, AGPT analysis of CPS extraction revealed that antisera 2 could only form a precipitation line with the CPS of CH-2, cCH-2ΔG148_RS04320 strains but not CH2ΔG148-RS04320 and RCAD0392 strains (Fig. 6). Furthermore, antisera 1 and 3–13 did not produced any precipitation lines with the CPS samples of the four stains (data not shown). These results suggested that the CPS of R. anatipestifer was serovar-specific and only bound to the corresponding antisera.

Fig 5.

Fig 5

Analysis of CPS expression in R. anatipestifer strains. CPS was separated on a 10% SDS-PAGE and stained with Alcian blue. Line 1, CH-2; line 2, CH-2ΔG148_RS04320; line 3, cCH-2ΔG148_RS04320; line 4, RCAD0392.

Fig 6.

Fig 6

Agar-gel precipitin analysis of CPS with antisera. The central hole shows the standard types 2, 5, 6, and 10 antisera. The peripheral holes are labeled with roman numbers I–VII and represent CPS extractions from CH-2, CH-2ΔG148_RS04320, cCH-2ΔG148_RS04320, RCAD0392, CCUG 25004 (serotype 5), CCUG 25005 (serotype 6), and CCUG 25008 (serotype 10), respectively; hole VIII: physiological saline.

To further validate this finding, CPS extracts from CCUG 25004, CCUG 25005, and CCUG 25008 were analyzed using AGPT. Types 5, 6, and 10 antisera could only form a precipitation line with the CPS of CCUG 25004 (serovar 5) CCUG 25005 (serovar 6), and CCUG 25008 (serovar 10), respectively (Fig. 6). This finding supports our hypothesis that each known serotype of R. anatipestifer corresponds to a specific CPS.

To confirm that CPS was the specific antigen responsible for R. anatipestifer serotyping, CPS from CH-2 was used to immunize mice and obtain antisera. AGPT using the obtained mouse serum was used as antibody and the CPS extracts from CH-2, CH-2ΔG148_RS04320, cCH2ΔG148-RS04320, and RCAD0392 as antigen. As expected, the antisera produced a precipitation line only with the CPS of CH-2 and cCH-2ΔG148_RS04320 (Fig. 7). These results indicated that CPS was a specific antigen that determined R. anatipestifer serotyping.

Fig 7.

Fig 7

Agar-gel precipitin analysis of CPS with anti-CPS serum. The central hole shows the anti-CPS serum. The peripheral holes are labeled with roman numbers I–IV and represent CPS extractions from CH-2, CH-2ΔG148_RS04320, cCH-2ΔG148_RS04320, and RCAD0392. Hole V: physiological saline.

DISCUSSION

As we all know, a wide variety of bacteria can be serotyped based on their polysaccharides. Currently, there are up to 21 serotypes of R. anatipestifer, and serotyping is still based on traditional serological agglutination tests (1). However, the exact polysaccharide(s) that determine R. anatipestifer serotype is still unknown (11). In this study, we determined that the CPS is the polysaccharide antigen that determines the serotyping of R. anatipestifer, and found that the LPS of R. anatipestifer mediates cross-agglutination with antisera in the absence of the capsule on the surface.

In this study, the CPS gene cluster of R. anatipestifer was found to be located between recX and rimO genes, and the CPS locus of different serovars were also located between this gene pair. Notably, the CPS locus of Elizabethkingia anophelis, another member of the Weeksellaceae family, is also located downstream of the conserved recX gene (20). This is similar to several other species where the CPS locus lies between conserved gene pairs in the genome (30). R. anatipestifer is generally not prone to cross-agglutination with heterologous antisera. However, in this study, we isolated a naturally occurring strain, RCAD0392, which exhibited cross-agglutination properties. Further analysis revealed that the CPS of RCAD0392 is almost identical (Identity >99%) to that of the closely related strain RA CH-2 (31), except for a frameshift mutation in the D1J34_RS08130 gene (corresponding to G148_RS04320 of RA CH-2), resulting in a disrupted coding region. Thus, we constructed a deletion strain of gene G148_RS04320 (homolog of D1J34_RS08130) in RA CH-2, which was also able to cross-agglutinate with a variety of antisera, while the complement strain regained serological reaction specificity. This indicated that the appearance of the cross-agglutination phenotype of RA CH-2 was indeed due to the mutation in G148_RS04320 gene. Since vaccines are only effective against homologous serotypes of R. anatipestifer (2), the mutations that cause the capsule defect could potentially facilitate evasion of host-specific immune stress. However, the loss of the physical barrier function of the capsule could make bacteria more susceptible to common environmental stresses, such as antibiotics.

Gene G148_RS04320 is homologous to gdr in Acinetobacter baumannii, cpsE in Streptococcus suis, and gene pglF in Campylobacter jejuni. In Acinetobacter baumannii (32), Streptococcus suis (33), and Campylobacter jejuni (34), this gene encodes UDP-N-acetyl-glucosamine dehydratase, which is associated with CPS biosynthesis. Wang et al. (35) found that the bacterial morphology of the AS87_04050 mutant strain was converted from the smooth type of the wild strain to the rough type. After BLAST, the gene AS87_04050 is also found to be on the CPS synthesis gene cluster. This represents a typical morphological alteration associated with the loss of capsule (36). Yi et al. (37) found that deletion of the gene wza on the RA CH-1 CPS synthesis gene cluster resulted in capsule defects. In addition, Smith et al. (38) found that the capsule was not detectable on the surface of cpsΔEF and that the parent strain agglutinated only with type 2 antisera, while the mutant strain agglutinated with all antisera. The present study observed that deletion of gene G148_RS04320 also resulted in the disappearance of the capsule on the surface of RA CH-2, as shown by India ink staining and transmission electron microscopy. However, the complementation strain (cCH2ΔG148-RS04320) gave only partly phenotypic complementation, which may be due to the relatively low replication and expression levels of plasmids used for complementary strain. For the mutant strain (CH-2 ΔG148_RS04320), the loss of the capsule on the surface of the bacteria exposes surface antigens that would otherwise be masked by the capsule, suggesting that the agglutination of the CH-2 ΔG148_RS04320 strain with multiple sera must be caused by its binding to polysaccharides other than CPS. This finding was consistent with previous studies (37, 38) that showed that deletion of genes in the CPS synthesis gene cluster resulted in capsule defects and the exposure of surface antigens.

We extracted LPS of CH-2, CH-2ΔG148_RS04320, cCH2ΔG148-RS04320, and RCAD0392; all of which produced precipitated lines when reacted with types 2, 5, 6, and 10 antisera. This result suggested that LPS was a common antigen rather than a specific antigen that determined serological characteristics. Yang et al. (39) found that immunizing mice with capsular reduced mutant strains can produce cross-protection against different serovars of Pasteurella multocida, which may be due to the effect of their surface cross antigens. Therefore, the ability of the capsule-deficient strain (CH-2ΔG148_RS04320) in this study to undergo cross-agglutination may be due to the exposed LPS antigens binding with multiple antisera.

We also extracted CPS of CH-2, CH-2ΔG148_RS04320, cCH2ΔG148-RS04320, and RCAD0392 and analyzed them using Alcian blue, which has been used to stain the CPS of many bacterial species (40). Although the results indicated the presence of CPS components in the mutant strain (CH-2ΔG148_RS04320), there was an increase in low molecular weight CPS components compared to the wild type (CH-2). Furthermore, only CPS extracts from the wild-type and complemented strains exhibited specific reactions with type 2 antisera. This suggested that the deletion of the G148_RS04320 gene resulted in the inability of bacteria to synthesize complete CPS molecules. Instead, intermediate products of CPS synthesis accumulate within the cells, preventing the formation of a complete surface capsule structure. The CPS extracts from other strains of different serovars also showed specific reactions with their respective homologous antisera. This was further confirmed by AGPT using antisera against CPS.

