Skip to main content
Microbiology Spectrum logoLink to Microbiology Spectrum
. 2023 Oct 13;11(6):e02777-23. doi: 10.1128/spectrum.02777-23

Correction for Sun et al., “Large-Scale Detection of Telomeric Motif Sequences in Genomic Data Using TelFinder”

Qing Sun, Hao Wang, Shiheng Tao , Xuguang Xi
PMCID: PMC10715131  PMID: 37831470

AUTHOR CORRECTION

Volume 11, no. 2, e03928-22, 2023, https://doi.org/10.1128/spectrum.03928-22.

Page 5, line 23: “TAAGGATGTCACGATCATTGGTG was detected in Candida tropicalis and Candida albicans,” should be “TACGGATGTCTAACTTCTTGGTG was detected in Candida albicans.”

Page 5, line 39: “Eremothecium gossypii” should be “Eremothecium cymbalariae.”

Page 5, line 40: “This motif was also identified in another species in the genus Eremothecium, namely, Eremothecium cymbalariae.” should read "A similar motif, TCTCTCAGCGGTGTGGTGTATGGG, was identified in E. gossypii, another species in the genus Eremothecium.”

Page 5, line 46: “E. cymbalariae” should be “E. gossypii.”

Page 6, Fig. 2: The telomeric motif sequences of Candida albicans and Kluyveromyces lactis were mislabeled. The correct Fig. 2 is shown in this author correction. The corresponding motif is also corrected in the revised Table S1 in this author correction.

Fig 2.

Fig 2

Fig 3.

Fig 3

Page 7, Fig. 3: The genus names of Saccharomycopsis malanga and Saccharomycopsis fibuligera were mislabeled. The correct Fig. 3 is shown in this author correction.

Correction of the information above does not change the conclusions of this paper.

Contributor Information

Shiheng Tao, Email: 2008116600@nwafu.edu.cn.

Xuguang Xi, Email: xxi01@ens-cachan.fr.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/spectrum.02777-23.

Supplemental material. spectrum.02777-23-s0001.docx.

Supplemental material for published article; Table S1 is revised

DOI: 10.1128/spectrum.02777-23.SuF1

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material. spectrum.02777-23-s0001.docx.

Supplemental material for published article; Table S1 is revised

DOI: 10.1128/spectrum.02777-23.SuF1

Articles from Microbiology Spectrum are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES