Abstract
Despite binding similar cis elements in multiple locations, a single transcription factor often performs context-dependent functions at different loci. How factors integrate cis sequence and genomic context is still poorly understood and has implications for off-target effects in genetic engineering. The Drosophila context-dependent transcription factor CLAMP targets similar GA-rich cis elements on the X-chromosome and at the histone gene locus but recruits very different, loci-specific factors. We discover that CLAMP leverages information from both cis element and local sequence to perform context-specific functions. Our observations imply the importance of other cues, including protein-protein interactions and the presence of additional cofactors.
Introduction:
Coordinated gene expression is a crucial but difficult task in the crowded nucleus. To accomplish this feat, transcription factors (TFs) must first traverse the nucleus to find their corresponding cis elements. Furthermore, once factors have identified their DNA-binding sites, they can then impact gene expression on highly constrained temporal and spatial levels. When gene expression programs are misregulated or interrupted by mutations in regulatory elements, it can have catastrophic impacts, causing a variety of disease outcomes including cancer, autoimmunity, and neurological disorders (Lee and Young 2013). To further complicate the hurdle of widespread gene regulation, some TFs are “context dependent”; they bind similar cis elements across the genome but retain the ability to perform distinct functions at these different loci (Fry and Farnham 1999). Currently, we still do not fully understand how context-dependent TFs integrate locational information with cues they may receive from cofactors, 3D architecture, and other signals to perform their diverse functions.
CLAMP (Chromatin Linked Adaptor for MSL Proteins) is Diptera-specific C2H2 zinc-finger TF that plays a genome-wide role as a pioneer factor (Duan et al. 2021) and targets GA-rich cis elements to regulate global gene expression through both chromatin accessibility changes and polymerase pausing (Urban et al. 2017b, 2017a). CLAMP is designated as a context-dependent transcription factor that is critical for two major coordinated gene expression events: histone gene expression and upregulation of the male X chromosome for dosage compensation (Soruco and Larschan 2014). CLAMP is enriched on the male X-chromosome where it binds to GA-rich regions called MREs (MSL recognition elements) (Alekseyenko et al. 2008) and recruits the Male Specific Lethal complex (MSLc) to accomplish dosage compensation in male flies (Soruco and Larschan 2014). At the histone gene locus, CLAMP binds a long GA-repeat cis element in the promoter of H3 and H4 (H3/H4p) and fosters recruitment of histone gene locus body (HLB) specific factors including Mxc (Multi Sex combs, Mxc; the Drosophila ortholog of the human NPAT; (Terzo et al. 2015)) (Salzler et al. 2013; Rieder et al. 2017). CLAMP targets both the histone genes and the X chromosome prior to locus-specific factors such as Mxc and MSLc, neither of which have strong DNA-binding capability (Villa et al. 2016; Terzo et al. 2015). These observations show that, despite binding similar cis elements on the X-chromosome and at the histone gene locus, CLAMP recruits different factors to each location ensuring proper group composition at each genomic location. It is unclear how early transcription factors such as CLAMP integrate information from GA-rich cis elements with other genomic contextual information to perform their locus-specific functions.
Drosophila dosage compensation provides some clues as to how TFs like CLAMP integrate sequence and context information. For example, moving X-linked chromosome entry sites (CES; up to ~1500bp which contain one or more GA-rich MREs (Alekseyenko et al. 2008)) to autosomal locations leads to ectopic MSLc recruitment, spreading of the complex into surrounding chromatin, and transcriptional regulation of nearby genes (Gorchakov et al. 2009). A similar phenomenon occurs when the ~300bp H3/H4p, which includes a GA-repeat ranging from 16–35 bps (Bongartz and Schloissnig 2018) targeted by CLAMP (Salzler et al. 2013; Rieder et al. 2017). When this segment is placed outside the endogenous histone gene locus on chromosome 2L, HLB-specific factors are recruited to the transgenes resulting in transcription of the adjacent sequences (Salzler et al. 2013). These important experiments show that separation of local contexts (CES, up to ~1500bp; H3/H3p, ~300bp) from the larger locus (X-chromosome, histone gene locus on chromosome 2L) still allows for retention of local context function. This retention of function suggests that the larger chromosomal or locus context of these elements is not required for their function in recruiting the factors necessary for coordinated gene expression. Since both regions carry elements that recruit the CLAMP protein (Alekseyenko et al. 2008; Rieder et al. 2017), we hypothesized that the GA cis elements themselves are interchangeable and that the flanking local context provides the cues required for CLAMP context-specific function and unique factor recruitment.
Neither the Drosophila X-chromosome nor the endogenous histone gene locus are tractable study systems in which to test this hypothesis. MSLc coats the entire chromosome, and it is not practical to manipulate each GA-rich MRE in all 150 CES (Alekseyenko et al. 2008). Altering a critical number of CES, besides being nearly impossible to execute, would likely cause incomplete dosage compensation and male-specific lethality, while altering just a few CES is unlikely to significantly affect MSL recruitment to the whole chromosome due to complex spreading (Kelley et al. 1999; Kageyama et al. 2001; Gorchakov et al. 2009). Similarly, the endogenous histone gene locus is organized in a series of ~100 tandemly repeated 5 Kb arrays, in which each array contains the five canonical histone genes (H3, H4, H2A, H2B, and H1).
The repetitive nature of the histone locus renders it intractable for genetic manipulation as it harbors CLAMP-binding GA-repeats in all ~100 H3/H4p. However, the Drosophila transgenic histone gene array provides an excellent genetic system in which to test our hypothesis. Transgenes carrying 1–12 histone gene arrays have been established that allow for genetic manipulation and recapitulate histone locus functionality (Salzler et al. 2013; McKay et al. 2015; Meers et al. 2018). A single copy histone gene array, while not able to rescue an endogenous histone locus deletion background, has been shown to successfully recruit HLB-specific factors and drive histone gene expression (Koreski et al. 2020). This becomes a powerful system to perturb the CLAMP-recruiting cis elements within the array without editing all ~100 arrays at the endogenous locus.
