PRMT5 regulates the polysaccharide content by controlling the splicing of thaumatin-like protein in Ganoderma lucidum

ABSTRACT

In the current study, the silencing of protein arginine methyltransferase 5 (PRMT5) decreased the polysaccharide content of Ganoderma lucidum compared to that of the wild-type (WT) strain. Furthermore, RNA-seq screening showed that the glycan degradation process-related gene thaumatin-like protein (TLP) was alternatively spliced in WT strains via retained introns, leading to the production of a longer TLP1 isoform and a shorter TLP2 isoform; however, only the TLP2 isoform was observed in PRMT5i strains. Experiments examining the polysaccharide content of the TLP silencing, TLP1 overexpression (OE-TLP1), and TLP2 overexpression (OE-TLP2) transformants revealed that TLP2 plays a more important role than TLP1 in polysaccharide degradation. Through a combination of yeast two-hybrid, bimolecular fluorescence complementation and surface plasmon resonance assays, we found that TLP2 directly physically interacted with phosphoglucose isomerase (PGI), a key enzyme in polysaccharide synthesis, and thereby increased PGI activity. However, TLP1 failed to interact with PGI, and PGI activity was not affected. Further inspection showed that the polysaccharide content was decreased in the OE-TLP2 strains but not significantly changed in the OE-TLP1 strains compared with that in the WT strains. In addition, the polysaccharide content of the PRMT5-TLP-cosilenced strains was not significantly different from that of the WT strains. These results demonstrate that PRMT5 modulates TLP processing of pre-mRNA transcripts and thereby decreases the polysaccharide content.

IMPORTANCE

PRMT5 contributes to secondary metabolite biosynthesis in Ganoderma lucidum. However, the mechanism through which PRMT5 regulates the biosynthesis of secondary metabolites remains unclear. In the current study, PRMT5 silencing led to a significant decrease in the biosynthesis of polysaccharides from G. lucidum through the action of the alternative splicing of TLP. A shorter TLP2 isoform can directly bind to PGI and regulated polysaccharide biosynthesis. These results suggest that PRMT5 enhances PGI activity by regulating TLP binding to PGI. The results of the current study reveal a novel target gene for PRMT5-mediated alternative splicing and provide a reference for the identification of PRMT5 regulatory target genes.

INTRODUCTION

Protein arginine methyltransferase 5 (PRMT5) is the primary type II arginine methyltransferase and the major enzyme responsible for the mono- and symmetric dimethylation of histones and nonhistone substrates. Its histone substrates, including arginine 3 of histone H4 (H4R3), arginine 2 of histone H3, arginine 8 of histone H3, and arginine 3 of histone H2A, are involved in gene expression and protein–protein interactions (1). Its nonhistone substrates include three subunits of the survival of motor neuron complex (SmB, SmD1, and SmD3) that are involved in the assembly of small nuclear ribonucleoproteins (snRNPs), which are essential components of the spliceosome machinery (2). PRMT5 activity is essential in a wide range of biological processes, including cellular growth and differentiation, chromatin regulation, transcript splicing, and cell signaling through histone and nonhistone modification (3). RNA interference-mediated depletion of PRMT5 in planarian stem cells results in a reduced organism size and increases in the transposon and repetitive element transcript levels (4). Mutation of the Arabidopsis PRMT5 protein reduces the shoot regeneration rate by decreasing the frequency and capacity of shoot regeneration and the number of shoots per callus (5). In contrast to animals and plants, only a few studies have investigated PRMT5 in fungi. Skb1 (a homolog of mammalian PRMT5) is needed for the normal cell viability and polarity of fission yeast in a hyperosmotic medium (6). Disruption of Hsl7 (a homolog of mammalian PRMT5) increases the cell length and filamentous response under low-ammonium conditions in the plant pathogen Ustilago maydis (7). Previous research has also shown that PRMT5 contributes to secondary metabolite pigment biosynthesis in Penicillium expansum (8). This area of research has attracted widespread interest. However, the mechanism through which PRMT5 regulates the biosynthesis of secondary metabolites remains unclear.

Mechanistic studies have revealed two major modes of PRMT5 action. The direct induction of histone methylation is involved in multiple physiological processes. For example, the symmetric methylation of histone H4R3 by PRMT5 modulates oligodendrocyte differentiation and developmental myelination (9). PRMT5 also regulates physiological functions through methylation of nonhistone substrates. For example, PRMT5 inhibition alters the methylation status of the E2F1 protein, leading to DNA damage repair attenuation, cell cycle arrest, and increased apoptosis (10). Another physiological function that is regulated by PRMT5 through nonhistone substrate methylation is spliceosome methylation, which is a global requirement for pre-mRNA splicing and is involved in many physiological processes (11). PRMT5 promotes the methylation of Sm spliceosomal proteins and significantly alters the spliced repertoire of mouse double minute four and euchromatic histone lysine N-methyltransferase 2 RNAs in mammalian embryonic cells and primordial cells (12). Moreover, PRMT5 is needed for methylation of the Sm spliceosome and affects EIF4E activity, and the OGT intron retention interface impairs the growth of tumor cells (13). Loss of PRMT5 function-induced chilling-sensitive 3 mRNA splicing results in enhanced resistance of Arabidopsis thaliana to the virulent oomycete pathogen Hyaloperonospora arabidopsidis (14). Arabidopsis PRMT5 mutants regulate shoot regeneration via abnormal pre-mRNA splicing during related to KPC1 and KIP-related protein gene transcription (5). There is a need to identify and verify additional new target genes and to confirm the mechanisms through which PRMT5 regulates secondary metabolite biosynthesis.

Thaumatin-like protein (TLP) belongs to a family of pathogenesis-related proteins that share high sequence homology with thaumatin, an intensely sweet-tasting disulfide protein that was originally identified in the fruit of the shrub Thaumatococcus daniellii (15). TLP itself does not have a sweet taste, but as a member of the PR-5 gene family, TLP is associated with a broad range of growth, development, stress responses and host defenses in plants, fungi, and animals (16). The TLP1 gene expression level of medium-size plants possibly contributes to generative organ development in Corydalis cava (17). The TLP expression level in broccoli is significantly higher under salt and drought stress conditions, and transgenic plants overexpressing TLP exhibit high salt and drought tolerance (18). TLP not only plays a critical role in the stress response but also is considered an important antimicrobial. Transcriptome sequencing of highly resistant and susceptible tomato (Solanum lycopersicum) varieties identified TLP as a candidate gene for resistance against late blight (19). TLP expression is induced during the wheat defense response to leaf rust attack and increases antifungal activity against Puccinia triticina (10). Much research on TLP has focused on its role in plants, and relatively few studies have focused specifically on the function of TLP in fungi. The expression of TLPs of Polyporales is upregulated in response to pine and aspen, suggesting that they may be new candidate factors in wood decomposition (20). TLP purified from the Lentinula edodes fruiting body exhibits lentinan-degrading activity (21). However, the physiological and biochemical functions of TLPs in fungi are unclear, and this issue requires further research.

Ganoderma lucidum has been a traditional medicinal fungus in Asia for thousands of years due to its broad medicinal properties and wide variety of biological activities. G. lucidum polysaccharides are the major important active constituents and components used in the medical application of G. lucidum. G. lucidum polysaccharides have been studied for several years and have been demonstrated to possess diverse bioactivities, such as anti-tumor, anti-oxidative, anti-microbial, cytotoxic, hepatoprotective, anti-hypertensive, and immunomodulatory activities (22). G. lucidum has potential high commercial value for both food and biopharmaceutical and food industry applications. Therefore, most of the current research has mainly focused on optimizing the fermentation conditions for G. lucidum polysaccharide biosynthesis and cloning the key genes in the G. lucidum polysaccharide biosynthesis pathway. The key enzymes in the G. lucidum polysaccharide biosynthetic pathways include phosphoglucose isomerase (PGI), phosphoglucose mutase (PGM), and phosphomannose isomerase (PMI) (23, 24). However, very few studies have investigated the key genes and molecular mechanisms regulating G. lucidum polysaccharide biosynthesis. Therefore, it is important to identify new genes and to analyze the possible mechanisms within regulatory networks of G. lucidum polysaccharide biosynthesis. Knowledge about the mechanisms present in G. lucidum that regulate polysaccharide biosynthesis could also provide a model and foundation for further research on the molecular mechanism of the key genes that regulate secondary metabolite biosynthesis in fungi.

PGI, as the key component in the glycolysis and gluconeogenesis pathways, catalyzes the isomerization of glucose-6-phosphate (G6-P) and fructose-6-phosphate (25). PGI is a multifunctional enzyme that is involved in regulating growth, hyphal polarity, stress resistance, and cell-wall integrity (26). A point mutation in the PGI gene in Aspergillus nidulans results in abnormal development by primary germ tube extension, yielding an enlarged, swollen apex with pronounced wall thickening (27). The deletion of PGI significantly inhibits hyphal growth, conidial germination, and deoxynivalenol biosynthesis in Fusarium graminearum (28). In addition, PGI is a key enzyme that regulates polysaccharide biosynthesis and metabolism. G6-P is a substrate used by PGM to produce glucose-1P, which is the central precursor in polysaccharide synthesis (29). Therefore, higher PGI activity is associated with increased G6-P flux into the glycolysis pathway. Increased PGI activity results in reduced levels of a major precursor needed for polysaccharide synthesis, G6-P, and an increased lactate yield (30). PGI silencing exerts a significant increase in the extracellular polysaccharide (EPS) and intracellular polysaccharide (IPS) levels in Lentinula edodes (31). Significantly lower PGI activity is observed from days 4 to 8 of culture after coixenolide addition than under control conditions, and this decreased activity is associated with increases in the EPS and IPS content in G. lucidum (32). PGI activity decreases over time during fermentation with glucose as the carbon source, but significant increases in the EPS and IPS contents of G. lucidum are observed (23).

In this study, we aimed to understand the mechanism through which PRMT5 contributes to polysaccharide biosynthesis. We found that target gene (TLP) splicing regulated by the silencing of PRMT5 led to a decrease in the polysaccharide content of the fungus. The results identified an uncharacterized mechanism through which PRMT5 regulates secondary metabolite biosynthesis and revealed a new mechanism through which TLP decreases polysaccharide biosynthesis.

RESULTS

The silencing of PRMT5 decreases the polysaccharide content of G. lucidum

To understand the links connecting PRMT5 with polysaccharide biosynthesis in G. lucidum, G. lucidum strains in which the PRMT5 gene (GenBank: OP360010, the silenced fragments in the conserved PRMT5 oligomerization domain) was silenced were constructed by RNA interference (RNAi) using cassette plasmids produced by our laboratory (33). Hygromycin-resistant transformants were isolated, and PRMT5 gene knockdown was confirmed by real-time quantitative reverse transcription PCR (qRT–PCR). The PRMT5-silenced strains (PRMT5i-31 and PRMT5i-35) produced in this study exhibited 68% and 72% reductions in the PRMT5 gene expression level compared with that of the wild-type (WT, ACCC53264) and Si-control (empty vector control) strains (Fig. S1A). The expression of the PRMT5 protein was confirmed by Western blot analysis and also showed that PRMT5 silencing reduced efficiently the PRMT5 protein level (Fig. S1B). qRT‒PCR and Western blot results confirmed the efficiency of PRMT5 silencing in the PRMT5-silenced strains. Polysaccharides and triterpenes are considered the main bioactive components in G. lucidum (34). Therefore, the polysaccharide content of the WT and PRMT5i strains was measured. The silencing of PRMT5 led to a significant decrease in the IPS and EPS contents (Fig. 1A). The IPS and EPS contents of the PRMT5i strains were decreased by 35% and 41% compared with those of the WT and Si-control strains, respectively (Fig. 1B). These data suggest that the silencing of PRMT5 decreases the polysaccharide content of G. lucidum, including that of IPS and EPS.

Fig 1.

Polysaccharide content of G. lucidum WT and PRMT5-silenced strains. (A) IPS content of WT and PRMT5i strains of G. lucidum. (B) EPS content of the WT and PRMT5i strains. The data are presented as the means ± standard deviations of the values obtained from three independent experiments. ***P < 0.001, ****P < 0.0001 by one-way analysis of variance).

PRMT5 silencing reduces symmetric arginine methylation of the spliceosome factor SmD3

PRMT5 methylates proteins involved in RNA splicing, one of which is SmD3 (35, 36). Thus, to identify the PRMT5 that catalyzes SmD3 methylation, the SmD3 methylation levels in WT G. lucidum strains and in PRMT5i-31 and PRMT5i-35 strains were measured by Western blotting with antibodies against SYM11 (37). The anti-SYM11 antibody specifically recognizes symmetric dimethylated arginine-containing peptides in various species (35, 38). This antibody recognizes a band at 16 kDa corresponding to SmD3 and proteins that contain arginine that are symmetrically demethylated. β-Actin was used as an internal reference for data normalization. The results showed that the PRMT5-catalyzed methylation of arginine residues in SmD3 was significantly reduced in the PRMT5-silenced strains compared with that in the WT and Si-control strains and did not affect the expression level of the Smd3 protein (Fig. 2A). The signal produced by the binding of the antibody to the methylated protein was quantified using image analysis software, and the results indicated that SmD3 methylation was approximately 60% lower in the PRMT5i strain than in the WT strain (Fig. 2B). These results suggest that PRMT5 activity is reduced in PRMT5-silenced strains and that the silencing of PRMT5 decreases SmD3 methylation.

Fig 2.

PRMT5 silencing decreases the SmD3me2S levels of G. lucidum. (A) SmD3me2S levels of the WT and PRMT5i strains were confirmed by Western blot analysis. The anti-SYM11 antibody specifically recognizes symmetric dimethylated arginine-containing peptides in various species. A band at 16 kDa corresponds to symmetrically demethylated SmD3 proteins; β-actin and SmD3 were used as internal reference for data normalization. (B) Grayscale analysis of SmD3me2S levels of the WT and PRMT5i strains. The data are presented as the means ± standard deviations of the values obtained from three independent experiments. ****P < 0.0001 by one-way ANOVA.

PRMT5 silencing leads to splicing changes in G. lucidum

PRMT5-regulated SmD3 methylation is a requirement for pre-mRNA splicing, and PRMT5 activity in the control of pre-mRNA splicing is conserved (39). To understand the effect of PRMT5 silencing on alternative splicing and to determine whether PRMT5 regulates polysaccharide biosynthesis in G. lucidum through gene splicing, we performed an RNA-seq analysis of PRMT5i and WT strains (the raw sequence reads are deposited in the National Center for Biotechnology Information Sequence Read Archive, accession number PRJNA933587). Replicate multivariate analysis of transcript splicing, an unbiased approach, was used to determine how PRMT5 silencing affects RNA splicing in G. lucidum. Using this approach, we identified a total of 214 differential alternative splicing events that were affected by PRMT5 silencing. These splicing events were associated with 185 unique genes. The largest proportion of novel alternatively spliced transcripts was generated by retained introns (RIs) and alternative 3′ splicing sites (Fig. 3A). Because the presence of abnormal introns retained/loss is an important method for measuring PRMT5 function (40), we screened 78 spliced RI genes. A Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of these genes showed that abnormally spliced RI genes are implicated in metabolism. TLP is known to play a vital role in glycan degradation. TLP in WT strains was found to undergo alternative splicing at intron 4, and intron 4 was lost in the PRMT5i strains (Fig. 3B and C). Hence, PRMT5 silencing leads to loss of introns in the TLP transcript. These findings were confirmed by semiquantitative PCR amplification of a fragment encompassing exons 3–5. We observed that the WT strains produced two alternative transcripts, a longer isoform (TLP1) and a shorter isoform (TLP2). The longer TLP isoform was not observed in the PRMT5i strain (Fig. 3D), suggesting that PRMT5 might be essential for the regulation of splicing during TLP expression. The alternative splicing of TLP also results in changes in its conserved domains, and it is speculated that gene function is altered by these changes.

Fig 3.

Differentially spliced genes in the PRMT5-silenced and WT strains. (A) The number of alternative splicing events in the PRMT5-silenced strains vs WT strains was determined by RNA-seq analysis. Cassette exons (SEs), retained introns (RIs), mutually exclusive exons (MXEs), alternative 5′ splice sites (A5SSs) and alternative 3′ splicing sites (A3SSs). (B and C) Pre-RNA splicing of TLP in the WT and PRMT5i strains. (D) Semiquantitative PCR of the indicated transcripts in the WT and PRMT5i strains.

G. lucidum PRMT5 regulates polysaccharide biosynthesis through TLP alternative splicing

To determine whether polysaccharide biosynthesis is affected by alternative splicing of TLPs, TLP-silenced and isoform-overexpressing transformants were constructed. The efficiency of TLP silencing and overexpressing was confirmed by qRT–PCR (Fig. S2A through C). The two TLP-silenced strains were named polysaccharide content of the TLP silencing (TLPi)-6 and TLPi-8; the longer TLP isoform-overexpressing strains were named TLP1 overexpression (OE-TLP1)-12 and OE-TLP1-14, and the shorter TLP isoform-overexpressing strains were named TLP2 overexpression (OE-TLP2)-24 and OE-TLP2-26). The expression levels of the TLP1 and TLP2 genes were determined by Northern blot analysis using two specific probes for detecting TLP1 and TLP2, respectively. Northern blot analysis showed that TLP1 and TLP2 silencing reduced efficiently the TLP expression level (Fig. S2D through E). The expression of the TLP2 gene was significantly increased in the OE-TLP2 strains, as detected with a TLP2-specific probe (Fig. S2E). qRT‒PCR and Northern blot results confirmed the efficiency of TLP1 and TLP2 gene expression in the TLP1 and TLP2 strains, respectively. The IPS and EPS contents of TLP-silenced strains and OE-TLP1/TLP2 strains were examined. The results showed that the IPS and EPS contents were significantly increased by 65% and 32% in the TLP-silenced strains and significantly decreased by 43% and 35% in the OE-TLP2 strain compared with those in the WT strain. However, the OE-TLP1 strain showed no significant difference in the polysaccharide content compared with that in the WT strain (Fig. 4). These results show that the shorter TLP isoform TLP2 inhibits total polysaccharide biosynthesis and that TLP1 does not affect polysaccharide biosynthesis. The results suggest that TLP2 plays a more important role than TLP1 in controlling the polysaccharide content of G. lucidum and that PRMT5 regulates polysaccharide biosynthesis in G. lucidum through TLP mRNA splicing.

Fig 4.

Polysaccharide contents of the G. lucidum WT, TLPi, OE-TLP1, and OE-TLP2 strains. (A) IPS contents of the WT, TLPi, OE-TLP1, and OE-TLP2 strains of G. lucidum. (B) EPS contents of the WT, TLPi, OE-TLP1, and OE-TLP2 strains. The data are presented as the means ± standard deviations of the values obtained from three independent experiments. ***P < 0.001, ****P < 0.0001 by one-way ANOVA. NS, not significant.

PRMT5- and TLP-cosilenced strains were constructed and used to illustrate the role of TLP in PRMT5-regulated G. lucidum polysaccharide biosynthesis. The construction of PRMT5–TLPi-11 and PRMT5–TLPi-20 was confirmed by qRT–PCR, and these strains were used for further analysis (Fig. S3; the PRMT5- and TLP-cosilenced strains were named PRMT5–TLPi-11 and PRMT5–TLPi-20). PRMT5 protein expression was confirmed by Western blot analysis with the anti-PRMT5 antibody. β-Actin was used as an internal reference for data normalization. PRMT5 protein expression was significantly reduced in the PRMT5- and TLP-cosilenced strains compared with that in the WT and Si-control strains (Fig. S1B). qRT‒PCR and Western blot results confirmed the efficiency of PRMT5 silencing in the PRMT5- and TLP-cosilenced strains. The expression levels of the TLP1 and TLP2 genes were determined by Northern blot analysis using two specific probes for detecting TLP1 and TLP2, respectively. The results showed that the expression of the TLP1 and TLP2 genes was significantly reduced in the TLP- and PRMT5-cosilenced strains compared with that in the WT and siControl strains (Fig. S2D through E). qRT‒PCR and Northern blot results confirmed the efficiency of TLP1 and TLP2 gene expression in the PRMT5- and TLP-cosilenced strains, respectively. The IPS and EPS contents were detected in the PRMT5i, TLPi, and PRMT5–TLPi strains. Although the PRMT5–TLPi strain showed a significant decrease in the EPS and IPS contents compared with those of the TLPi strain and a significant increase compared with those of the PRMT5i strain, no significant difference in the EPS or IPS content was found between the WT strain and PRMT5–TLPi strain (Fig. 5). The results show that PRMT5 regulates polysaccharide biosynthesis in G. lucidum through TLP-mediated alternative splicing events.

Fig 5.

Polysaccharide contents of the G. lucidum WT, PRMT5i, TLPi, and PRMT5–TLPi strains. (A) IPS contents of the WT, PRMT5i, TLPi, and PRMT5–TLPi strains of G. lucidum. (B) EPS contents of the WT, PRMT5i, TLPi and PRMT5–TLPi strains. The data are presented as the means ± standard deviations of the values obtained from three independent experiments. ****P < 0.0001 by one-way ANOVA.

Aberrant splicing of TLP affects its interaction with phosphoglucose isomerase

To understand the molecular mechanism through which the PRMT5-regulated TLP alternative splicing event modulates polysaccharide biosynthesis in G. lucidum, the relationship between TLP and the key enzymes of polysaccharide synthesis and metabolism was investigated. Yeast two-hybrid assays were conducted to identify the various interactions that occur among the two TLP isoforms and PGI, PGM, and PMI. As shown in Fig. 6A through C, TLP2 interacts physically with PGI, whereas no direct interaction between TLP2 and PGM or PMI was detected. Furthermore, TLP1 does not bind PGM or PMI and does not interact with PGI (Fig. 6A through C).

Fig 6.

Protein interactions between TLP1/TLP2 and PGI, PGM, or PMI tested by yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) assays. (A) Y2H assays showing that TLP2 interacts with PGI. No direct interaction between TLP1 and PGI was detected. (B) Y2H assays showing no direct interaction between TLP1 or TLP2 and PGM. (C) Y2H assays showing no direct interaction between TLP1 or TLP2 and PMI. (D) BiFC-identified interactions of TLP1/TLP2 with PGI, PGM, and PMI. The BiFC signal was observed only for TLP1 and PGI. The interaction between TLP and PGM/PGI/PMI was detected using a Y2H assay. pGBKT7 + pGADT7, pGBKT7 + pGADT7-PGI, and pGBKT7-TLP + pGADT7 were used as controls, and pGBKT7-53 and pGADT7-T were used as controls. pGADT7-PGI/PMI/PGM was used as the bait protein, and pGBKT7-TLP was used as the prey protein. The BiFC assay indicated a correlation between PGM/PMI/PGI and TLP. Fluorescence was detected by constructing the PVN-PGI/PGM/PMI vector and a PVC-TLP vector containing a GFP tag and cotransforming yeast cells with these vectors. Digital image correlation (DIC) images indicate the yeast cell morphology under the normal white-field view; Venus shows the morphology of the yeast cells under green fluorescence. Scale bar: 5 µm.

To further verify the interaction between TLP1/TLP2 and PGI, PGM, or PMI, bimolecular fluorescence complementation (BiFC) assays were conducted. The results demonstrated that TLP2 interacts physically and directly with PGI but has no direct interaction with PGM or PMI (Fig. 6D). Because TLP1 failed to interact with any of the three proteins, yeast two-hybrid and BiFC assays together showed that TLP2 interacts only with PGI. To further determine how TLP2 interacts with the PGI protein, a surface plasmon resonance (SPR) assay was performed. The experiments revealed strong binding affinity between PGI and TLP2, with a KD value of 2.213 µM (Fig. 7A). The exposure of immobilized PGI to increasing concentrations (0–400 μM) of TLP2 protein resulted in the detection of increased binding (Fig. 7B). These results indicate that TLP2 can directly bind to PGI and that PRMT5 regulates the interaction between TLP and PGI through TLP splicing.

Fig 7.

Binding affinity between TLP2 and PGI proteins investigated by surface plasmon resonance assays. (A) KD values of TLP2 and PGI proteins. (B) Binding curves for the interaction of TLP2 and PGI proteins. PGI was loaded onto a chip, and the TLP2 protein was injected as the analyte at concentrations of 0–400 nM. Different colored lines represent different concentrations of the analytes.

Aberrant TLP splicing affects its binding to PGI and thereby regulates enzyme activity

Because enzyme activity is often regulated by protein–protein interactions, PGI activity in G. lucidum was measured to understand the effect of the interaction of TLP with PGI. PGI activity was significantly higher (66%) in the OE-TLP2 strains than in the WT strain, and no significant difference in PGI activity was observed between the OE-TLP1 and WT strains. In addition, PGI activity was increased by 45% in the PRMT5-silenced strains compared with that in the WT strain. A significant 53% reduction was detected in the TLP-silenced strains compared with that in the WT strains, but no significant change was found in the TLPi strains or the PRMT5- and TLP-silenced strains (Fig. 8). These results show that PRMT5 enhances PGI activity through TLP. Furthermore, these results suggest that PRMT5 enhances PGI activity by regulating the binding of TLP to PGI.

Fig 8.

PGI activity of G. lucidum. (A) PGI activity of the WT, PRMT5i, TLPi, PRMT5–TLPi, and OE-TLP1/TLP2 strains. The data are presented as the means ± standard deviations of the values obtained from three independent experiments. ****P < 0.0001 by one-way ANOVA.

DISCUSSION

PRMT5 is a type II methyltransferase that catalyzes the transfer of a methyl group from S-adenosylmethionine to arginine residues of histone and nonhistone proteins (35). Among these modifications, the methylation of nonhistone proteins, especially the spliceosome Sm protein, modulates constitutive and alternative pre-mRNA splicing of diverse genes and is an important way in which PRMT5 performs its functions (36). PRMT5 has been shown to participate in various cellular processes, including transcriptional regulation, signal transduction, and stress responses, by mediating alternative pre-mRNA splicing (41, 42). For example, in human acute myeloid leukemia cells, loss of PRMT5 leads to changes in the alternative splicing of multiple essential genes that regulate cell survival, including PNKP and PDCD2 (43). Mutations in PRMT5 alter alternative splicing of the core-clock gene PSEUDO RESPONSE REGULATOR 9 and contribute to regulation of the circadian rhythm in Arabidopsis thaliana (44). A change in PRMT5 activity modulates transcription of the stress-related gene At1G18160 and eventually boosts tolerance to salt stress in Arabidopsis (45). Mutation of PRMT5 alters the methylation of snRNP Sm and influences pre-mRNA splicing, conferring high salt tolerance in Arabidopsis (38). The knockdown of PRMT5 results in an increase in the frequency of I-6 splicing of the circadian clock gene in Neurospora (46). PRMT5 modulates diverse phenotypes by regulating the splicing of a variety of target genes; thus, identifying new target mRNA splicing genes is key to understanding the mechanism of action of PRMT5. In the current study, PRMT5 silencing led to a significant decrease in the biosynthesis of polysaccharides from G. lucidum through the alternative splicing of TLP (Fig. 9). These results are a common example of the various physiological functions of the alternative gene-splicing events that are regulated by PRMT5. The results of the current study reveal a novel target gene of PRMT5-mediated alternative splicing and provide a reference for the identification of regulatory target genes of PRMT5.

Fig 9.

Schematic describing a hypothetical model of the mechanism by which PRMT5 mediates polysaccharide biosynthesis in G. lucidum by controlling TLP splicing. PRMT5 silencing decreased the polysaccharide biosynthesis in G. lucidum by splicing TLP pre-mRNA to TLP2. TLP2 plays a more important role than TLP1 in polysaccharide biosynthesis in G. lucidum. TLP2 directly physically interacts with PGI and increases PGI activity, thereby decreasing the polysaccharide content. TLP1 failed to interact with PGI, and the polysaccharide content of the cells was not affected. In summary, PRMT5 modulates TLP pre-mRNA transcript processing, thus regulating polysaccharide biosynthesis. The solid black arrows in the hypothetical model indicate steps supported by data from experiments performed in the present study; the dotted arrows indicate steps supported by data derived from other systems.

TLPs are the products of a large, highly complex gene family, the members of which are associated with a broad range of host defense and stress response processes (16). Although TLPs share similar structures within their families, their functions show some differences. Recently, TLPs have been discovered in a wide range of plants, and their defense and stress response activities have been explored (47). However, few studies have studied the TLP-mediated regulation of physiological functions in fungi. The cetA (homology to plant TLP) mutant in Aspergillus nidulans, which contains a mutation in this glucose-repressible gene, exhibits delayed germination, abnormal hyphal branching, and cell-wall defects (48). Deletion of the TLPs cetA and calA in Aspergillus nidulans yields a synthetic lethal phenotype, and a few cells show cell-wall defects and lysis during germination and abnormal hyphal branching (49). The current research shows that TLP2 regulates polysaccharide biosynthesis in G. lucidum and that the TLP gene transcript undergoes alternative splicing. To the best of our knowledge, this study provides the first description of the mechanism through which TLP2 contributes to secondary metabolite biosynthesis via alternative splicing. Although TLP is known to be important for physiological processing, the functional mechanism through which it acts in physiological processing remains unclear. Barley TLP8 binds to insoluble (1,1,3,4)-β-D glucans in grain extracts and thereby facilitates the removal of this polysaccharide during the final beer-making process (50). TLP, as a putative SGC interactor, suppresses callose deposition in the nascent generative cell by digesting β-1,3-glucans, the main constituent of callose in Arabidopsis (51). However, our understanding of the mode of action of TLP in fungi is incomplete, and the subject remains under debate. The current study found that TLP2 regulated G. lucidum polysaccharide biosynthesis by interacting with PGI, a key enzyme in polysaccharide metabolism, and induced an increase in its activity without a direct interaction with PGM. We speculated that TLP2 does not interact with PGM, which may be due to the lack of a binding site in the protein or an effect of the protein spatial structure. TLP2 interacts with PGI and thus increases its activity, which may be due to an influence on other posttranslational modifications or protein stability. The relevant mechanisms have also been observed in other studies (52). PGI is a key enzyme that regulates polysaccharide biosynthesis and metabolism. Changes in PGI activity may directly affect polysaccharide biosynthesis. Therefore, TLP2 regulates polysaccharide biosynthesis through increases PGI activity. This study elucidated the molecular mechanism by which TLP2 regulates physiological function in fungi. Specifically, our findings elucidated the mechanism through which TLP2 contributes to secondary metabolite biosynthesis and may provide a basis for further functional investigation of these gene families.

In the present study, increased PGI activity led to a decreased polysaccharide content in G. lucidum. The results of this study are consistent with other recent reports and suggest that PGI is a key enzyme for polysaccharide biosynthesis. Although we found that PGI regulates polysaccharide biosynthesis, the influence of the PGI gene on the physiological functions of polysaccharide biosynthesis is currently unknown. The PGI gene deletion mutant exhibited higher total cellulase activity and pellet-like growth, and a possible mechanism could be the availability of building block precursors produced by glycolysis and the pentose phosphate pathway (26). In the present study, only the interaction of TLP2 with PGI was found to decrease the polysaccharide content. We speculated that TLP1 does not interact with PGI due to the lack of a binding site residue in the protein or the effect of the protein spatial structure. The alternative splicing of TLP1 also results in changes in its conserved domains, and it is speculated that gene function is altered by these changes. Whether there are other mechanisms that regulate polysaccharide biosynthesis in G. lucidum remains unknown. These issues will be investigated in future work.

MATERIALS AND METHODS

Strains and growth conditions

In this study, G. lucidum ACCC53264 provided by the Agricultural Culture Collection of China was used as the WT strain. The WT and transformant strains generated in this study were maintained on potato dextrose agar (PDA) slants. A 0.5-cm³ inoculation block was obtained and inoculated into complete yeast medium (CYM) plates. The mycelia were grown on complete medium (CYM, 2% glucose, 1% maltose, 0.46% KH₂PO₄, 0.2% yeast extract, 0.2% tryptone, and 0.05% MgSO₄·7H₂O) for 7 days at 28°C prior to evaluation of the IPS and EPS contents.

Construction of RNAi strains

The sequences of the PRMT5 and TLP genes in G. lucidum were obtained from the database of the G. lucidum genome. The coding regions of the PRMT5 gene and the TLP gene were amplified using G. lucidum cDNA as the template, and PCR was performed using the primers PRMT5i-F (ACTGGGTACCGCTGGAAAGCCCATTACG), PRMT5i-R (ACTGACTAGTGACGGAGACATCTGCGAC), TLPi-F (ACTGGGTACCCTCGTGGAAGACCAGATT), and TLPi-R (ACTGACTAGTGAGTCAAGGCAGCAAAA) to construct the fungal RNAi vectors (53). The RNAi silencing vectors pAN7-dual-PRMT5i and pAN7-dual-TLPi were electroporated into G. lucidum (54). The two independent strains with the highest silencing efficiencies were selected for use in follow-up experiments. The empty vector control was also selected according to the above-described method and named Si-control.

Estimation of the EPS and IPS concentrations

After the removal of mycelia by centrifugation, crude EPSs were precipitated by adding four volumes of 95% (vol/vol) ethanol, incubating the solution overnight at 4°C, and separating the components by centrifugation. The insoluble components were suspended in 1-M NaOH at 60°C for 1 h, and the supernatants were analyzed using the phenol–sulfuric acid method. The IPS content in the mycelia was measured after drying at 60°C to a constant dry weight; 1-M NaOH was used to extract IPSs at 60°C for 1 h. The supernatant was collected by centrifugation, and the IPS content was measured using the phenol‒sulfuric acid method (55, 56).

RNA extraction procedure

The WT and PRMT5i strains were grown on CYM medium for 7 days at 28°C; 200-mg mycelia frozen in liquid nitrogen were ground to a fine powder using a mortar and pestle; and total RNA was extracted with 1-mL RNAiso Plus (Takara, China). Chloroform (0.2 mL) was added to the solution and well mixed until the solution became milky. The samples were centrifuged at 12,000 g for 15 minutes at 4°C after kept at room temperature for 5 minutes. The supernatant was transferred to a new tube and extracted with 0.5-mL isopropanol with gentle shaking for about 10 minutes and was centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was again transferred to a 1.5-mL tube, and a 2.5-fold volume of absolute ethanol was added and mixed thoroughly for precipitating the total RNA at −20°C. Subsequently, the RNA was pelleted at 12,000 g for 30 mintes at 4°C, washed in 75% ethanol twice, dried in a vacuum, and re-dissolved in RNase-free water. RNA samples were denatured at suitable temperature to open their secondary structure, and mRNA was enriched by oligo (dT)-attached magnetic beads. Synthesis of the first-strand cDNA and the second-strand cDNA was performed after the RNAs were fragmented. The sequencing libraries were constructed by amplifying the selected fragments by PCR after the end repair process and ligation of adapters.

RNA-seq analysis

The RNA integrity was assessed using the RNA Nano 6000 Assay Kit and the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). RNA-seq was performed as described previously (57). The sequencing data were filtered with SOAPnuke; afterward, clean reads were obtained and stored in FASTQ format. The clean data were mapped to the reference genome by HISAT (v.2.1.0). Bowtie2 was applied to align the clean reads to the gene set, in which known and novel, coding, and noncoding transcripts were included.

Semiquantitative RT–PCR

G. lucidum mycelia cultured on PDA were used for semiquantitative RT–PCR detection. The splicing variant-specific primers RT-TLP-F (ATGCCGTCGTATC) and RT-TLP-R (TCACGACGACC) were used to amplify (28 cycles) two variants of TLP with predicted sizes of 306 and 251 bp. Using 18S rRNA as the internal reference gene, the amount of template was determined, and the results were analyzed by gel electrophoresis.

Immunoblot analysis

Seven-day-old mycelia frozen in liquid nitrogen were ground to a fine powder using a mortar and pestle. The powder was placed in ice-cold extraction buffer. The lysate was centrifuged at 12,000 g for 10 minutes at 4°C. Total protein was extracted, separated by 12% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Bio-Rad, USA). Protein gel blot analysis using an antibody against symmetrically dimethylated arginine residues (SYM11;07–413, Millipore) to detect the symmetric arginine methylation of SmD3 revealed a band at 16 kDa (58). Protein gel blotting was used in the immunoblot analysis with a PRMT5 antibody (AB_2615010, Active Motif) to detect the expression level of the PRMT5 protein in the silenced strains. A β-actin-specific antibody (AT0097, CMCTAG) served as the internal control. Blots were developed using the ECL Western blotting detection system (Amersham Bioscience, Sweden). Images were acquired with the Bio-Rad ChemiDoc Touch imaging system (Bio-Rad), and densitometry was performed using ImageJ v.1.8.0 software.

Yeast two-hybrid assay

Using G. lucidum cDNA as a template, we performed PCR amplification of TLP1 and TLP2 fragments. The PCR product was ligated into the pGBKT7 vector to generate the bait vector. The obtained vector was transformed into the yeast Y2HGold strain for the assessment of toxicity and autotranscription activity. The coding sequences (CDSs) of the PMI (GenBank: UOF75523), PGM (GenBank: UOF75521), and PGI (GenBank: UOF75525) genes were then further ligated into the pGADT7 vector to generate feed plasmids that were inserted into strain Y187 via transformation. The yeast two-hybrid strain was obtained by mating the Y187 and Y2HGold strains. The mating cells were screened on synthetic dropout DDO plates (SD-Trp/SD-Leu), and the yeast two-hybrid interactions were assessed on QDO plates (SD-Trp/SD-Leu/SD-Ade/SD-His/X-α-Gal). Protein interactions were assessed based on the expression of different reporter genes under the control of Gal4-responsive promoters.

Bimolecular fluorescence complementation assay

For the BiFC assay, the PGI, PGM, PMI, TLP1, and TLP2 coding sequences were cloned into pVN and pVC vectors fused with the N‐terminal or C‐terminal sequence to generate pVN-PGI/PGM/PMI and pVC-TLP1/TLP2, respectively. Yeast cells were transfected with the plasmids and incubated in the dark at 30°C; the cells were then imaged using an epifluorescence microscope. DIC images indicate the yeast cell morphology under the normal white-field view; Venus shows the morphology of the yeast cells under green fluorescence.

Expression and purification of recombinant proteins

The pColdI-TLP2 expression vectors were transformed into Escherichia coli strain BL21 (DE3), and protein expression was induced by 0.5-mM isopropyl-beta-D-thiogalactopyranoside (IPTG) at 16°C for 12 h. Recombinant proteins were purified on a nickel–nitrilotriacetic acid column (Sangon, C600033). The pGEX-4T-PGI expression vectors were transformed into Escherichia coli strain BL21 (DE3), and protein expression was induced by 0.5-mM IPTG at 28°C for 4 h. Recombinant proteins were purified on a Mag-Beads GST Fusion Protein Purification (Sangon, C650031).

Surface plasmon resonance assay

SPR experiments to analyze protein–protein interactions were performed with a Biacore T200 system (GE Healthcare) using an NTA sensor chip (GE Healthcare). For interaction studies, proteins were prepared in SPR running buffer (50-mM HEPES, pH 7.5, 150-mM NaCl, and 0.1% Tween 20). PGI protein was immobilized on the chip; a kinetics protocol using various concentrations of TLP2 ranging from 0 to 400 µM was employed in independent experiments; and the KD values of the PGI-TLP2 interaction were then calculated.

Detection of PGI activity

PGI activity was determined according to previously described methods (59). For the assay, 190 µL of assay buffer (50-mM HEPES–NaOH, pH 7.4, 1-mM EDTA, 3-mM MgCl₂, 3-mM Fru6P, 1-mM NAD⁺, and 0.4-unit/mL Fru6P dehydrogenase) was added to 20 µL of protein extracted from the WT strain or from G. lucidum transformants. NADH formation was measured by reading the absorbance at 340 nm, and PGI activity was calculated based on the amount of NADH produced, which was normalized to the total protein level.

Northern blot analysis

Northern blot analysis of total RNA isolated using TRIzol reagent (Takara) was performed. The quality of total RNA was evaluated by the 28S:18S ratio according to gel electrophoresis. The RNA (10 µg per sample) was denatured by glyoxal treatment and separated on a 1% agarose gel. After capillary transfer onto nylon membranes, specific TLP1 and TLP2 probes were labeled in an in vitro transcription reaction with digoxigenin-11-UTP using the DIG-High Prime DNA Labeling and Detection Starter Kit II (cat. 11745832910, Roche) according to the manufacturer’s instructions (60). The membrane was hybridized with a denatured DIG-labeled RNA probe overnight at 68°C with gentle agitation. After hybridization, the blots were washed, and immunological detection was performed. The chemiluminescent signal was detected for 30 minutes with a Bio-Rad Image Lab device.

Statistical analysis

All data presented in this article are based on the results from at least three independent experiments. The error bars indicate the standard deviations of the means of the values obtained in independent experiments conducted in triplicate. Differences in mean values among groups were analyzed by one-way or two-way analysis of variance using GraphPad Prism. For statistical representation, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 indicate statistical significance. NS indicates “not significant.”

DATA AVAILABILITY

The raw sequence reads are deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive, accession number PRJNA933587. The gene sequence was deposited into the NCBI GenBank under the following accession numbers: PRMT5 (GenBank: OP360010), PMI (GenBank: UOF75523), PGM (GenBank: UOF75521), and PGI (GenBank: UOF75525).

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/spectrum.02906-23.

Supplemental figures. spectrum.02906-23-s0001.pdf.

Fig. S1 to S3.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.