Tetraspanin 1 regulates papillary thyroid tumor growth and metastasis through c‐Myc‐mediated glycolysis

Abstract

Papillary thyroid cancer (PTC) is the most common form of thyroid cancer and is characterized by its tendency for lymphatic metastasis, leading to a poor prognosis. Tetraspanin 1 (TSPAN1) is a member of the tetra‐transmembrane protein superfamily and has been implicated in tumorigenesis and cancer metastasis in various studies. However, the role of TSPAN1 in PTC tumor development remains unclear. In this study, we aimed to investigate the impact of TSPAN1 on PTC cell behavior. Our results demonstrate that knockdown of TSPAN1 inhibits PTC cell proliferation, migration, and invasion, while overexpression of TSPAN1 has the opposite effect. These findings suggest that TSPAN1 might play a role in the tumorigenesis and invasiveness of PTC. Mechanistically, we found that TSPAN1 activates the ERK pathway by increasing its phosphorylation, subsequently leading to upregulated expression of c‐Myc. Additionally, we observed that TSPAN1‐ERK‐c‐Myc axis activation promotes glycolytic activity in PTC cells, as evidenced by the upregulation of glycolytic genes such as LDHA. Taken together, our findings indicate that TSPAN1 acts as an oncogene in PTC by regulating glycolytic metabolism. This discovery highlights the potential of TSPAN1 as a promising therapeutic target for PTC treatment. Further research in this area could provide valuable insights into the development of targeted therapies for PTC patients.

It is suggested that tetraspanin 1 could be a molecular target for the treatment of papillary thyroid cancer.

Abbreviations

2‐DG

2‐deoxy‐D‐glucose

CCA

cholangiocarcinoma

ECAR

extracellular acidification rate

ENO1

enolase 1

GLUT1

glucose transporter 1

IHC

immunohistochemical

LDHA

lactate dehydrogenase A

LN

lymph node

OCR

oxygen consumption rate

PGK1

phosphoglycerate kinase 1

PKM2

pyruvate kinase M2

PTC

papillary thyroid cancer

qRT‐PCR

quantitative real‐time PCR

RNA‐seq

RNA sequencing

TSPAN1

tetraspanin 1

1. INTRODUCTION

Thyroid tumors are prevalent in the head and neck region, with a higher incidence in women. ¹ The main histological types of thyroid cancer include PTC, follicular thyroid carcinoma, medullary thyroid carcinoma, and anaplastic thyroid carcinoma, among which PTC is the most common histological type. ² , ³ The molecular mechanisms underlying PTC primarily involve two pathways. First, abnormal activation of proto‐oncogenes, including constitutive activation of the MAPK cascade pathway and excessive activation of the PI3K/AKT pathway. ⁴ , ⁵ Second, recessive mutations of oncogenes. Receptor tyrosine kinases are located on the cell surface and bind to their respective ligands, leading to receptor dimerization and subsequent phosphorylation cascade involving tyrosine residues and ATP. This process regulates cell survival, differentiation, growth, proliferation, and apoptosis. ⁶ , ⁷ The MAPK/EPK signaling pathway is a highly conserved receptor protein kinase signaling pathway in mammals and is the predominant molecular pathogenic mechanism of PTC. ⁸ , ⁹

Tetraspanin‐1 is located on human chromosome 1p34.1 and belongs to the tetra‐transmembrane protein superfamily, which includes 33 members involved in signal transduction and activation. ¹⁰ It is expressed in a variety of tumor tissues and cells, and its mechanism might be involved in the process of carcinogenesis and invasion, and metastasis by transducing signals for cell division or causing anisotropic differentiation or dedifferentiation of cells, leading to cell proliferation or angiogenesis in cancerous tissues. The role of tetraspanins in cancer has emerged, with the proteins involved in proliferation, metastasis, and immune protection, and they have thus been proposed as potential oncogenic proteins. ¹¹ , ¹² Tetraspanin‐1 was found to be one of the most significantly upregulated proteins in CCL‐138‐R cells and cancer stem cells when compared to parental CCL‐138 cells. ¹³ Interestingly, TSPAN1 has been implicated in the development of prostate, colon, and stomach cancers. ¹⁴ , ¹⁵ , ¹⁶ , ¹⁷ It also plays a role in the survival, proliferation, and carcinogenesis of pancreatic cancer. ¹⁸ In CCA, high levels of TSPAN1 were associated with TNM stages and metastasis. Overexpression of TSPAN1 promoted CCA growth, metastasis, and induction of epithelial–mesenchymal transition, while its silencing had the opposite effect in vitro and in vivo. ¹⁹

The principal physiological role of sugars, particularly glucose, is to give the body the energy it requires for important functions. ²⁰ , ²¹ Glycolysis is the primary energy source in organisms, occurring in the cytoplasm where the enzymes catalyzing glycolytic reactions are located. It is a common metabolic pathway for glucose catabolism in all organisms. ²² , ²³ Tumor cells undergo metabolic changes that differ from normal cells and can adapt to altered metabolic environments by switching between glycolysis and oxidative phosphorylation. ²⁴ , ²⁵ , ²⁶ During the development of PTC, the capacity for cellular glycolysis increases, as it is the most common type of thyroid cancer in humans. Therefore, studying the role of glycolysis and its regulatory mechanisms in tumor development is crucial.

2. MATERIALS AND METHODS

2.1. Patient samples

From 2017 to 2020, a total of 30 pairs of human PTC tissues were collected from the Department of Head and Neck Surgery, Harbin Medical University Cancer Hospital. The PTC samples were classified according to the criteria set by the WHO. Informed consent was obtained from all patients whose biological samples were used in the study, and the research protocol involving human subjects was approved by the Research Ethics Committee of Harbin Medical University Cancer Hospital.

2.2. Cell culture

HEK293T, Nthy‐ori‐3‐1, K1, BCPAP, TPC‐1, IHH4, and 8505C cells were cultured in DMEM supplemented with 10% FBS and penicillin–streptomycin. The cells were grown as a monolayer until reaching confluence, and then trypsinized with 0.25% trypsin to obtain individual cells in the logarithmic growth phase for subsequent experiments.

2.3. Western blot analysis and Abs

Immunoblotting was carried out as previously described with the following Abs: anti‐p‐ERK (4370; CST), anti‐ERK (4695; CST), anti‐TSPAN1 (ab254730; Abcam), anti‐GAPDH (ab8245; Abcam), and anti‐c‐Myc (ab32072; Abcam).

2.4. Lentivirus package

Endotoxin‐free plasmid extraction kits were used to make lentiviral plasmids and packaging vectors (Qiagen). psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) were created by cotransfection of HEK293 cells with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Infection with lentiviral particles was followed by puromycin selection to produce stable cell lines. Real‐time PCR and western blotting were used to assess transfection effectiveness.

2.5. shRNA construction

The TSPAN1 shRNA targeting sequences were synthesized as follows: shTSPAN1‐1, 5′‐CCGGCCCATTCTGTTGCAATGACAACTCGAGTTGTCATTGCAACAGAATGGGTTTTTG‐3′ and shTSPAN1‐2, 5′‐CCGGCCTCTTCAATTTGCTCATCTTCTCGAGAAGATGAGCAAATTGAAGAGGTTTTTG‐3′. These oligos were inserted into pLKO.1 vector and confirmed by Sanger sequencing.

2.6. Quantitative real‐time PCR

Total RNA of cells was extracted using the Qiagen RNA kit and measured by Thermo Fisher Scientific. Reverse transcription was carried out with the first‐strand cDNA synthesis kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Quantitative PCR was carried out with a LightCycler 480 instrument (Roche) with actin as a control. All measurements were realized in triplicate. Primer sequences are shown: TSPAN1‐F, CATGCAGTTTGTCAACGTGGG; TSPAN1‐R, CACTTGCTCTCAGTCTTAGCAC; LDHA‐F, ATGGCAACTCTAAAGGATCAGC; LDHA‐R, CCAACCCCAACAACTGTAATCT; PKM2‐F, ATGTCGAAGCCCCATAGTGAA; PKM2‐R, TGGGTGGTGAATCAATGTCCA; ENO1‐F, AAAGCTGGTGCCGTTGAGAA; ENO1‐R, GGTTGTGGTAAACCTCTGCTC; PGK1‐F, TGGACGTTAAAGGGAAGCGG; PGK1‐R, GCTCATAAGGACTACCGACTTGG; GLUT1‐F, GGCCAAGAGTGTGCTAAAGAA; and GLUT1‐R, ACAGCGTTGATGCCAGACAG.

2.7. Cell proliferation assay using CCK‐8

Cell proliferation was assessed using CCK‐8 (Dojindo Laboratories). Cells were seeded in 96‐well plates at a density of 4000 cells per well and incubated for 5 days. Afterward, CCK‐8 solution was added, and the plates were further incubated for 4 h. The optical density was measured at 450 nm using a microplate reader.

2.8. Colony formation assay

Cells were plated in 6‐well plates at a density of 500 cells per well. After 14 days of incubation, cells were fixed with 4% paraformaldehyde, stained with 4 mg/mL crystalline violet, and counted under a light microscope (Leica).

2.9. Transwell migration assay

Transwell migration experiments were undertaken using 24‐well cell culture inserts with clear PET membranes (pore size 8.0 μm; BD Biosciences). The upper chamber received 200 μL serum‐free DMEM for 200,000 cells and the lower chamber received 800 μL DMEM containing 10% FBS. Membrane bottom migrated cells were incubated for 24 h and preserved with 4% paraformaldehyde for 20 min before staining with 0.1% crystal violet for further studies.

2.10. Transwell invasion assay

The upper chambers of Transwell systems were precoated with Matrigel and allowed to incubate for 2 h. Then 200,000 cells were added to the upper chamber and incubated for 24 h. Invaded cells that penetrated through the membrane were fixed, stained, and counted under a bright field microscope.

2.11. Wound healing assay

Cells were seeded in 6‐well plates and grew to a confluent monolayer, which was scratched with a 20 μL pipette tip, allowing for consistent width and length of the scratches. Scratch width was measured immediately and at regular intervals, as described in the results. The plate was marked immediately after scratching to ensure that the scratch is measured at the same location in each experiment. Cell proliferation was detected after 24 h of growth. The relative migration distance was calculated.

2.12. Mouse experiments

All mice were cared for in accordance with NIH guidelines for the care and use of laboratory animals and were in good general health in terms of appearance and activity (approved by the Committee on the Use of Live Animals in Teaching and Research of the Harbin Medical University). Mice were housed in standard cages at 22°C with a 12:12 h photoperiod, with isolation facilities and free access to water and food.

Thymus‐free nude mice were transplanted with BCPAP cells. All animals were provided with sterilized food and water. Briefly, BCPAP cells suspended in 2.5 × 10⁷ cells/mL DMEM were injected s.c. into the right side of the nude mice. Tumors were measured every 2 days with electronic calipers. The tumor size was calculated as: Tumor volume = π/6 × L × W², where L represents the longest tumor diameter and W represents the shortest tumor diameter.

2.13. Lung metastasis model of PTC

To investigate the metastasis of PTC in vivo, 200,000 BCPAP cells were injected i.v. into the lateral tail vein of 8‐week‐old BALB/c nude mice. Tumor colonies were counted in the lungs on day 30. Mice were killed and the lung tissues were collected, dissected, and stained with H&E. The histomorphology of tumor colonies was photographed, and the number of metastases was calculated.

2.14. Oxygen consumption rate and ECAR measurements

The OCR was recorded using the Agilent XFe96 Cell Extracellular Flux Analyzer. Mitochondrial respiration and glycolysis parameters were measured in intact cells using the Seahorse XF Cell Mito Stress Test (103015–100; Agilent) and Glycolysis Stress Test (103020–100; Agilent) kits. The OCR values were measured before and after injection of 2 mM oligomycin, 250 nM carbonyl cyanide p‐trifluoromethoxy‐phenylhydrazone, or 1 mM rotenone/antimycin A in the mitochondrial stress assay. The ECAR values were measured before and after injection of 10 mM glucose, 2 mM oligomycin, or 50 mM 2‐deoxyglucose in the glycolytic stress test.

2.15. Immunohistochemistry assay

Tissues were stored in formalin zinc fixative for 16–24 h and then transferred to 70% ethanol solution for paraffin embedding. Slides were blocked with endogenous peroxidase blocker (Dako) or Bloxall endogenous peroxidase and alkaline phosphatase blocker (Vector Laboratories) according to product instructions and then incubated with horse serum for 1 h at room temperature (Vector Laboratories). Primary Abs were incubated overnight at 4°C on slides. The next day, slides were treated with the appropriate antispecies enzyme‐labeled secondary Ab for 30 min at room temperature. All slides were made using DAB Peroxidase Substrate Kit (Vector Laboratories) unless otherwise noted. The TSPAN1 immunostaining was assessed using a modified semiquantitative immunoreactive score system, incorporating clinical data. The scoring criteria for category A (immunostaining intensity) was graded as: 0, negative; 1, weak; 2, moderate; and 3, strong. Category B (percentage of immunoreactive cells) was graded as: 1, 0%–25% cells; 2, 26%–50% cells; 3, 51%–75% cells; and 4, 76%–100% cells. The final scores were calculated by multiplying the scores of categories A and B for each section, resulting in scores ranging from 0 to 12. A TUNEL kit was used for apoptosis measurement according to the manufacturer's protocol.

2.16. Quantification and statistical analysis

Statistical analysis was carried out using GraphPad Prism 8.0 software. The significance of differences between individual groups was determined using unpaired t‐tests or one‐way ANOVA with Tukey's multiple comparisons test. The ratio paired t‐test was used to analyze real‐time PCR data.