Leveraging the transgenic system, we confirm that H3/H4p GA-repeat CLAMP binding sites are required for Mxc recruitment to the transgene (Rieder et al. 2017). We further demonstrate that transgenes in which we replace the H3/H4p GA-repeats with X-linked GA-rich MREs, which are bound by CLAMP in vitro and in their native locations, fail to recruit Mxc despite the larger contextual information of the histone gene array. Finally, we demonstrate that adding back additional X-linked sequence to the transgenic histone gene array results in MSLc recruitment in males. We observe sex-specific differences that suggest a competition between CLAMP-associated factors in males, but not in females. Overall, our observations indicate that cis element sequence alone is enough to impact context-dependent TF functions.
Results and Discussion
CLAMP targets GA-rich cis elements at different loci
CLAMP binds genome-wide and is enriched on the X-chromosome as well as on chromosome 2L at the endogenous histone locus (Figure 1A). We mapped available CLAMP ChIP-seq data from 2–4 hr mixed embryos (Duan et al. 2021) and confirmed that CLAMP targets the GA-repeats in the H3/H4p (Figure 1B). Mxc is specific to the histone locus by immunofluorescence (White et al. 2011) and the mammalian homolog NPAT also only targets histone promoters in cultured human cells (Kaya-Okur et al. 2019). We confirmed that Mxc is specific to the histone genes by performing ChIP-seq from embryo samples and by performing sexed polytene chromosome immunofluorescence using antibodies against Mxc, CLAMP, and MSL3. Mxc targets only the histone locus on chromosome 2L (Figure 1A, D) and is broadly localized over histone gene promoters, overlapping with CLAMP signal at the H3/H4p (Figure 1B). We also mapped existing MSL3 (Male Specific Lethal 3; a component of MSLc) ChIP-seq data from embryos (Rieder et al. 2019) and confirmed that MSLc is enriched on the X-chromosome (Figure 1A, D). As expected, MSLc is not enriched at the autosomal histone locus (Figures 1A–B, D). Both CLAMP and MSL are enriched at CESs, including CES5C2 and the roX2 (RNA on X 2; a lncRNA component of MSLc) CES (Figure 1C). Although CLAMP is present at both X-linked CES and the GA-repeats within the context of the histone gene array, MSLc and Mxc are locus-specific.
Figure 1: CLAMP binds locations genome-wide while Mxc and MSL3 bind distinct genomic regions.
(A) We mapped ChIP-seq data for CLAMP (green) from 2–4hr mixed sex embryos (Duan et al. 2021, GSE152598, three overlaid replicates normalized to respective inputs), MSL3 (yellow) from 2–4hr mixed embryos ((Rieder et al. 2019), GSE133637, normalized to the input), and Mxc (magenta) from 2–4 hr female staged embryos (three overlaid replicates normalized to respective inputs) to the dm6 (Drosophila melanogaster) genome. The purple arrow indicates the location of the endogenous histone gene locus. (B) CLAMP, MSL3, and Mxc ChIP-seq data mapped to a custom single histone gene array. The dark green bars between the H3 and H4 coding sequences mark the CLAMP binding GA-repeats. (C) ChIP peaks at two X-chromosome locations, CES5C2 and the roX2 gene. The yellow bars mark the known chromosome entry sites (CES) and the light green bars mark the GA-rich MSL recognition elements (MREs) where CLAMP and MSLc colocalize. (D) We performed immunofluorescence staining of wildtype chromosomal male third instar larval polytene chromosomes for CLAMP (green), MSL3 (yellow) and Mxc (magenta). DNA is stained with DAPI (blue). CLAMP and Mxc colocalize at the endogenous histone locus (magenta arrow, solid outlined box) and CLAMP and MSL3 colocalize on the X-chromosome (yellow arrow). Mxc and MSL3 do not colocalize.
CLAMP requires GA-rich sequences to bind in vitro and in vivo
CLAMP is a zinc-finger protein that directly interacts with DNA sequence (Soruco and Larschan 2014). Recombinant full-length CLAMP binds to GA-repeat carrying DNA probes in vitro (Duan et al. 2021). We therefore investigated the ability of recombinant CLAMP to interact with different cis element and whether the GA-repeats were critical for CLAMP binding in vitro. We first designed two biotin-labeled DNA probes based on the sequence from the endogenous H3/H4p. The “WT” probe includes the endogenous H3/H4p with intact CLAMP-recruiting GA-repeat. The “GA delete” probe includes the same H3/H4p sequence except the GA-repeats are removed (Figure 2A). CLAMP is maternally deposited in the early embryo and is a known member of the Late Boundary Complex which shifts CES probes in vitro (Kuzu et al. 2016; Kaye et al. 2017). We therefore also performed radiolabeled EMSAs using embryo extracts, which should include both maternally deposited CLAMP as well as the CLAMP-containing LBC, and our probes. To confirm the embryo extract included CLAMP, we performed shifts with extract, probe, and CLAMP antibody and showed that CLAMP antibody super-shifted with the WT WT probe (Supplemental Figure 1). Only the WT probe containing the GA-repeats is shifted with embryo extract; the GA delete probe did not shift (Figure 4B). We repeated these EMSAs with recombinant full-length CLAMP protein (Duan et al. 2021) with the same result (Figure 2B). These observations confirm that the endogenous H3/H4p GA-repeats are critical for CLAMP binding in vitro.
Figure 2: GA-repeats are required for CLAMP binding and function at the transgenic histone gene array.
(A) We engineered two transgenes carrying a single histone gene array: the “WT” transgene which resembles the endogenous histone arrays and the “GA deletion” transgene in which we deleted the GA-repeats (dark green, labeled bars). (B) We performed EMSA (gel shift) assays with recombinant CLAMP and biotinylated probes of the H3/H4p sequences from both histone array transgenes (WT: 226 bp, GA deletion: 198 bp). Recombinant CLAMP shifts EMSA probes only when the GA-repeats are present. (C) We performed immunofluorescence staining of third instar larval polytene chromosomes in chromosomal females for Mxc (magenta). A chromosomal female carrying the WT transgene (top) shows ectopic Mxc (white outlined magenta arrow, dotted outlined box) and while a chromosomal female carrying the GA deletion transgene (bottom) shows no ectopic Mxc staining. (D) A chromosomal male carrying the WT transgene (top) shows ectopic Mxc while a chromosomal male carrying the GA deletion transgene (bottom) shows no ectopic Mxc staining. Both sexes show Mxc localizing to the endogenous histone locus, which is used as an internal staining control (magenta arrow, solid outlined box). (E) We also performed immunofluorescence in chromosomal male and female animals for CLAMP (green) and Mxc (magenta). A chromosomal male shows colocalization of CLAMP (green) and Mxc (magenta) at the endogenous histone locus (magenta arrow, solid outlined box) and at the WT transgene (white outlined magenta arrow, dotted outlined box). Both chromosomal females and chromosomal males show Mxc localizing to the endogenous histone locus, which is used as an internal staining control (magenta arrow, solid outlined box). (F) Quantification of ectopic Mxc from polytene scoring shows a significant difference between the percentage of chromosome spreads that have ectopic Mxc between the WT and GA deletion transgenes in both chromosomal males and chromosomal females. n values reflect number of polytenes scored for each respective genotype. *** Chi-squared text, p < 0.001
Figure 4: X-linked elements do not functionally substitute GA-repeats in the histone gene array in chromosomal females.
(A) We engineered histone array transgenes in which we replaced parts of the H3/H4p sequence with varying amounts of X-linked sequence; the “2 MRE” transgenes replaces the GA-repeats with X-linked MREs from the roX2 gene (light green boxes), the “CES5C2” transgene replaces the sequence between the TATA boxes (maroon) with the X-chromosome CES5C2 sequence (yellow line, light green bars indicate MREs), and the “roX2” transgene replaces the sequence between the TATA boxes with the CES sequence from the roX2 gene (yellow line, light green bars indicate MREs). (B) We performed EMSA (gel shift) assays with early and late embryo extract (HEPES buffer serves as a control) and radiolabeled probes of the H3/H4p sequences of the histone array transgenes in (A) (WT: 226 bp, GA deletion: 198 bp, 2 MRE: 238 bp, CES5C2: 232 bp, roX2: 232 bp). Late embryo extract, containing CLAMP, shifts all EMSA probes of the H3/H4p other than the GA deletion probe. (C) We performed immunofluorescence staining on third instar larval polytene chromosomes from salivary glands in chromosomal females for Mxc (magenta) and MSL2 (yellow). DNA is stained with DAPI (cyan). Mxc localizes to the endogenous histone locus, which is used as an internal staining control (magenta arrow, solid outlined box). (D) Quantification of ectopic Mxc from polytene scoring shows a significant difference in the percentage chromosome spreads that have ectopic Mxc. Significance above the bars represent the comparison to the WT data and the lines with represent direct comparisons between datasets. n values reflect number of polytenes scored for each respective genotype. Chi-squared test, *** = p < 0.001
In vivo, GA-repeat cis elements are clearly not sufficient for CLAMP and Mxc recruitment: GA-repeats exist throughout the genome and long repeats are enriched on the X-chromosome (Kuzu et al. 2016) yet Mxc is solely recruited to the histone locus (Figure 1) (Rieder et al. 2017, 2019). We therefore sought to translate our in vitro observations in vivo. A transgene carrying twelve wild-type histone gene arrays recruits HLB components, including CLAMP and Mxc, but transgenic arrays lacking the GA-repeats in the H3/H4p fail to attract HLB factors when the endogenous locus is present (Rieder et al. 2017; Koreski et al. 2020). To validate these findings and to confirm these observations using a transgene carrying only a single histone gene array, we created two transgenic lines. The “WT” line carries a transgene with a single wild-type copy of the histone gene array, while the “GA deletion” line carries the same transgene lacking the GA-repeat sequences in the H3/H4p (Figure 2A). We then performed sexed polytene chromosome immunofluorescence using an antibody against Mxc and scored for ectopic Mxc.
We observed that both CLAMP and Mxc are recruited to the WT transgene in both chromosomal female and chromosomal male larvae (Figure 2C,D,E). The endogenous histone locus is visible near the chromocenter and serves as an internal staining control. Approximately 80% of polytenes from female larvae containing the WT transgene and 85% of polytenes from male larvae exhibited ectopic Mxc recruitment (Figure 2C,D). In contrast, we rarely observed ectopic Mxc recruitment in larvae carrying the GA delete transgene (Figure 2C,D,E) and observed a significant difference between the polytene scoring of WT larva and GA-deletion larva (Figure 2F). Our in vivo observations are therefore in agreement with our in vitro EMSA results and establish the transgenic system as a manipulable in vivo assay.
Because CLAMP is an integral transcription factor responsible for regulating the expression of essential genes such as the histone genes, it’s likely that there are “backup” mechanisms for ensuring CLAMP can locate regions where GA-rich cis elements reside and perform its function. Recent work demonstrated that CLAMP is recruited to a transgene carrying twelve histone gene arrays in which the H3/H4p is replaced with the H2A/H2B promoter, which does not contain GA-repeats. But, the phenomenon where CLAMP and HLB factors are recruited to the transgene only occurs in the background of a endogenous ~100 copy histone locus deletion (Koreski et al. 2020). CLAMP targets the region by immunofluorescence, but does not interact with any sequence by ChIP-seq. This is still surprising, since our observations show that simply deleting the GA-repeats from the H3/H4p rendered CLAMP non-functional in the context of the single histone array transgene (Figure 2C,D). However, all of our observations are by necessity in the background of the endogenous histone locus, as the single histone gene array itself does not support viability (Günesdogan et al. 2010; McKay et al. 2015).
The GA-repeats must reside in the H3/H4p for Mxc recruitment in vivo
We next sought to determine if simply the local promoter context (~300 bp) affects CLAMP recruitment to target elements. We hypothesized that the GA-repeats could be moved anywhere within the transgenic histone gene array and still attract CLAMP along with other histone locus specific factors, such as Mxc, because the larger context of the array is retained. We engineered two transgenes in which we deleted the GA-repeats from the H3/H4p and moved them to one of two locations within the transgenic array: either within the H2A/H2B promoter (“H2A/H2B”) or within the intergenic region between the H1 and the H2B coding sequences (“H2B/H1”) (Figure 3A). In both cases, we attempted to avoid disrupting any known or predicted cis elements (Crayton et al. 2004). We then performed fluorescent staining on polytene chromosomes from transgenic lines with an antibody against Mxc to assess how the different GA-repeat locations impacted Mxc recruitment compared to controls (Figure 3B,C). We rarely observed ectopic Mxc in transgenic lines in which the GA-repeats reside in the H2A/H2B promoter or the region between H1 and H2B (Figure 3C,D). Our data showed a significant difference between the percentage of chromosome spreads with ectopic Mxc for both transgenes when compared to our WT transgene and the data more closely resembled that of the GA deletion transgenes in which we completely removed the GA-repeats (Figure 3D). Our observations show that neither the H2A/H2B or H2B/H1 transgenes led to ectopic Mxc recruitment, indicating the importance of local H3/H4p context for Mxc recruitment. Overall, it’s clear that the larger context of the histone gene array is not required for either CLAMP recruitment or specific function but that the local flanking context of the H3/H4p promoter is important for CLAMP function at the histone gene array.
Figure 3: GA-repeats must reside in the H3/H4p for proper CLAMP function at the transgenic histone gene array.
(A) We engineered two histone gene array transgenes in which we moved the GA-repeats (green bars) to different regions along the array; one where we placed the GA-repeats in the H2A/H2B promoter and one where we placed the GA-repeats in the intergenic region between H1 and H2B. (B) We performed immunofluorescence staining of third instar larval polytene chromosomes for Mxc (magenta). DNA is stained with DAPI (cyan). Animals carrying the WT transgene (top) show ectopic concentration of Mxc (white outlined magenta arrow, dotted outlined box) while animals carrying the GA deletion transgene (bottom) show no ectopic Mxc staining. (C) Animals carrying the transgenes in which the GA-repeats are moved to the H2A/H2B promoter (top) or intergenic region between H1 and H2B (bottom) do not show ectopic Mxc. All animals show Mxc localizing to the endogenous histone locus, which is used as an internal staining control (magenta arrow, solid outlined box). (D) Quantification of ectopic Mxc from polytene scoring shows a significant difference in the percentage of chromosome spreads that have ectopic Mxc between WT and the transgenes in which the GA-repeats are moved. Significance above the bars represent the comparison to the WT and the lines with represent direct comparisons between genotypes. n values reflect number of polytenes scored for each respective genotype. Chi-squared test, *** = p < 0.001.
Our results were somewhat surprising since other well-studied transcription factors rely exclusively on cis element sequence, rather than local context for function. For example, the Drosophila pioneer factor Zelda targets “TAGteam” sequences. Zelda competes with another TF, Grainyhead, for binding TAGteam cis elements and differences in the motif sequence elicits differential binding and function of Zelda (Harrison et al. 2010; Li and Eisen 2018). Because of this relationship between Zelda and specific cis element sequence, specific TAGteam sequences can be placed in combination in transgenes to titrate gene expression output (Li and Eisen 2018). Another example is the early Drosophila embryo factor Twist which binds a variety of cis element motifs. Twist targets several repetitive cis elements as well as E-box motifs, the sequences of which are not interchangeable: each E-box type corresponds to a discrete regulatory role (Ozdemir et al. 2011). However, unlike Zelda and Twist, CLAMP appears to glean significant information from the flanking local context wherein cis elements reside.
CLAMP binding sequences from different loci do not functionally substitute in the context of the histone array in chromosomal females
The presence of CLAMP-recruiting elements within the local context of the H3/H4p is necessary for ectopic Mxc recruitment. Prior work demonstrated that the H3/H4p alone is sufficient to recruit HLB factors and even to initiate histone transcription, indicating that the rest of the array is dispensable at least for these actions (Salzler et al. 2013). However, when CLAMP is tethered to the H3/H4p in the absence of the GA-repeats, Mxc and other HLB factors are recruited, but transgenic histone transcription is not initiated (Rieder et al. 2017). Therefore, the specific CLAMP-GA-repeat interaction is critical for full CLAMP function at the histone genes. That being considered, CLAMP may integrate other local information that is unique to the large, repetitive endogenous histone locus. For example, CLAMP-binding sites exist in each of the ~100 histone arrays (Bongartz and Schlossnig 2019), but it is unclear if CLAMP binds to all of these sites. Concentrating HLB factors at the locus likely contributes to important body properties such as phase separation (Hur et al. 2020) and facilitates histone biogenesis (Tatomer et al. 2016). The repetitive nature of the locus also likely leads to unique three-dimensional organization, both within and between loci (Carty et al. 2017; Fritz et al. 2018), which can impact the function of transcription factors such as CLAMP. Since these higher-order organizational aspects are not recapitulated at our transgenic histone gene arrays, we are unable to capture how they contribute to its contest-specific functions.
Given that CLAMP targets many GA-rich elements across the genome and that CLAMP may integrate local genomic context information to perform its functions, we next sought to investigate whether X-linked sequences can functionally substitute for the endogenous GA-repeats in the H3/H4p in vitro. We designed three hybrid DNA probes based on the sequence of the H3/H4p, but in which we replaced parts of the promoter with various amounts of X-linked sequence. In the “2 MRE” probe we replaced the two endogenous CLAMP recruiting GA-repeats with two 21 bp GA-rich MREs from the X-linked roX2 gene. The “CES5C2” probe replaces the sequence between the H3 and H4 TATA boxes with sequence from the X-linked CES5C2 region containing three 21 bp GA-rich MREs. Finally, the “roX2” probe replaces the sequence between the H3 and H4 TATA boxes with sequence from the X-linked roX2 CES containing four 21 bp GA-rich MREs (Figure 4A). We performed radiolabeled EMSAs using embryo extracts and all three hybrid probes robustly shifted (Figure 4B). CLAMP therefore binds X-linked GA-rich elements in the context of the H3/H4p in vitro, and this interaction appears similar to CLAMP binding of the endogenous GA-repeats.
To translate our results in vivo, we engineered transgenic Drosophila lines carrying these hybrid transgenes with the same sequences as our EMSA probes (Figure 4A) and performed polytene chromosome immunostaining as above. We observed very little ectopic Mxc in all chromosomal female larvae regardless of which hybrid transgene they carried. Animals carrying the 2 MRE transgene were significantly less likely to show ectopic Mxc than the WT control animals, but significantly more likely to show ectopic Mxc compared to animals carrying the CES5C2 and roX2 transgenes (Figure 4C,D). Together these data suggest that replacing just the H3/H4p GA-repeats impacts Mxc recruitment, in chromosomal females even though the majority of the H3/H4p sequence is preserved and CLAMP binds to this sequence in vitro (Figure 4B). Overall, our data from chromosomal females suggests that cis element sequence impacts CLAMP function at the transgenic histone gene array. Furthermore, in combination with our data showing the GA-repeats must reside in the H3/H4p for Mxc recruitment to the histone array transgene (Figure 3), our results suggest that CLAMP is using cues from both cis element sequence and the local flanking regions of the cis element to determine its function at the transgenic histone gene array.
X-linked sequences in the context of the histone gene array attract MSL2 in chromosomal males
Because Drosophila males undergo dosage compensation, MSLc members such as MSL2 are present in males whereas they are not expressed in females. When CLAMP binds the GA-rich MREs on the X-chromosome, it then recruits MSLc for dosage compensation (Soruco and Larschan 2014; Rieder et al. 2019). We therefore considered that our transgenes might behave differently in chromosomal males compared to females. We performed immunofluorescence staining on male polytene chromosomes with antibodies against Mxc and MSL2. Although MSL2 may have some DNA-binding capability (Villa et al. 2016), it requires CLAMP for efficient X-chromosome targeting (Soruco and Larschan 2014; Rieder et al. 2019).
Similar to our observations in chromosomal females, X-linked sequences do not functionally substitute in the local context of the H3/H4p in males: we observed few instances of ectopic Mxc in animals carrying the chimeric transgenes (Figure 5B,C). Strikingly, ectopic Mxc was significantly rarer in chromosomal males than in females carrying the 2MRE transgene (Figure 5C). However, in males we observed ectopic, autosomal MSL2: approximately 50% of polytene spreads from animals carrying the 2MRE transgene showed ectopic MSL2, whereas the majority of larvae carrying the CES5C2 or roX2 transgene showed ectopic MSL2 recruitment (Figure 5B,C). These results suggest that X-linked MRE or CES sequences recruit MSLc, even in the context of the transgenic histone gene array. These results confirm that CLAMP utilizes cues from the cis element sequence itself as well as the local flanking regions to determine its function at the transgenic histone gene array.
Figure 5: X-linked elements attract MSL2 in the context of the transgenic histone gene array in chromosomal males.
(A) We engineered single copy histone array transgenes in which we replaced parts of the H3/H4p sequence with varying amounts of X-linked sequence as in Figure 4. (B) We performed immunofluorescence staining on third instar larval polytene chromosomes in chromosomal males for Mxc (magenta) and MSL2 (yellow). DNA is stained with DAPI (cyan). Mxc localizes to the endogenous histone locus, which is used as an internal staining control (magenta arrow). MSL2 marks the male X-chromosome and also serves as an internal staining control. Chromosomal males containing any of the three histone array transgenes with X-linked sequence show some amount of ectopic MSL2 staining on autosomes (white outlined yellow arrows, dotted white boxes). (C) Quantification of ectopic Mxc from polytene scoring shows a significant difference in the percentage chromosome spreads that have ectopic Mxc. Significance above the bars represent the comparison to the WT data and the lines with represent direct comparisons between genotypes. n values reflect number of polytenes scored for each respective genotype. Chi-squared test, *** = p < 0.001
When we replace the majority of the H3/H4p with X-linked sequence, CLAMP likely binds this region but performs its X-linked role, even in the context of the transgenic histone gene array, suggesting there may be other information within the local context, such as additional TF recruiting cis elements, that impact CLAMP histone locus role. This observation is interesting given that we recently discovered that in Drosophila virilis, a species ~40 million years diverged from D. melanogaster, MSL2 is recruited to one of their two endogenous histone loci (Xie et al. 2022). The D. virilis H3/H4p carries poorly conserved, much shorter GA-repeats than those in D. melanogaster (Rieder et al. 2017), but CLAMP is still recruited to this sequence in vitro and, furthermore, recruits both Mxc and MSL2 to one of the two loci (Xie et al. 2022). This observation suggests that there may be evolutionary differences in CLAMP function and that there are different mechanisms for histone gene regulation, perhaps even within single species (Koreski et al. 2020). In addition, we recently explored other candidates that target the D. melanogaster histone gene array (Hodkinson et al. 2023). We identified several DNA-binding factors from this screen, including the Hox factor Ultrabithorax, that may provide CLAMP contextual cues for functioning at the histone locus. Ubx appears to interact specifically with the H3/H4p sequence and is therefore positioned close to the CLAMP binding sites. Given that there is likely a “secondary” mechanism to HLB formation that does not involve the CLAMP-GA-repeat interaction (Koreski et al. 2020); see below), other transcription factors emerge as a likely mechanism.
Overall, we show that the context-dependent transcription factor CLAMP incorporates both cis element sequence information as well as cues from local flanking context where its cis binding elements reside to govern its function. We show that CLAMP cis elements are not interchangeable and that, in the context of the histone locus, the local context of the H3/H4p provides CLAMP with critical cues to function at the histone genes. Together our findings provide new insights into our understanding of how TFs bind similar cis elements in locations across the genome but can preserve their specific regulatory functions at these each of these different loci.
Materials and methods
Transgenics
Transgenes were constructed to include a 5 Kb histone array sequence consisting of the 5 replication-dependent histone genes and their relative promoters (McKay et al. 2015; Meers et al. 2018) in which the H4 and H2A genes are FLAG-tagged (24 bp) at the 5’ end to distinguish them from the endogenous histone genes. 500 bp DNA inserts containing the H3/H4p changes of interest were ordered from IDT and inserted via Gibson cloning (detailed above). All 1x histone array transgenes were inserted at the VK33 attP site on chromosome 3L (65B2) (Venken et al. 2006) using PhiC3-mediated integration (Groth et al. 2004) by GenetiVision (Houston, TX). Injected chimeric flies were crossed in pairs to a +/+; CyO/If; TM3 (Sb) / TM6 (Tb) balancer stock. Resulting red-eyed progeny were selected and singly mated back to +/+; CyO/If; TM3 (Sb) / TM6 (Tb) flies and a homozygous stock was established. Flies were maintained on standard cornmeal/molasses media at 18° C and transferred every 3–4 weeks.
Electrophoretic Mobility Shift Assays:
We performed EMSAs after Aoki et al. 2008 (Aoki et al. 2008) with minor modifications.
DNA probes:
We made EMSA probes using PCR from gblocks (IDT) acquired during cloning as templates and the following primers: H3/H4 promoter F1: CACAGCACGAAAGTCACTAAAGAAC, H3/H4 promoter R1: GTTTGAAAACACAATAAACGATCAGAGC. We 5′ end labeled one pmol of probe with γ−32P-ATP (MP Biomedicals) using T4 polynucleotide kinase (New England BioLabs) in a 50 μl total reaction volume at 37°C for 1 hour. We used Sephadex G-50 fine gel (Amersham Biosciences) columns to separate free ATP from labeled probes. We adjusted the volume of the eluted sample to 100 μl using deionized water so that the final concentration of the probe was 10 fmol/μl.