In conclusion, we demonstrated that the G148_RS04320 gene is involved in CPS biosynthesis and that the serovars of R. anatipestifer are distinguished by CPS. This study has provided a preliminary exploration of the molecular basis related to serotyping in R. anatipestifer and suggests possible directions for further investigation of the genetic basis of serotypes in this bacterium.

ACKNOWLEDGMENTS

This work was supported by the Sichuan Science and Technology Program (2020YJ0330); Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2021–18); Earmarked Fund for China Agriculture Research System (CARS-42–17).

Contributor Information

Anchun Cheng, Email: chenganchun@vip.163.com.

Dekang Zhu, Email: zdk24@sicau.edu.cn.

Artem S. Rogovskyy, Texas A&M University, College Station, Texas, USA

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/spectrum.01804-23.

Fig. S1 to S3. spectrum.01804-23-s0001.doc.

Fig. S1 (Gene cluster locus was conserved across serovars), S2 (Identification of G148_RS04320 deletion and complementation strain), and S3 (Slide agglutination of CH-2 and cCH-2ΔG148_RS04320).

DOI: 10.1128/spectrum.01804-23.SuF1
Tables S1 and S2. spectrum.01804-23-s0002.xlsx.

Tables S1 (The variations [SNPs, INDELs, and large structural variations] between RCAD0392 and RA-CH-2) and S2 (Agar-gel precipitin analysis).

DOI: 10.1128/spectrum.01804-23.SuF2

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

  • 1. Omaleki L, Blackall PJ, Bisgaard M, Turni C. 2021. Molecular and serological characterization of Riemerella isolates associated with poultry in Australia. Avian Pathol 50:31–40. doi: 10.1080/03079457.2020.1828568 [DOI] [PubMed] [Google Scholar]
  • 2. Sandhu T. 1979. Immunization of white Pekin Ducklings against Pasteurella Anatipestifer infection. Avian Dis 23:662–669. doi: 10.2307/1589742 [DOI] [PubMed] [Google Scholar]
  • 3. Fang CT, Shih YJ, Cheong CM, Yi WC. 2016. Rapid and accurate determination of lipopolysaccharide O-antigen types in Klebsiella pneumoniae with a novel PCR-based O-Genotyping method. J Clin Microbiol 54:666–675. doi: 10.1128/JCM.02494-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Xi D, Wang X, Ning K, Liu Q, Jing F, Guo X, Cao B. 2019. O-antigen gene clusters of Plesiomonas shigelloides serogroups and its application in development of a molecular serotyping scheme. Front Microbiol 10:741. doi: 10.3389/fmicb.2019.00741 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bentley SD, Aanensen DM, Mavroidi A, Saunders D, Rabbinowitsch E, Collins M, Donohoe K, Harris D, Murphy L, Quail MA, Samuel G, Skovsted IC, Kaltoft MS, Barrell B, Reeves PR, Parkhill J, Spratt BG. 2006. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet 2:e31. doi: 10.1371/journal.pgen.0020031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Okura M, Takamatsu D, Maruyama F, Nozawa T, Nakagawa I, Osaki M, Sekizaki T, Gottschalk M, Kumagai Y, Hamada S. 2013. Genetic analysis of capsular polysaccharide synthesis gene clusters from all Serotypes of Streptococcus suis: potential mechanisms for generation of capsular variation. Appl Environ Microbiol 79:2796–2806. doi: 10.1128/AEM.03742-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Harper M, Boyce JD, Adler B. 2012. The key surface components of Pasteurella multocida: capsule and lipopolysaccharide. Curr Top Microbiol Immunol 361:39–51. doi: 10.1007/82_2012_202 [DOI] [PubMed] [Google Scholar]
  • 8. Orskov I, Fife-asbury MA. 1977. New Klebsiella capsular antigen, K82, and the deletion of five of those previously assigned. Internat J System Bacteri 27:386–387. doi: 10.1099/00207713-27-4-386 [DOI] [Google Scholar]
  • 9. Heddleston KL, Gallagher JE, Rebers PA. 1972. Fowl cholera: GEL diffusion precipitin test for Serotyping Pasteruella Multocida from avian species. Avian Dis 16:925–936. doi: 10.2307/1588773 [DOI] [PubMed] [Google Scholar]
  • 10. Brogden KA, Rhoades KR, Heddleston KL. 1978. A new serotype of Pasteurella multocida associated with fowl cholera. Avian Dis 22:185–190. doi: 10.2307/1589525 [DOI] [PubMed] [Google Scholar]
  • 11. Brogden KA, Rhoades KR, Rimler RB. 1982. Serologic types and physiologic characteristics of 46 avian Pasteurella anatipestifer cultures. Avian Dis 26:891–896. doi: 10.2307/1589877 [DOI] [PubMed] [Google Scholar]
  • 12. Zou J, Wang X, Ding C, Tian M, Han X, Wang S, Yu S. 2015. Characterization and cross-protection evaluation of M949_1603 gene deletion Riemerella anatipestifer mutant RA-M1. Appl Microbiol Biotechnol 99:10107–10116. doi: 10.1007/s00253-015-6848-y [DOI] [PubMed] [Google Scholar]
  • 13. Dou Y, Wang X, Yu G, Wang S, Tian M, Qi J, Li T, Ding C, Yu S. 2017. Disruption of the M949_Rs01915 gene changed the bacterial lipopolysaccharide pattern, pathogenicity and gene expression of Riemerella anatipestifer. Vet Res 48:6. doi: 10.1186/s13567-017-0409-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Dou Y, Yu G, Wang X, Wang S, Li T, Tian M, Qi J, Ding C, Yu S. 2018. The Riemerella anatipestifer M949_Rs01035 gene is involved in bacterial lipopolysaccharide biosynthesis. Vet Res 49:93. doi: 10.1186/s13567-018-0589-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Li T, Shan M, Liu L, Zhao Y, Qi J, Tian M, Wang S, Wu Z, Yu S. 2020. Characterization of the Riemerella anatipestifer M949_Rs00050 gene. Vet Microbiol 240:108548. doi: 10.1016/j.vetmic.2019.108548 [DOI] [PubMed] [Google Scholar]