3. RESULTS

3.1. Tetraspanin 1 is upregulated in human PTC and associated with PTC LN metastasis

To investigate the role of TSPAN1 in PTC, we undertook IHC staining for TSPAN1 in both PTC tissues and normal adjacent tissues. As shown in Figure 1A, the level of TSPAN1 was found to be elevated in PTC tissue sections. Subsequently, we extracted the total mRNA from the tissues and reverse transcribed it into cDNA. We then carried out qRT‐PCR assays, which revealed a significant upregulation of TSPAN1 mRNA expression in PTC tumor samples (Figure 1B). Furthermore, we collected the total proteins from the tissues and undertook western blot analyses. The results showed that the protein expression of TSPAN1 was increased in PTC tissues compared to normal adjacent tissues (Figure 1C).

FIGURE 1.

Tetraspanin 1 (TSPAN1) is upregulated in human papillary thyroid cancer (PTC) and associated with PTC lymph node metastasis. (A) Immunohistochemical (IHC) analysis of TSPAN1 expression in PTC tissues and normal adjacent tissues. (B) Quantitative real‐time (qRT)‐PCR assay was carried out to detect the mRNA expression of TSPAN1 in PTC tissues and normal adjacent tissues (n = 30). (C) Western blot assay of TSPAN1 expression in PTC tissues (T) and normal adjacent tissues (N). GAPDH expression as loading control. (D) mRNA levels of TSPAN1 in PTC lymph node (LN) metastasis tissues (n = 13) and nonmetastasis tissues (n = 17). (E) Western blot assay of TSPAN1 expression in normal thyroid cell lines and PTC cell lines. GAPDH expression as loading control. (F) qRT‐PCR assay was used to detect the mRNA expression of TSPAN1 (n = 3). Data represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 compared with the corresponding control group.

It is known that PTC is the most common type of thyroid cancer in humans, and has a very pronounced tendency to LN metastasis. ²⁷ Our data suggested that TSPAN1 mRNA was significantly increased in thyroid cancer cells with LN metastases compared to nonmetastatic samples (Figure 1D). These results indicated that TSPAN1 is upregulated in human PTC and associated with PTC LN metastasis. To further confirm TSPAN1 function at the cellular level, a series of cell lines were selected and validated, including human normal thyroid cell line Nthy‐ori‐3‐1, human papillary thyroid cancer cell line K1, BCPAP, TPC‐1, and IHH4, and anaplastic thyroid carcinoma cell line 8505C. Western blot analysis revealed high expression of TSPAN1 in thyroid cancer cell lines, particularly in BCPAP and TPC‐1, which were used as representative cell models in our study (Figure 1E). Moreover, the mRNA level of TSPAN1, as tested by qRT‐PCR, was also upregulated in thyroid cancer cell lines (Figure 1F). These results collectively suggest that TSPAN1 is upregulated in human PTC and is associated with PTC LN metastasis at both the tissue and cellular levels.

3.2. Downregulation of TSPAN1 inhibits PTC cell proliferation, migration, and invasion

Given the high expression of TSPAN1 in PTC tumor samples, we sought to investigate the functional consequences resulting from abnormal TSPAN1 expression. Additionally, as TSPAN1 was significantly highly expressed in BCPAP and TPC‐1 cells, we downregulated endogenous TSPAN1 by stably transfecting these cells with shRNA using lentivirus. The knockdown efficiency was confirmed by western blot analysis (Figures S1–S3). To exclude the effect of off‐target effects, we selected two shRNA sequences. First, cell proliferation viability was detected by CCK‐8 assay. As shown in Figure 2A, it was powerfully inhibited by downregulation of TSPAN1 in both BCPAP and TPC‐1 cells. Transwell assay and scratching experiments indicated that downregulation of TSPAN1 reduced the migratory capacity of BCPAP and TPC‐1 cells (Figure 2C,D). Western blot analysis showed that the epithelial marker E‐cadherin was upregulated, whereas the mesenchymal markers N‐cadherin and vimentin were downregulated in TSPAN1 knockdown cells compared to those in control cells (Figure S2).

FIGURE 2.

Downregulation of tetraspanin 1 (TSPAN1) inhibits papillary thyroid cancer (PTC) cell proliferation, migration, and invasion. (A) TSPAN1 was knocked down in PTC cell lines BCPAP and TPC‐1 using shRNA. CCK‐8 assay was used to detect cell proliferation activity. (B) Cell colony formation assay was carried out using BCPAP and TPC‐1 cell lines, in which TSPAN1 was knocked down by shRNA, similar to (A). (C) Cell migration and invasion assays were carried out in BCPAP and TPC‐1 cell lines. Cell number per field was counted and shown in the right panels. (D) Cell wound scratch assay was carried out, and the relative distance of cell migration was detected and shown. Scale bar, 200 μm. Data represent mean ± SEM. n = 3. *p < 0.05, **p < 0.01 compared with the corresponding control group. shNC, lentiviral plasmid expressing control short hairpin RNA.

3.3. Overexpression of TSPAN1 promotes PTC cell proliferation, migration, and invasion

Following the confirmation of the cellular effects resulting from TSPAN1 knockdown in both BCPAP and TPC‐1 cells, we proceeded to overexpress exogenous TSPAN1 to analyze its function. The overexpression efficiency was verified through western blot analysis (Figures S1–S3). The coding sequence of TSPAN1 was cloned and inserted into plasmids to package lentivirus, which infected both BCPAP and TPC‐1 cells. Through screening with puromycin, the cell lines that stably overexpressed exogenous TSPAN1 gene were obtained, then the cells were subjected to cell proliferation assay by CCK‐8. The results showed that overexpression of TSPAN1 could dramatically increase cell viability (Figure 3A). Next, a cell colony formation assay was carried out and showed that TSPAN1 could improve cell colony numbers (Figure 3B). Similar to previous experiments, we undertook cell migration and invasion assays, which revealed that exogenous expression of TSPAN1 enhanced the migratory and invasive capabilities of PTC cells (Figure 3C,D). According to the western blot analysis (Figures S1–S3), overexpression of TSPAN1 led to a downregulation of the epithelial marker E‐cadherin, while the mesenchymal markers N‐cadherin and vimentin were upregulated in comparison to control cells. These results collectively indicated that overexpression of TSPAN1 promotes PTC cell proliferation, migration, and invasion.

FIGURE 3.

Tetraspanin 1 (TSPAN1) overexpression promotes papillary thyroid cancer (PTC) cell proliferation, migration, and invasion. (A) TSPAN1 was stably overexpressed in BCPAP and TPC‐1 cells. CCK‐8 assay was used to detect cell proliferation activity. (B) Cell colony formation assay was carried out using BCPAP and TPC‐1 cell lines, in which TSPAN1 was stably overexpressed, similar to (A). (C) Cell migration and invasion assays were carried out in BCPAP and TPC‐1 cell lines. Cell number per field was counted and shown in bottom panels. (D) Cell wound scratch assay was carried out, and the relative distance of cell migration was detected and shown. Scale bar, 200 μm. Data represent mean ± SEM. n = 3. *p < 0.05, **p < 0.01 compared with the corresponding control group.

3.4. Crucial role of TSPAN1 in PTC glycolysis and mitochondrial activity

To investigate the pathways regulated by TSPAN1, we reanalyzed RNA‐seq data from pancreatic cancer cells where TSPAN1 was knocked down. ²⁸ The results of the Gene Set Enrichment Analysis revealed that the glycolysis and metabolic regulation pathways were enriched in the TSPAN1 knockdown groups (Figure S2). Therefore, we used the Seahorse assay to measure the ECAR and OCR to determine whether TSPAN1 downregulation affected glycolysis metabolism in PTC cells. In addition to the observed effects of TSPAN1 knockdown on the proliferation of PTC cells, these cells showed significantly reduced glycolytic ECAR, which indicates decreased lactate production from pyruvate during glycolysis (Figure 4A,B). In contrast, PTC cells knocking down TSPAN1 displayed higher OCR compared with the control cells (Figure 4C,D). The glycolytic pathway relies on glucose as an important carbon source, and its inhibition can completely block glycolysis. To inhibit glycolysis in PTC cells, we used 2‐DG, a glucose analog that acts as a glucose metabolism inhibitor, targeting hexokinase. At the basal level, 2‐DG inhibited cell proliferation, as tested by the CCK‐8 assay. However, the blocking effect of 2‐DG was reduced in BCPAP cells with TSPAN1 knockdown, suggesting that TSPAN1 regulates cell proliferation through the glycolysis pathway (Figure 4E). Conversely, we also examined the effect of 2‐DG on TSPAN1‐overexpressing BCPAP cells and found that exogenous TSPAN1 did not influence cell growth rate (Figure 4F). These findings indicate that TSPAN1 is necessary for PTC cell glycolysis and proliferation.

FIGURE 4.

Tetraspanin 1 (TSPAN1) is essential for papillary thyroid cancer (PTC) glycolysis and mitochondrial activity. (A, B) TSPAN1 knockdown (A) BCPAP and (B) TPC‐1 cells were analyzed for extracellular acidification rate (ECAR) on a Seahorse device. (C, D) TSPAN1 knockdown (C) BCPAP and (D) TPC‐1 cells were analyzed for oxygen consumption rate (OCR) on a Seahorse device. (E) Endogenous TSPAN1 was knocked down in BCPAP cells. Cells were then treated with 10 μM 2‐deoxy‐D‐glucose (2‐DG) to block glycolysis, then cell proliferation was detected using CCK‐8 assay. (F) BCPAP cells with overexpressed TSPAN1 were treated with 10 μM 2‐DG, then CCK‐8 assay was carried out to test cell proliferation activity. Data represent mean ± SEM. n = 3. *p < 0.05, **p < 0.01 compared with the corresponding control group. FCCP, carbonyl cyanide p‐trifluoromethoxy‐phenylhydrazone; ns, not significant; OD450, optical density at 450 nm; Rote/AA, rotenone/antimycin A; shNC, lentiviral plasmid expressing control short hairpin RNA.

3.5. Tetraspanin 1 enhances ERK phosphorylation and glycolysis

The MAPK pathway is known to be critical for tumor proliferation and glycolysis and is regulated by protein phosphorylation. Thus, we investigated the effect of TSPAN1 on the MAPK signaling pathway through immunoblotting. Overexpression of TSPAN1 significantly increased the phosphorylation level of ERK (Thr202/Tyr204), but not JNK (Thr183/Tyr185) or p38 (Thr180/Tyr182) in BCPAP and TPC‐1 cells. Conversely, downregulation of TSPAN1 decreased the phosphorylation level of ERK1/2 (Figures 5A and S3). To determine whether TSPAN1 directly affects PTC cell glycolysis through the activation of the ERK pathway, we introduced an activated ERK construct into TSPAN1‐knockdown TPC cells. The E322K variant of ERK2, which is constitutively active due to a mutation, was used. ²⁹ We transfected ERK2‐E322K into BCPAP and TPC‐1 cells, which had endogenous TSPAN1 knocked down by shRNA. These cells were then subjected to an ECAR assay, and the results indicated that TSPAN1 downregulation inhibited cell glycolysis, glycolytic capacity, and glycolytic reserve, as mentioned earlier (Figure 5B,C). Interestingly, ERK2‐E322K overexpression could dramatically rescue these functions inhibited by knocking down TSPAN1 (Figure 5B,C). Thus, it can be concluded that the TSPAN‐ERK1/2 axis affects PTC cell glycolysis. Subsequently, we examined the effect of ERK2‐E322K on PTC cell proliferation using the CCK‐8 assay. The results showed that the viability of both BCPAP and TPC‐1 cells significantly recovered when the mutated ERK2 was overexpressed (Figure 5D,F). We have previously reported that TSPAN1 is crucial for PTC cell migration and invasion. Therefore, we assessed these processes in the presence of ERK2‐E322K expression. The results indicated that the constitutive mutation of ERK2 increased PTC cell migration and invasion (Figure 5E). In summary, our findings suggest that TSPAN1 promotes PTC cell glycolysis, proliferation, migration, and invasion by upregulating the activation of the ERK pathway, and the ERK2‐E322K mutation can mitigate the effects caused by TSPAN1 knockdown.

FIGURE 5.

Tetraspanin 1 (TSPAN1) increases ERK phosphorylation and glycolysis. (A) TSPAN1 was overexpressed or knocked down in BCPAP cells; immunoblotting and relative levels of phosphorylated ERK (Thr202/Tyr204) are shown. GAPDH was used as loading control (shNC). (B, C) Constitutive activation mutation of ERK2 (E322K) was overexpressed in TSPAN1‐knockdown (B) BCPAP and (C) TPC‐1 cells. Glycolysis activity was detected using extracellular acidification rate (ECAR) assay. (D) BCPAP TPC‐1 cells were used to test cell viability by CCK‐8 assay. (E) Representative images of migration and invasion assays. Cell numbers per field were counted and shown. Scale bar, 200 μm. Data represent mean ± SEM. n = 3, *p < 0.05, **p < 0.01 compared with the corresponding control group. OD450, optical density at 450 nm.

3.6. Aerobic glycolysis enhanced by TSPAN1 through activating the ERK‐c‐Myc pathway

To further investigate the mechanism by which the TSPAN1‐ERK axis regulates PTC cell aerobic glycolysis, we measured the mRNA expression of glycolysis pathway genes using qRT‐PCR. As shown in Figure 6A,B, the expression of glycolysis genes was dramatically reduced when endogenous TSPAN1 was knocked down in both BCPAP and TPC‐1 cells. Glycolysis is a hallmark of cancer. ²⁰ Therefore, we examined the expression of glycolysis genes in PTC tissues and adjacent normal tissues. The results showed that the mRNA levels of LDHA, ENO1, PGK1, and GLUT1 were significantly increased in PTC tissues, indicating that PTC requires more glucose to maintain cell proliferation and survival (Figure 6C–F). The ERK/c‐Myc pathway is known to be activated in various types of cancers, particularly in PTC. We assessed c‐Myc expression in PTC cells when TSPAN1 was knocked down and observed a significant decrease in c‐Myc levels (Figure 6G). Interestingly, the overexpression of ERK2‐E322K rescued the decline in c‐Myc induced by TSPAN1 knockdown, consistent with our previous findings. These results suggest that c‐Myc acts downstream of the TSPAN1/ERK pathway, influencing PTC cell glycolysis.

FIGURE 6.

Tetraspanin 1 (TSPAN1) enhances aerobic glycolysis through activating the ERK‐c‐Myc pathway. (A, B) Relative expression of glycolysis genes in TSPAN1‐knockdown (A) BCPAP and (B) TPC‐1 cells. (C–F) Papillary thyroid cancer (PTC) tissues and normal adjacent tissues were collected and the representative glycolysis gene mRNA levels were detected using quantitative real‐time PCR. n = 15. (G) Constitutive activation mutation of ERK2 (E322K) was stably overexpressed in TSPAN1‐knockdown BCPAP and TPC‐1 cells. Cells were treated with 10 μM cycloheximide for the indicated times, and the expression of c‐Myc was tested using western blot assay. β‐Actin as loading control. Results showed that TSPAN1 increased the stability of c‐Myc protein and ERK2 activation could rescue c‐Myc degradation. Data represent mean ± SEM. n = 3. *p < 0.05, **p < 0.01 compared with the corresponding control group. shNC, lentiviral plasmid expressing control short hairpin RNA.

3.7. Tetraspanin‐1 promotes PTC tumor growth and lung metastasis in vivo

Having observed the effects of TSPAN1 on PTC cell proliferation and metastasis at the cellular level, we sought to determine whether TSPAN1 also influences PTC tumor growth in vivo. Subcutaneous injection of TSPAN1 knockdown BCPAP cells into mice significantly inhibited tumor growth (Figure 7A). At the end of the experiment, excised tumor tissues were weighed, and the knockdown of TSPAN1 resulted in a halving of tumor weight (Figure 7B). The H&E and IHC staining of tissue sections revealed a significant reduction in Ki‐67 (a cell proliferation marker), phosphorylated ERK1/2, and c‐Myc signals in shTSPAN1 samples (Figure 7C). Additionally, the proportion of TUNEL‐positive cells increased in all shTSPAN1 groups compared to the control group (Figure 7C). Furthermore, injection of TSPAN1‐knockdown BCPAP cells into the tail veins of nude mice was undertaken to investigate PTC cell metastasis in vivo. Interestingly, collection of lung metastatic tissues showed that downregulation of TSPAN1 significantly reduced the size and number of metastatic PTC (Figure 7D). Together, these findings confirm that TSPAN1 promotes PTC tumor growth and lung metastasis in vivo.

FIGURE 7.

Tetraspanin 1 (TSPAN1) increased papillary thyroid cancer (PTC) tumor growth and lung metastasis in vivo. (A) TSPAN1‐knockdown BCPAP cells were injected into mice s.c. and tumor volumes were detected at the indicated times. (B) Tumor weights were calculated and shown. (C) Immunohistochemistry results of the positivity of Ki‐67, p‐ERK, c‐Myc, and TUNEL from xenograft tumor sections. (D) Metastasis of PTC in lung tissue was detected and subjected to H&E staining. Scale bar, 100 μm. Data represent mean ± SEM. n = 5. *p < 0.05, **p < 0.01, ***p < 0.001 compared with the corresponding control group. shNC, lentiviral plasmid expressing control short hairpin RNA.

4. DISCUSSION

This research focuses on the functional and mechanistic studies of TSPAN1 in PTC tumors. First, we examined the expression of TSPAN1 in human tumor samples and observed a gradual increase with the progression of PTC tumor development. These findings suggest that TSPAN1 might play a role in PTC tumor development and act as a pro‐oncogene. Subsequently, we analyzed changes in TSPAN1 expression, including protein and RNA levels, in a series of PTC tumor cell lines. Compared to normal cell lines, tumor cells showed significantly higher levels of TSPAN1 expression, which corroborated the findings from human tumor samples. In our ongoing work, we aim to expand the number of tumor samples and undertake a comprehensive study on the prognostic relationship between TSPAN1 and PTC tumors.

With knowledge of TSPAN1's function in PTC tumors, our focus shifted to exploring the specific mechanisms underlying its regulation of PTC tumor development. We utilized published RNA‐seq data ²⁸ that, although the cell line used was pancreatic cancer, also provided valuable insights for studying the mechanisms involving TSPAN1. Upon reanalysis of the RNA‐seq data, we observed significant enrichment of glycolytic and metabolic pathways following TSPAN1 knockdown, indicating that TSPAN1 might influence the progression of PTC tumor development by impacting cellular metabolism. The OCR and ECAR experiments indicated that TSPAN1 knockdown significantly reduced cellular glycolytic capacity, while TSPAN1 overexpression reversed this effect. Additionally, treatment with 2‐DG effectively reversed this pathway (Figure 4). Further analysis of the RNA‐seq data revealed that TSPAN1 overexpression markedly promoted MAPK pathway enrichment. Consequently, we investigated the activation of ERK phosphorylation and the expression of the downstream pro‐oncogene c‐Myc. The results revealed significant regulation of the ERK‐c‐Myc axis by TSPAN1. Complementary expression of persistently activating ERK2 mutations in TSPAN1 knockdown cell lines fully rescued the growth arrest caused by TSPAN1 deficiency (Figure 5). Further studies, considering RNA‐seq data from PTC cells, will be undertaken.

Finally, we undertook subcutaneous tumorigenesis experiments using nude mice and showed that knockdown of TSPAN1 significantly reduced tumor growth rate. Immunohistochemical staining showed that expression of proliferation marker Ki‐67 was significantly downregulated and ERK phosphorylation and c‐Myc were significantly upregulated. Furthermore, we examined the metastatic ability of PTC tumors in vivo, and knockdown of TSPAN1 significantly reduced the number and size of metastatic foci in the lungs of mice. In summary, we found that TSPAN1 is an oncogene in PTC tumorigenesis and metastasis, in which TSPAN1 affects the ERK‐c‐Myc axis to upregulate PTC cell glycolysis (Figure 8).

FIGURE 8.

Schematic presentation of mechanism underlying tetraspanin 1 (TSPAN1)‐regulated papillary thyroid cancer progression.

Based on our results, we propose that TSPAN1 acts as an oncogene in PTC by modulating glycolytic metabolism and promoting the aggressive behavior of PTC cells. Therefore, targeting TSPAN1 could be a promising therapeutic approach for PTC treatment. Inhibiting TSPAN1 expression or targeting its downstream signaling pathways, such as the ERK pathway, could help suppress tumor growth and metastasis in PTC patients. Further research in this area is warranted to better understand the molecular mechanisms underlying the role of TSPAN1 in PTC. Additionally, exploring the therapeutic potential of targeting TSPAN1 in preclinical and clinical settings could provide valuable insights into the development of effective and targeted therapies for PTC patients.

AUTHOR CONTRIBUTIONS

J.H., J.Z., and C.N. initiated the project and designed the experiments. J.H., C.X., B.L., Y.W., R.P., W.B., R.S., G.H., L.K., J.Y., Z.D., L.C., and J.J. performed the experiments. J.H., J.Z., and C.N. wrote the manuscript.

FUNDING INFORMATION

This study was supported by the National Natural Science Foundation of China (Grant No. 81902954), Postdoctoral Research Foundation of China (Grant Nos. 2018 M630368 and 2018 M641848), Hei Longjiang Postdoctoral Foundation (Grant Nos. LBH‐Z17143, LBH‐Z18118, LBH‐Z19182, and LBH‐Q17122), Nn10 program of Harbin Medical University Cancer Hospital, Haiyan Research Fund of Harbin Medical University Cancer Hospital (Grant Nos. JJZD2017‐03, JJMS2021‐04, and JJQN2018‐14), and The Youth Talent Support Program of Harbin Medical University Cancer Hospital (Grant No. BJQN2018‐01).

CONFLICT OF INTEREST STATEMENT

The authors have no conflict of interest.

ETHICS STATEMENTS

Approval of the research protocol by an institutional review board: All procedures performed in studies involving human participants were in accordance with the standards upheld by the Research Ethics Committee of Harbin Medical University Cancer Hospital and with those of the 1964 Helsinki Declaration and its later amendments for ethical research involving human subjects. All animal experiments were approved by the Ethics Committee of Harbin Medical University Cancer Hospital for the use of animals and conducted in accordance with the National Institutes of Health Laboratory Animal Care and Use Guidelines.

Informed consent: Written informed consent was obtained from a legally authorized representative(s) for anonymized patient information to be published in this article.

Registry and registration no. of the study/trial: N/A.

Animal studies: Animal experiments were performed with the approval of the Committee on the Use of Live Animals in Teaching and Research of the Harbin Medical University.

Supporting information

Figures S1–S3.

Han J, Xie C, Liu B, et al. Tetraspanin 1 regulates papillary thyroid tumor growth and metastasis through c‐Myc‐mediated glycolysis. Cancer Sci. 2023;114:4535‐4547. doi: 10.1111/cas.15970