Late embryo nuclear extracts:
We prepared embryo extracts from 6–18hr Oregon R embryos collected on apple juice plates and aged 6 hours at room temperature. We performed nuclear extract preparation as in Aoki et al. 2008. We omitted the final dialysis step described in Aoki et al. and completed the extraction with the final concentration of KCl at 360 mM.
Shifts:
We performed 20 μl binding reactions consisting of 0.5 μl (5 fmol) of labeled probe in the following buffer: 25 mM Tris-Cl (pH 7.4), 100 mM KCl, 1 mM EDTA, 0.1 mM dithiothreitol, 0.1 mM PMSF, 0.3 mg/ml bovine serum albumin, 10% glycerol, 0.25 mg/ml poly(dI-dC)/poly(dI-dC). We added 1 μl of nuclear extract and incubated samples at room temperature for 30 minutes. We loaded samples onto a 4% acrylamide (mono/bis, 29:1)−0.5× TBE-2.5% glycerol slab gel. We performed electrophoresis at 4°C, 180 V for 3–4 hours using 0.5× TBE−2.5% glycerol as a running buffer. We dried gels and imaged using a Typhoon 9410 scanner and Image Gauge software.
Supershifts:
We preincubated reactions, including 5ug/ul poly(dA-dT)/poly(dA-dT), with OreR late nuclear extract (LNE) and antibodies for 30 min at room temperature before adding hot probe. We used 1 ul rabbit serum and 4 ul anti-CLAMP antibodies.
Polytene immunofluorescence and microscopy
We performed polytene chromosome squashes from salivary glands of sexed female and male third instar larvae. We passed glands through fix 1 (4% formaldehyde, 1% Triton X-100, in 1× PBS) for 1 min, fix 2 (4% formaldehyde, 50% glacial acetic acid) for 2 min, and 1:2:3 solution (ratio of lactic acid:water:glacial acetic acid) for 5 min prior to squashing and spreading. Slides were washed in 1X PBS, washed in 1% Triton X-100 (diluted in 1X PBS) and blocked for one hour in .5% BSA in 1X PBS. Slides were then incubated with primary antibody diluted in blocking solution (antibody specifics below) overnight at 4° C in a dark humid chamber. Slides were then washed in 1 X PBS and incubated with secondary antibody diluted in blocking solution (antibody specifics below) for two hours. Slides were then mounted using Prolong Diamond anti-fade reagent with DAPI (Thermo Fisher, P36961), and spreads were imaged on a using a Zeiss Scope.A1 equipped with a Zeiss AxioCam using a 40×/0.75 plan neofluar objective using AxioVision software. We used primary antibodies at the following concentrations: rabbit anti-CLAMP (1:1000; Novus/SDIX) (Larschan et al. 2012), guinea pig anti-Mxc (1:5000) (White et al. 2011, gift from the Duronio and Marzluff labs), and rabbit anti-MSL2 (1:150, a gift from the Meller Lab). We used AlexaFluor secondary 488 and 647 antibodies (Thermo Fisher Scientific) at a concentration of 1:1000.
ChIP-seq data
CLAMP ChIP-seq was performed using protocol from Rieder et al. 2017 (Rieder et al. 2017) and data was taken from GEO (GSE152598, (Duan et al. 2021)). MSL3 ChIP-seq was performed using protocol from Rieder et al, 2017 and data was taken from GEO (GSE133637, (Rieder et al. 2019)). Mxc ChIP-seq was performed as in Rieder et al. 2017 using 2 ul guinea pig anti-Mxc antibody (gift from the Duronio/Marzluff laboratories).
Data availability:
Mxc ChIP-seq data is available on GEO (accession number pending).
Bioinformatic analysis, alignment and visualization
We performed bioinformatics analysis as in Hodkinson et al. 2023 (Hodkinson et al. 2023). We directly imported individual FASTQ datasets into the web-based platform Galaxy (The Galaxy Community 2022) through the NCBI SRA Run Selector or using our sequencing files by selecting the desired runs and utilizing the computing Galaxy download feature. We retrieved the FASTQ files from SRA using the “Faster Download and Extract Reads in FASTQ format from NCBI SRA” Galaxy command. Because the ~100 histone gene arrays are extremely similar in sequence (Bongartz and Schloissnig 2018), we do not utilize the dm6 or dm3 genomes and instead can collapse ChIP-seq data onto a single histone array (McKay et al. 2015; Bongartz and Schloissnig 2018; Koreski et al. 2020). We used a custom “genome” that includes a single Drosophila melanogaster histone array similar to that in Mckay et al. 2015, which we directly uploaded to Galaxy using the “upload data” feature, and normalized using the Galaxy command “NormalizeFasta” specifying an 80 bp line length for the output .fasta file. We aligned ChIP reads to the normalized histone gene array using Bowtie2 (Langmead and Salzberg 2012) to create .bam files using the user built-in index and “very sensitive end-to-end” parameter settings. We converted the .bam files to .bigwig files using the “bamCoverage” Galaxy command in which we set the bin size to 1 bp and set the effective genome size to user specified: 5000 bp (approximate size of l histone array). We also mapped relevant input or IgG datasets. If an input dataset was available, we normalized ChIP datasets to input using the “bamCompare” Galaxy command in which we set the bin size to 1 bp. We visualized the bigwig files using the Integrative Genome Viewer (IGV) (Robinson et al. 2011).
Supplementary Material
Table 1:
Sequences of EMSA probes.
| Probe (length) | Probe Sequence |
|---|---|
| WT (226 bp) GA-repeats bolded | CACAGCACGAAAGTCACTAAAGAACTAATTTCAACGTTTCTGTGTGCCCCTATTTATAGGTAAAACGACAAAAACCCGAGAGAGTACGAACGATATGTTCGTTCGCTTTTCGCTCGTCAAATGAAATGGCCTCTGTTTTTCTCTCTCTCTCTCTCTCTCTTTCACCGTCCACGATTGCTATATAAGTAGGTAGCAAATGCTCTGATCGTTTATTGTGTTTTCAAAC |
| GA del (198 bp) | CACAGCACGAAAGTCACTAAAGAACTAATTTCAACGTTTCTGTGTGCCCCTATTTATAGGTAAAACGACAAAAACCCXTACGAACGATATGTTCGTTCGCTTTTCGCTCGTCAAATGAAATGGCCTCTGTTTTXTTCACCGTCCACGATTGCTATATAAGTAGGTAGCAAATGCTCTGATCGTTTATTGTGTTTTCAAAC |
| 2 MRE (238 bp) MREs bolded | CACAGCACGAAAGTCACTAAAGAACTAATTTCAACGTTTCTGTGTGCCCCTATTTATAGGTAAAACGACAAAAACCCgatttagagcgagatgacaaTACGAACGATATGTTCGTTCGCTTTTCGCTCGTCAAATGAAATGGCCTCTGTTTTggcgatctctctcgtatacgTTCACCGTCCACGATTGCTATATAAGTAGGTAGCAAATGCTCTGATCGTTTATTGTGTTTTCAAACG |
| CES5C2 (232 bp) MREs bolded | CACAGCACGAAAGTCACTAAAGAACTAATTTCAACGTTTCTGTGTGCCCCTATTTATATTTATAGGTAAAACGaaatcacgttcacacaacttagaaagagatagcgatggcggtgtgaaagagagcgagatagttggaagcttcatggaaatgaaagagaggtagtttttggaaatgaATTGCTATATAAGTAGGTAGCAAATGCTCTGATCGTTTATTGTGTTTTCAAAC |
| roX2 (232 bp) MREs bolded | CACAGCACGAAAGTCACTAAAGAACTAATTTCAACGTTTCTGTGTGCCCCTATTTATATTTATAGGaatacagatcgatttagagcgagatgacaatagagaggcgatctctctcgtatacgagtcttgaaaagaaagagaaggcgaacggtgctggcttagagagagatggcaatactaattaacTATAAGTAGGTAGCAAATGCTCTGATCGTTTATTGTGTTTTCAAAC |
Acknowledgements
We would like to the members of the Rieder Lab as well as Dr. William Kelly and Dr. Roger Deal for their helpful remarks on the manuscript. We also would like to thank Dr. William Marzluf and Dr. Robert Duronio for Mxc antibody as well as Dr. Victoria Meller for MSL2 antibody. This work was supported by T32GM00008490 and F31HD105452 to LJH, K12GM00068 to CAS and HSC; F32GM140778 to CAS; and R00HD092625 and R35GM142724 to LER.
Footnotes
Author contributions
Conceptualization: JG, CAS, and LER. Methodology: JG, LJH, CAS, PPD, TA, and LER. Validation: LJH, TA, and LER. Formal analysis: LJH, CAS, PPD, and LER. Investigation: LJH, CAS, and TA. Resources: TA and LER. Data curation: LJH and LER. Writing – Original Draft: LJH and LER. Writing – Review and Editing: LJH, JG, CAS, TA, and LER. Visualization: LJH and LER. Supervision: LER. Project Administration: LJH and LER. Funding Acquisition: LJH, CAS, and LER.
Competing interest statement
The authors declare no competing interests.
References
- Alekseyenko AA, Peng S, Larschan E, Gorchakov AA, Lee O-K, Kharchenko P, McGrath SD, Wang CI, Mardis ER, Park PJ, et al. 2008. A sequence motif within chromatin entry sites directs MSL establishment on the Drosophila X chromosome. Cell 134: 599–609. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Aoki T, Schweinsberg S, Manasson J, Schedl P. 2008. A stage-specific factor confers Fab-7 boundary activity during early embryogenesis in Drosophila. Mol Cell Biol 28: 1047–1060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bongartz P, Schloissnig S. 2018. Deep repeat resolution—the assembly of the Drosophila Histone Complex. Nucleic Acids Research 47: e18–e18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carty M, Zamparo L, Sahin M, González A, Pelossof R, Elemento O, Leslie CS. 2017. An integrated model for detecting significant chromatin interactions from high-resolution Hi-C data. Nat Commun 8: 15454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crayton ME, Ladd CE, Sommer M, Hampikian G, Strausbaugh LD. 2004. An organizational model of transcription factor binding sites for a histone promoter in D. melanogaster. In Silico Biol 4: 537–548. [PubMed] [Google Scholar]
- Duan J, Rieder L, Colonnetta MM, Huang A, Mckenney M, Watters S, Deshpande Girish, Jordan W, Fawzi N, Larschan E. 2021. CLAMP and Zelda function together to promote Drosophila zygotic genome activation. eLife. https://elifesciences.org/articles/69937 (Accessed January 9, 2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fritz AJ, Ghule PN, Boyd JR, Tye CE, Page NA, Hong D, Shirley DJ, Weinheimer AS, Barutcu AR, Gerrard DL, et al. 2018. Intranuclear and higher-order chromatin organization of the major histone gene cluster in breast cancer. J Cell Physiol 233: 1278–1290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fry CJ, Farnham PJ. 1999. Context-dependent Transcriptional Regulation *. Journal of Biological Chemistry 274: 29583–29586. [DOI] [PubMed] [Google Scholar]
- Gorchakov AA, Alekseyenko AA, Kharchenko P, Park PJ, Kuroda MI. 2009. Long-range spreading of dosage compensation in Drosophila captures transcribed autosomal genes inserted on X. Genes Dev 23: 2266–2271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Groth AC, Fish M, Nusse R, Calos MP. 2004. Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 166: 1775–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Günesdogan U, Jäckle H, Herzig A. 2010. A genetic system to assess in vivo the functions of histones and histone modifications in higher eukaryotes. EMBO Rep 11: 772–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harrison MM, Botchan MR, Cline TW. 2010. Grainyhead and Zelda compete for binding to the promoters of the earliest-expressed Drosophila genes. Developmental Biology 345: 248–255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hodkinson LJ, Smith C, Comstra HS, Ajani BA, Albanese EH, Arsalan K, Daisson AP, Forrest KB, Fox EH, Guerette MR, et al. 2023. A bioinformatics screen reveals hox and chromatin remodeling factors at the Drosophila histone locus. BMC Genom Data 24: 54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hur W, Kemp JP, Tarzia M, Deneke VE, Marzluff WF, Duronio RJ, Di Talia S. 2020. CDK-Regulated Phase Separation Seeded by Histone Genes Ensures Precise Growth and Function of Histone Locus Bodies. Dev Cell 54: 379–394.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kageyama Y, Mengus G, Gilfillan G, Kennedy HG, Stuckenholz C, Kelley RL, Becker PB, Kuroda MI. 2001. Association and spreading of the Drosophila dosage compensation complex from a discrete roX1 chromatin entry site. The EMBO Journal 20: 2236–2245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaya-Okur HS, Wu SJ, Codomo CA, Pledger ES, Bryson TD, Henikoff JG, Ahmad K, Henikoff S. 2019. CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat Commun 10: 1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaye EG, Kurbidaeva A, Wolle D, Aoki T, Schedl P, Larschan E. 2017. Drosophila Dosage Compensation Loci Associate with a Boundary-Forming Insulator Complex. Mol Cell Biol 37: e00253–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kelley RL, Meller VH, Gordadze PR, Roman G, Davis RL, Kuroda MI. 1999. Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell 98: 513–22. [DOI] [PubMed] [Google Scholar]
- Koreski KP, Rieder LE, McLain LM, Chaubal A, Marzluff WF, Duronio RJ. 2020. Drosophila histone locus body assembly and function involves multiple interactions. Mol Biol Cell 31: 1525–1537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kuzu G, Kaye EG, Chery J, Siggers T, Yang L, Dobson JR, Boor S, Bliss J, Liu W, Jogl G, et al. 2016. Expansion of GA Dinucleotide Repeats Increases the Density of CLAMP Binding Sites on the X-Chromosome to Promote Drosophila Dosage Compensation. PLoS Genet 12: e1006120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods 9: 357–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee TI, Young RA. 2013. Transcriptional Regulation and its Misregulation in Disease. Cell 152: 1237–1251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li X-Y, Eisen MB. 2018. Effects of the maternal factor Zelda on zygotic enhancer activity in the Drosophila embryo. 385070. https://www.biorxiv.org/content/10.1101/385070v1 (Accessed November 6, 2023).
- McKay DJ, Klusza S, Penke TJ, Meers MP, Curry KP, McDaniel SL, Malek PY, Cooper SW, Tatomer DC, Lieb JD, et al. 2015. Interrogating the function of metazoan histones using engineered gene clusters. Dev Cell 32: 373–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meers MP, Leatham-Jensen M, Penke TJR, McKay DJ, Duronio RJ, Matera AG. 2018. An Animal Model for Genetic Analysis of Multi-Gene Families: Cloning and Transgenesis of Large Tandemly Repeated Histone Gene Clusters. Methods Mol Biol 1832: 309–325. [DOI] [PubMed] [Google Scholar]
- Ozdemir A, Fisher-Aylor KI, Pepke S, Samanta M, Dunipace L, McCue K, Zeng L, Ogawa N, Wold BJ, Stathopoulos A. 2011. High resolution mapping of Twist to DNA in Drosophila embryos: Efficient functional analysis and evolutionary conservation. Genome Res 21: 566–577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rieder LE, Jordan WT 3rd, Larschan EN. 2019. Targeting of the Dosage-Compensated Male X-Chromosome during Early Drosophila Development. Cell Rep 29: 4268–4275.e2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rieder LE, Koreski KP, Boltz KA, Kuzu G, Urban JA, Bowman SK, Zeidman A, Jordan WT 3rd, Tolstorukov MY, Marzluff WF, et al. 2017. Histone locus regulation by the Drosophila dosage compensation adaptor protein CLAMP. Genes Dev 31: 1494–1508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP. 2011. Integrative Genomics Viewer. Nat Biotechnol 29: 24–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Salzler HR, Tatomer DC, Malek PY, McDaniel SL, Orlando AN, Marzluff WF, Duronio RJ. 2013. A sequence in the Drosophila H3-H4 Promoter triggers histone locus body assembly and biosynthesis of replication-coupled histone mRNAs. Dev Cell 24: 623–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Soruco MML, Larschan E. 2014. A new player in X identification: the CLAMP protein is a key factor in Drosophila dosage compensation. Chromosome Res 22: 505–515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tatomer DC, Terzo E, Curry KP, Salzler H, Sabath I, Zapotoczny G, McKay DJ, Dominski Z, Marzluff WF, Duronio RJ. 2016. Concentrating pre-mRNA processing factors in the histone locus body facilitates efficient histone mRNA biogenesis. Journal of Cell Biology 213: 557–570. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Terzo EA, Lyons SM, Poulton JS, Temple BRS, Marzluff WF, Duronio RJ. 2015. Distinct self-interaction domains promote Multi Sex Combs accumulation in and formation of the Drosophila histone locus body. Mol Biol Cell 26: 1559–1574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- The Galaxy Community. 2022. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2022 update. Nucleic Acids Research 50: W345–W351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Urban J, Kuzu G, Bowman S, Scruggs B, Henriques T, Kingston R, Adelman K, Tolstorukov M, Larschan E. 2017a. Enhanced chromatin accessibility of the dosage compensated Drosophila male X-chromosome requires the CLAMP zinc finger protein. PLoS One 12: e0186855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Urban JA, Urban JM, Kuzu G, Larschan EN. 2017b. The Drosophila CLAMP protein associates with diverse proteins on chromatin. PLoS One 12: e0189772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venken KJT, He Y, Hoskins RA, Bellen HJ. 2006. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science 314: 1747–1751. [DOI] [PubMed] [Google Scholar]
- Villa R, Schauer T, Smialowski P, Straub T, Becker PB. 2016. PionX sites mark the X chromosome for dosage compensation. Nature 537: 244–248. [DOI] [PubMed] [Google Scholar]
- White AE, Burch BD, Yang XC, Gasdaska PY, Dominski Z, Marzluff WF, Duronio RJ. 2011. Drosophila histone locus bodies form by hierarchical recruitment of components. J Cell Biol 193: 677–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xie M, Hodkinson LJ, Comstra HS, Diaz-Saldana PP, Gilbonio HE, Gross JL, Chavez RM, Puckett GL, Aoki T, Schedl P, et al. 2022. MSL2 targets histone genes in Drosophila virilis. 2022.12.14.520423. https://www.biorxiv.org/content/10.1101/2022.12.14.520423v1 (Accessed January 3, 2023).
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Mxc ChIP-seq data is available on GEO (accession number pending).