  • 16. Koren S, Walenz BP, Berlin K, Miller JR, Bergman NH, Phillippy AM. 2017. Canu: scalable and accurate long-read assembly via adaptive K-MER weighting and repeat separation . Genome Res. 27:722–736. doi: 10.1101/gr.215087.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo CA, Zeng Q, Wortman J, Young SK, Earl AM. 2014. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One 9:e112963. doi: 10.1371/journal.pone.0112963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Li W, O’Neill KR, Haft DH, DiCuccio M, Chetvernin V, Badretdin A, Coulouris G, Chitsaz F, Derbyshire MK, Durkin AS, Gonzales NR, Gwadz M, Lanczycki CJ, Song JS, Thanki N, Wang J, Yamashita RA, Yang M, Zheng C, Marchler-Bauer A, Thibaud-Nissen F. 2021. Refseq: expanding the prokaryotic genome annotation pipeline reach with protein family model curation. Nucleic Acids Research 49:D1020–D1028. doi: 10.1093/nar/gkaa1105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Barrick JE, Colburn G, Deatherage DE, Traverse CC, Strand MD, Borges JJ, Knoester DB, Reba A, Meyer AG. 2014. Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq. BMC Genomics 15:1039. doi: 10.1186/1471-2164-15-1039 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Perrin A, Larsonneur E, Nicholson AC, Edwards DJ, Gundlach KM, Whitney AM, Gulvik CA, Bell ME, Rendueles O, Cury J, Hugon P, Clermont D, Enouf V, Loparev V, Juieng P, Monson T, Warshauer D, Elbadawi LI, Walters MS, Crist MB, Noble-Wang J, Borlaug G, Rocha EPC, Criscuolo A, Touchon M, Davis JP, Holt KE, McQuiston JR, Brisse S. 2017. Evolutionary dynamics and genomic features of the Elizabethkingia anophelis 2015 to 2016 Wisconsin outbreak strain. Nat Commun 8:15483. doi: 10.1038/ncomms15483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Liu MaFeng, Zhang L, Huang L, Biville F, Zhu D, Wang M, Jia R, Chen S, Sun K, Yang Q, Wu Y, Chen X, Cheng A, Dozois CM. 2017. Use of natural transformation to establish an easy knockout method in Riemerella anatipestifer. Appl Environ Microbiol 83. doi: 10.1128/AEM.00127-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Liu M, Wang M, Zhu D, Wang M, Jia R, Chen S, Sun K, Yang Q, Wu Y, Chen X, Biville F, Cheng A. 2016. Investigation of TBFA in Riemerella anatipestifer using plasmid-based methods for gene over-expression and knockdown. Sci Rep 6:37159. doi: 10.1038/srep37159 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Breakwell DP, Moyes RB, Reynolds J. 2009. Differential staining of bacteria: capsule stain. CP Microbiology 15. doi: 10.1002/9780471729259.mca03is15 [DOI] [PubMed] [Google Scholar]
  • 24. Tipton KA, Rather PN. 2019. Extraction and visualization of capsular polysaccharide from Acinetobacter baumannii. Methods Mol Biol 1946:227–231. doi: 10.1007/978-1-4939-9118-1_21 [DOI] [PubMed] [Google Scholar]
  • 25. Zou J, Wang X, Tian M, Cao S, Hou W, Wang S, Han X, Ding C, Yu S. 2015. The M949_1556 gene plays a role on the bacterial antigenicity and pathogenicity of Riemerella anatipestifer. Vet Microbiol 177:193–200. doi: 10.1016/j.vetmic.2015.03.003 [DOI] [PubMed] [Google Scholar]
  • 26. eBioMedicine . 2022. The 3RS of animal research. EBioMedicine 76:103900. doi: 10.1016/j.ebiom.2022.103900 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kavanagh KL, Jörnvall H, Persson B, Oppermann U. 2008. Medium- and short-chain dehydrogenase/reductase gene and protein families: the SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cell Mol Life Sci 65:3895–3906. doi: 10.1007/s00018-008-8588-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ishiyama N, Creuzenet C, Miller WL, Demendi M, Anderson EM, Harauz G, Lam JS, Berghuis AM. 2006. Structural studies of FlaA1 from Helicobacter pylori reveal the mechanism for Inverting 4,6-dehydratase activity. J Biol Chem 281:24489–24495. doi: 10.1074/jbc.M602393200 [DOI] [PubMed] [Google Scholar]
  • 29. Persson B, Kallberg Y, Oppermann U, Jörnvall H. 2003. Coenzyme-based functional assignments of short-chain dehydrogenases/reductases (SDRs). Chem Biol Interact 143–144:271–278. doi: 10.1016/s0009-2797(02)00223-5 [DOI] [PubMed] [Google Scholar]
  • 30. Yother J. 2011. Capsules of Streptococcus pneumoniae and other bacteria: paradigms for polysaccharide biosynthesis and regulation. Annu Rev Microbiol 65:563–581. doi: 10.1146/annurev.micro.62.081307.162944 [DOI] [PubMed] [Google Scholar]
  • 31. Wang X, Liu W, Zhu D, Yang L, Liu M, Yin S, Wang M, Jia R, Chen S, Sun K, Cheng A, Chen X. 2014. Comparative genomics of Riemerella anatipestifer reveals genetic diversity. BMC Genomics 15:479. doi: 10.1186/1471-2164-15-479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Kenyon JJ, Marzaioli AM, De Castro C, Hall RM. 2015. 5,7-di-N-acetyl-acinetaminic acid: a novel non-2-ulosonic acid found in the capsule of an Acinetobacter baumannii isolate. Glycobiology 25:644–654. doi: 10.1093/glycob/cwv007 [DOI] [PubMed] [Google Scholar]
  • 33. Goyette-Desjardins G, Vinogradov E, Okura M, Takamatsu D, Gottschalk M, Segura M. 2018. Streptococcus suis serotype 3 and serotype 18 capsular polysaccharides contain di-N-acetyl-bacillosamine. Carbohydr Res 466:18–29. doi: 10.1016/j.carres.2018.07.003 [DOI] [PubMed] [Google Scholar]
  • 34. Schoenhofen IC, McNally DJ, Vinogradov E, Whitfield D, Young NM, Dick S, Wakarchuk WW, Brisson J-R, Logan SM. 2006. Functional characterization of dehydratase/aminotransferase pairs from helicobacter and campylobacter: enzymes distinguishing the pseudaminic acid and bacillosamine biosynthetic pathways. J Biol Chem 281:723–732. doi: 10.1074/jbc.M511021200 [DOI] [PubMed] [Google Scholar]
  • 35. Wang X, Ding C, Wang S, Han X, Hou W, Yue J, Zou J, Yu S, Hozbor DF. 2014. The AS87_04050 gene is involved in bacterial lipopolysaccharide biosynthesis and pathogenicity of Riemerella anatipestifer. PLoS One 9:e109962. doi: 10.1371/journal.pone.0109962 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Paton JC, Trappetti C. 2019. Streptococcus pneumoniae capsular polysaccharide. Microbiol Spectr 7. doi: 10.1128/microbiolspec.GPP3-0019-2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Yi H, Yuan B, Liu J, Zhu D, Wu Y, Wang M, Jia R, Sun K, Yang Q, Chen S, Liu M, Chen X, Cheng A. 2017. Identification of a Wza-like gene involved in capsule biosynthesis, pathogenicity and biofilm formation in Riemerella anatipestifer. Microb Pathog 107:442–450. doi: 10.1016/j.micpath.2017.04.023 [DOI] [PubMed] [Google Scholar]
  • 38. Smith HE, Damman M, van der Velde J, Wagenaar F, Wisselink HJ, Stockhofe-Zurwieden N, Smits MA. 1999. Identification and characterization of the cps locus of Streptococcus suis serotype 2: the capsule protects against phagocytosis and is an important virulence factor. Infect Immun 67:1750–1756. doi: 10.1128/IAI.67.4.1750-1756.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Yang Y, Hu P, Gao L, Yuan X, Hardwidge PR, Li T, Li P, He F, Peng Y, Li N. 2021. Deleting qseC downregulates virulence and promotes cross-protection in pasteurella multocida. Vet Res 52:140. doi: 10.1186/s13567-021-01009-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Renzi F, Ittig SJ, Sadovskaya I, Hess E, Lauber F, Dol M, Shin H, Mally M, Fiechter C, Sauder U, Chami M, Cornelis GR. 2016. Evidence for a LOS and a capsular polysaccharide in Capnocytophaga canimorsus. Sci Rep 6:38914. doi: 10.1038/srep38914 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 to S3. spectrum.01804-23-s0001.doc.

Fig. S1 (Gene cluster locus was conserved across serovars), S2 (Identification of G148_RS04320 deletion and complementation strain), and S3 (Slide agglutination of CH-2 and cCH-2ΔG148_RS04320).

DOI: 10.1128/spectrum.01804-23.SuF1
Tables S1 and S2. spectrum.01804-23-s0002.xlsx.

Tables S1 (The variations [SNPs, INDELs, and large structural variations] between RCAD0392 and RA-CH-2) and S2 (Agar-gel precipitin analysis).

DOI: 10.1128/spectrum.01804-23.SuF2

Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES