DYRK2 promotes chemosensitivity via p53‐mediated apoptosis after DNA damage in colorectal cancer

Abstract

Dual‐specificity tyrosine‐regulated kinase 2 (DYRK2) is a protein kinase that phosphorylates p53‐Ser46 and induces apoptosis in response to DNA damage. However, the relationship between DYRK2 expression and chemosensitivity after DNA damage in colorectal cancer has not been well investigated. The aim of the present study was to examine whether DYRK2 could be a novel marker for predicting chemosensitivity after 5‐fluorouracil‐ and oxaliplatin‐induced DNA damage in colorectal cancer. Here we showed that DYRK2 knockout decreased the chemosensitivity to 5‐fluorouracil and oxaliplatin in p53 wild‐type colorectal cancer cells, whereas the chemosensitivity remained unchanged in p53‐deficient/mutated colorectal cancer cells. In addition, no significant differences in chemosensitivity to 5‐fluorouracil and oxaliplatin between scramble and siDYRK2 p53(−/−) colorectal cancer cells were observed. Conversely, the combination of adenovirus‐mediated overexpression of DYRK2 with 5‐fluorouracil or oxaliplatin enhanced apoptosis and chemosensitivity through p53‐Ser46 phosphorylation in p53 wild‐type colorectal cancer cells. Furthermore, DYRK2 knockout decreased chemosensitivity to 5‐fluorouracil and oxaliplatin in p53 wild‐type xenograft mouse models. Taken together, these findings demonstrated that DYRK2 expression was associated with chemosensitivity to 5‐fluorouracil and oxaliplatin in p53 wild‐type colorectal cancer, suggesting the importance of evaluating the p53 status and DYRK2 expression as a novel marker in therapeutic strategies for colorectal cancer.

We show the strong relationship between DYRK2 expression and chemosensitivity after DNA damage in p53 wild‐type, but not in p53 mutated, colorectal cancer cells. Our findings provide the importance of routine preoperative measurement of p53 status and DYRK2 expression that may help to predict chemosensitivity in patients undergoing 5‐fluorouracil‐ and oxaliplatin‐based chemotherapy for colorectal cancer.

Abbreviations

Advs

adenovirus vectors

CRC

colorectal cancer

DYRK2

dual‐specificity tyrosine‐phosphorylation‐regulated kinase 2

FU

fluorouracil

MTS

3‐(4,5‐dimethylthiazol‐2‐yl)‐5‐(3‐carboxymethoxyphenyl)‐2‐(4‐sulfophenyl)‐2H‐tetrazolium

PARP

poly(ADP‐ribose)polymerase

PI

propidium iodide

1. INTRODUCTION

Colorectal cancer (CRC) is the third most common malignancy and the third leading cause of cancer deaths worldwide. ¹ Recent advances in treatment have prolonged the survival rates in patients with CRC. ² , ³ , ⁴ However, patients with advanced CRC have a poor prognosis due to high rates of recurrence and metastasis. ⁵ , ⁶ Therefore, identifying a prognostic factor that allows for more accurate prediction of survival in CRC treatments is essential.

Chemotherapy is an integral part of treatment strategies for patients with advanced CRC. 5‐Fluorouracil (5‐FU) and oxaliplatin have long been used as standard treatments to induce DNA damage, cell‐cycle arrest, and apoptosis in CRC cells. ⁷ , ⁸ 5‐FU‐ and oxaliplatin‐based chemotherapies such as FOLFOX (5‐FU + leucovorin + oxaliplatin) and XELOX (capecitabine [5‐FU prodrug] + oxaliplatin) are effective for advanced CRC. ⁹ Although these chemotherapy regimens can prevent metachronous recurrence, eradicate minimal residual disease, and improve patient prognosis, ¹⁰ patients with the same CRC stages undergoing the same treatments may have different prognosis ¹¹ , ¹² Therefore, identifying novel predictive markers and therapeutic approaches in chemotherapy could help to prolong the survival of patients with CRC.

Dual‐specificity tyrosine‐regulated kinase 2 (DYRK2) is a protein kinase of the DYRK family that primarily localizes in the cytoplasm and shows intracellular serine/threonine kinase activity. ¹³ DYRK2 functions as a pro‐apoptotic kinase that induces apoptosis in response to DNA damage through p53‐Ser46 phosphorylation in the nucleus ¹⁴ , ¹⁵ Previous studies have shown that DYRK2 acts as a tumor suppressor in various cancers triggering major antitumor and pro‐apoptotic signals. ¹⁶ , ¹⁷ , ¹⁸ Clinically, low DYRK2 expression has been associated with poor prognosis in CRC. ¹⁷ , ¹⁹ However, the association between DYRK2 expression and the effect of cytotoxic chemotherapy‐induced DNA damage in CRC has not been thoroughly investigated. The aim of the present study was to examine whether DYRK2 could be a novel marker for predicting the effects of 5‐FU and oxaliplatin in CRC.

2. MATERIALS AND METHODS

2.1. Cell culture

Human CRC cell lines HCT116, HCT116 p53(−/−), RKO, DLD‐1, and SW480 were obtained from the JCRB Cell Bank, ATCC, and Horizon Discovery. Cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin–streptomycin (Nacalai Tesque). All cell lines were maintained at 37°C in a 5% CO₂ incubator.

2.2. CRISPR genome editing, plasmid construction, and cell transfection

DYRK2‐knockout (KO) cells were generated using CRISPR‐Cas9 technology. ²⁰ , ²¹ Target guide RNA (gRNA) sequences targeting DYRK2 genes were designed using CRISPRdirect (https://crispr.dbcls.jp). The sequences used to target DYRK2 were 5‐CCTGGATCTGTCCGTGAGCG‐3 and 5‐ACGCTGATGCTCGTAACAAC‐3.

Plasmids were transfected using PEI‐MAX (Polysciences) or Lipofectamine™ 3000 (Invitrogen) and incubated at 37°C in 5% CO₂ for 48 h. Transfected cells were first grown under antibiotic selection pressure with puromycin for 48–72 h. Selected cells were single‐cell plated onto a 10‐cm dish, and single‐cell colonies were allowed to grow for 10–14 days. Single‐cell colonies were harvested by cloning a ring, and a single DYRK2‐KO clone was isolated.

2.3. Small interfering RNA transfection

DYRK2‐specific, and negative control (scramble) small interfering (si)RNAs were purchased (Bex and Thermo Fisher Scientific). The siRNAs were transfected using RNAi MAX (Invitrogen). Gene knockdown was assessed using immunoblotting.

2.4. Adenovirus vector and cell infection

Adenovirus vector (Adv) construction and infection were performed as described previously. ¹⁸ , ²² , ²³ , ²⁴ Unfortunately, producing an adenovirus directly expressing DYRK2 from the EF1α promoter was impossible for uncertain reasons. Therefore, Advs expressing Flag‐DYRK2 were designed to depend upon Cre expression. Flag‐DYRK2‐WT and Flag‐DYRK2‐KR were inserted into the SwaI site of pAxEFLNLwi2, which was the cosmid cassette for the pAxEFNCre‐dependent expression Adv construction. ²⁴ Ad‐DYRK2‐WT and Ad‐DYRK2‐KR were used as DYRK2 and the kinase‐dead (K251R) DYRK2 mutant, respectively, and Ad‐empty, which contained no insert, was used as a control. ¹⁸ , ²² , ²³ , ²⁵

2.5. Immunoblotting

Immunoblot analyses were carried out as previously described. ¹⁸ The membranes were incubated with antibodies against anti‐DYRK2 (Sigma‐Aldrich), anti‐p53 (Santa Cruz Biotechnology), anti‐phospho‐p53‐Ser46 (Bio Academia and Cell Signaling Technology), anti‐cleaved poly (ADP‐ribose) polymerase (PARP) (Cell Signaling Technology), anti‐cleaved caspase‐3 (Cell Signaling Technology) and anti‐glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) (Santa Cruz Biotechnology). Then membranes were incubated with peroxidase‐conjugated anti‐rabbit IgG (Cell Signaling Technology) or anti‐mouse IgG (Cell Signaling Technology). The dilution ratios were all 1:1000.

2.6. MTS assay

An MTS assay was carried out in triplicate using a CellTiter 96 AQ Solution Cell Proliferation Assay Kit (Promega) according to the manufacturer's instructions. Initially, parental and DYRK2‐KO cells were seeded onto 96‐well plates (3 × 10³ cells/well) and incubated at 37°C in 5% CO₂ for 96 h. The absorbance was measured at 490 nm with a multiple counter (Infinite 200PRO; TECAN).

Next, in vitro chemosensitivity assay, parental and DYRK2‐KO cells were plated onto 96‐well culture plates with each concentration of 5‐FU or oxaliplatin. After incubation at 37°C for 72 h, the absorbance was measured at 490 nm with a multiple counter.

2.7. Colony formation assay

In a colony formation assay, parental and DYRK2‐KO cells were plated onto six‐well culture plates with each concentration of 5‐FU or oxaliplatin. After 14 days of culture, cells were fixed with 4% formaldehyde and stained with Giemsa solution. The number of visible colonies was calculated.

2.8. Wound healing assay

A cell scratch‐wound assay was performed to continuously analyze tumor cell migration in DYRK2‐KO cells. Parental and DYRK2‐KO cells (1 × 10⁶ cells) were seeded onto 12‐well plates to form a confluent monolayer. Cells in the center of the well were scratched using a sterile 200 μL pipette tip and cell‐free areas at 0 and 48 h were calculated. The ratio of wound healing was represented as [free area (at 0 h)‐free area (at 48 h)]/free area (at 0 h).

2.9. Apoptosis assay

Parental and DYRK2‐KO cells were plated onto six‐well culture plates with 5‐FU or oxaliplatin. After 48 h, the cells were treated according to the manufacturer's instructions (Annexin V‐FITC Apoptosis Detection Kit, Nacalai Tesque) and analyzed using a MACS Quant flow cytometer (Miltenyi Biotec) as previously described. ¹⁸ The numbers of apoptotic cells were defined as the total of annexin V+/PI– (early apoptosis) and annexin V+/PI+ (late apoptosis). The quantification of apoptosis was carried out using FlowJo software.

2.10. Mouse xenografts and in vivo treatment

The experimental animal protocol was approved by the Institutional Animal Care and Use Committee of Jikei University (No. 2021‐038). Seven‐week‐old male nude mice (BALB/cAJcl‐nu/nu; CLEA) were subcutaneously injected with parental or DYRK2‐KO HCT116 cells (2 × 10⁶) suspended in a Matrigel Basement Membrane Matrix (Corning). Tumor volumes were calculated according to the following formula: V (mm³) = 0.5 × (larger diameter × smaller diameter²). When the tumors reached 100 mm³, the mice were randomized into experimental groups (n = 4 per group). Vehicle (water), 5‐FU (5 mg/kg) or oxaliplatin (5 mg/kg) were intraperitoneally administered twice a week. Tumor growth was evaluated based on tumor size.

2.11. Immunohistochemistry

For immunostaining, excised xenografts were fixed with 4% paraformaldehyde and paraffin‐embedded. Six μm paraffin sections cut from the embedding block were stained with the primary antibodies anti‐Ki67 (dilution 1:500; Cell Signaling Technology) and anti‐cleaved caspase‐3 (dilution 1:500, Cell Signaling Technology). Sections were observed under a BZ‐9000 fluorescence microscope (Keyence). The number and proportion of immunopositive cells were measured by counting 20 fields of view.

2.12. Statistical analysis

All statistical analyses were performed using GraphPad Prism (version 9), and p‐values <0.05 were considered statistically significant. In vitro and in vivo data were presented as the mean ± standard error of the mean (SEM). Group comparisons were performed using the two‐tailed Welch t‐test or one‐way ANOVA.

3. RESULTS

3.1. DYRK2 is not involved in cell proliferation and migration under basal conditions

To examine the functional role of DYRK2 during chemotherapy in treating CRC, we generated DYRK2‐KO HCT116, RKO, DLD‐1, and SW480 cells (Figure 1A). A previous study showed that DYRK2 induced p53‐regulated apoptosis‐inducing protein 1 expression and DNA damage‐triggered apoptosis in a p53‐Ser46 phosphorylation‐dependent manner. ¹⁴ Additionally, overexpression of DYRK2 in CRC cell lines using Ad‐DYRK2‐WT induced p53‐Ser46 phosphorylation. ¹⁸ Therefore, we initially examined the expression levels of p53‐Ser46 phosphorylation in parental and DYRK2‐KO cells under basal conditions. Importantly, the expression level of p53‐Ser46 phosphorylation was comparable between the parental and DYRK2‐KO cells under basal conditions without chemotherapy‐induced DNA damage (Figure 1A).

FIGURE 1.

DYRK2 is not involved in cell proliferation and migration under basal conditions. (A) DYRK2‐KO cells (HCT116, RKO, DLD‐1, and SW480) were generated using CRISPR‐Cas9 technology. Expression of DYRK2, phospho‐p53‐Ser46, and p53 was analyzed using immunoblotting. (B) Proliferation of parental and DYRK2‐KO cells. Cell proliferation was measured using the MTS assay. Data are presented as mean ± SEM (n = 3). ns, not significant.

Next, an MTS assay was performed to compare the cell proliferation of parental and DYRK2‐KO cells under basal conditions. The proliferation of DYRK2‐KO cells remained unchanged compared with that of parental cells (Figure 1B). Similarly, no significant differences between parental and DYRK2‐KO cells were observed in the colony formation (Figure S1A,B) and wound healing assays (Figure S1C,D). These results suggested that DYRK2 was not involved in CRC cell proliferation and migration under basal conditions without chemotherapy‐induced DNA damage.

3.2. DYRK2‐knockout decreases the chemosensitivity of p53 wild‐type CRC cells to 5‐FU and oxaliplatin

To investigate whether DYRK2 regulated the chemosensitivity of CRC cells via p53‐Ser46 phosphorylation after DNA damage, we evaluated the viability of CRC cells treated with 5‐FU and oxaliplatin. HCT116 and RKO cells were classified as wild‐type p53, while DLD‐1 and SW480 cells as mutant p53. ²⁶ The MTS assay revealed that the cell viability of DYRK2‐KO cells increased under 5‐FU and oxaliplatin compared with that of parental HCT116 and RKO cells harboring wild‐type p53 (Figure 2A,B). In addition, the IC₅₀ of 5‐FU and oxaliplatin in DYRK2‐KO HCT116 and RKO cells was higher than that in the parental cells (Figure 2A,B). By contrast, the viability of DYRK2‐KO cells was comparable under 5‐FU and oxaliplatin in DLD‐1 and SW480 cells harboring mutant p53 (Figure 2C,D). Similarly, the colony formation assay revealed that the viability of DYRK2‐KO cells treated with 5‐FU and oxaliplatin increased in HCT116 cells, but not in DLD‐1 cells (Figure 2E,F). These results suggested that DYRK2‐KO decreased the chemosensitivity of CRC cells to 5‐FU and oxaliplatin dependent on the p53 status.

FIGURE 2.

DYRK2‐KO decreases the chemosensitivity of p53 wild‐type CRC cells to 5‐FU and oxaliplatin. (A–D) Cell viability under 5‐FU and oxaliplatin in parental and DYRK2‐KO cells (HCT116, RKO, DLD‐1, and SW480). Cell viability was measured using the MTS assay. The IC₅₀ values of 5‐FU and oxaliplatin in parental and DYKR2‐KO cells. Data are presented as the mean ± SEM (n = 3). (E, F) Colony formation assay under 5‐FU (5 μM) and oxaliplatin (5 μM) in parental and DYRK2‐KO cells. The number of colonies in each well was counted and the fold change was calculated, along with the parental cells. Data are presented as the mean ± SEM (n = 3). (G) Expression of phospho‐p53‐Ser46, and p53 in parental and DYRK2‐KO HCT116 cells was analyzed using immunoblotting. *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

In parental HCT116 cells, p53‐Ser46 phosphorylation was induced in a concentration‐dependent manner treated with 5‐FU and oxaliplatin (Figure 2G). However, p53‐Ser46 phosphorylation was not induced by 5‐FU or oxaliplatin in DYRK2‐KO HCT116 cells (Figure 2G ). These results indicated that DYRK2‐KO impaired p53‐Ser46 phosphorylation in p53 wild‐type CRC cells, thus resulting in a low response to 5‐FU and oxaliplatin.

3.3. DYRK2 promotes DNA damage‐induced apoptosis under 5‐FU and oxaliplatin in p53 wild‐type CRC cells

Next, we examined DNA damage‐induced apoptosis and apoptosis‐related molecules in parental and DYRK2‐KO CRC cell lines carrying wild‐type p53. Phospho‐p53‐Ser46, cleaved PARP, and caspase‐3 were detected in parental HCT116 and RKO cells after treatment with 5‐FU and oxaliplatin; however, their effects were attenuated in DYRK2‐KO cells (Figure 3A). To confirm the relationship between DYRK2 and apoptosis during chemotherapy, we assessed the rate of apoptosis using flow cytometry. The total numbers of early and late apoptotic HCT116 and RKO cells were significantly higher in the parental cells than in the DYRK2‐KO cells (Figure 3B–D). These results suggested that DYRK2 promoted DNA damage‐induced apoptosis in p53 wild‐type CRC cells treated with 5‐FU and oxaliplatin.

FIGURE 3.

DYRK2 promotes DNA damage‐induced apoptosis under 5‐FU and oxaliplatin in p53 wild‐type CRC cells. (A) Expression of phospho‐p53‐ser46, p53, cleaved PARP, and cleaved caspase‐3 under 5‐FU (5 μM) and oxaliplatin (5 μM) treatment for 72 h were analyzed using immunoblotting. (B, C) Ratio of total apoptotic parental and DYRK2‐KO HCT116 cells under 5‐FU (5 μM) and oxaliplatin (5 μM) for 48 h was analyzed using annexin V‐FITC/PI double staining. Data are presented as the mean ± SEM (n = 3). (D) Ratio of total apoptotic parental and DYRK2‐KO RKO cells under 5‐FU (5 μM) and oxaliplatin (5 μM) for 48 h was analyzed using annexin V‐FITC/PI double staining. Data are presented as the mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ns, not significant.

3.4. DYRK2 enhances chemosensitivity in a p53‐dependent manner

To investigate whether DYRK2 regulates the chemosensitivity of CRC cells dependent on the p53 status after DNA damage, we compared the viability of parental HCT116 cells with that of p53(−/−) cells under 5‐FU and oxaliplatin. Herein, siRNA DYRK2 was used to generate DYRK2‐knockdown HCT116 p53(−/−) cells (Figure 4A). The MTS assay revealed that the viability of p53(−/−) cells increased under 5‐FU and oxaliplatin compared with that of parental cells, while there were no significant differences in the viability between the control and siRNA DYRK2 p53(−/−) cells treated with 5‐FU and oxaliplatin (Figure 4B). Furthermore, the apoptosis assay revealed that the total numbers of early and late apoptosis cells were significantly higher in parental cells than in p53(−/−) cells. In addition, no significant difference was found in the total numbers of early and late apoptotic cells between the control and siRNA DYRK2 p53(−/−) cells treated with 5‐FU and oxaliplatin (Figure 4C,D). Collectively, these results demonstrated that DYRK2‐induced chemosensitivity to 5‐FU and oxaliplatin was dependent on the p53 status.

FIGURE 4.

DYRK2 enhances chemosensitivity in a p53‐dependent manner. (A) DYRK2‐knockdown HCT116 p53(−/−) cells were generated by transient transfection with siRNA DYRK2. Expression of DYRK2, and p53 was analyzed using immunoblotting. (B) Cell viability under 5‐FU and oxaliplatin in parental and siRNA knockdown (scramble and DYRK2) HCT116 p53(−/−) cells. (C, D) Ratio of total apoptotic parental and siRNA knockdown (scramble and DYRK2) HCT116 p53(−/−) cells under 5‐FU (5 μM) and oxaliplatin (5 μM) for 48 h was analyzed using annexin V‐FITC/PI double staining. Data are presented as the mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

3.5. Forced DYRK2 expression by adenovirus and chemotherapy has a synergistic effect on CRC cells

Previously, we have reported that p53‐Ser46 phosphorylation was induced by overexpressing Ad‐DYRK2‐WT compared with Ad‐empty and DYRK2‐KR in HCT116 cells. ¹⁸ To further investigate the function of DYRK2 during chemotherapy, we next examined whether forced DYRK2 expression enhanced the chemosensitivity to 5‐FU and oxaliplatin through p53‐Ser46 phosphorylation. We transiently overexpressed DYRK2 (Ad‐DYRK2‐WT), a kinase‐dead (K251R) DYRK2 mutant (Ad‐DYRK2‐KR), or Adv‐empty as a control in combination with 5‐FU or oxaliplatin in HCT116 cells. Cell viability under low‐dose 5‐FU and oxaliplatin decreased slightly compared with that under basal conditions when Ad‐empty was overexpressed (Figure 5A). Conversely, cell viability under low‐dose 5‐FU and oxaliplatin decreased significantly compared with that under basal conditions following Ad‐DYRK2‐WT overexpression (Figure 5A). Similar results were observed with Ad‐DYRK2‐KR overexpression; however, the rate of decrease in cell viability was lower than that with Ad‐DYRK2‐WT overexpression (Figure 5A). In addition, the synergistic effect (viability under 5FU or oxaliplatin − viability under no treatment) of forced DYRK2 expression by Advs and chemotherapy (5‐FU and oxaliplatin) was higher in cells overexpressing Ad‐DYRK2‐WT than that in cells overexpressing Ad‐empty or DYRK2‐KR (Figure 5B). Phospho‐p53‐Ser46, cleaved PARP, and caspase‐3 were detected in Ad‐DYRK2‐WT cells treated with low‐dose 5‐FU and oxaliplatin; however, their effects were attenuated in Ad‐empty or DYRK2‐KR cells (Figure 5C).

FIGURE 5.

Forced DYRK2 expression by adenovirus and chemotherapy has a synergistic effect on CRC cells. (A) Cell viability assay in the combination of forced DYRK2 expression by adenovirus with 5‐FU (1 μM) and oxaliplatin (1 μM) for 72 h in HCT116 cells. Cell viability was measured using the MTS assay. Data are presented as the mean ± SEM (n = 3). (B) Synergistic effect of chemosensitivity of 5‐FU (1 μM) and oxaliplatin (1 μM) under forced Ad‐DYRK2 expression for 72 h in HCT116 cells. Data are presented as the mean ± SEM (n = 3). (C) Expression of phospho‐p53‐Ser46, p53, cleaved PARP, and cleaved caspase‐3 in the combination of forced DYRK2 expression by adenovirus and 5‐FU (1 μM) and oxaliplatin (1 μM) were analyzed using immunoblotting. (D, E) Ratio of total apoptotic of forced DYRK2 expression by adenovirus and 5‐FU (1 μM) and oxaliplatin (1 μM) for 48 h in HCT116 cells was analyzed using annexin V‐FITC/PI double staining. Data are presented as the mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001, ns, not significant.

In the apoptosis assay, the total numbers of early and late apoptotic cells under low‐dose 5‐FU and oxaliplatin were significantly higher than that under no treatment in Ad‐DYRK2‐WT HCT116 cells (Figure 5D,E). However, a similar effect was not observed in the Ad‐empty or DYRK2‐KR HCT116 cells. These findings indicated that DYRK2 enhanced DNA damage‐induced apoptosis in response to 5‐FU and oxaliplatin, which is dependent upon its kinase activity through p53‐Ser46 phosphorylation.

3.6. DYRK2 regulates chemosensitivity in a xenograft model

To extend our in vitro findings, we examined the chemosensitivity of 5‐FU and oxaliplatin in parental and DYRK2‐KO HCT116 cells using xenograft tumors. The design of the experiment is shown in the scheme (Figure 6A ). Four weeks after injection, parental HCT116 cells treated with 5‐FU and oxaliplatin were significantly smaller than DYRK2‐KO cells (Figure 6B,C). Similarly, the tumor weights of parental HCT116 cells treated with 5‐FU and oxaliplatin were significantly lower than those of DYRK2‐KO cells (Figure 6D). These results indicated that DYRK2‐KO decreased the chemosensitivity to 5‐FU and oxaliplatin in p53 wild‐type colorectal xenograft tumors.

FIGURE 6.

DYRK2 regulates chemosensitivity in a xenograft model. (A) Timeline of the procedure for animal studies. (B) Images of tumors in nude mice at necropsy are shown. (C) Tumor volumes were measured at the indicated time points. n = 4 per group. Data are presented as mean ± SEM (n = 4/group). (D) Weight of tumors at 24 days is shown. (E–H) Tumors were stained by immunocytochemistry for Ki‐67 and cleaved caspase‐3. Nuclei were stained with DAPI (blue). Scale bars represent 100 μm. Data are presented as the mean ± SEM (n = 3 per group) *p < 0.05, **p < 0.01. ns, not significant.

To clarify whether DYRK2 regulated apoptosis in subcutaneous tumors, we analyzed xenograft models by immunohistochemistry. Ki‐67 and cleaved caspase‐3 were used as markers of cell proliferation and apoptosis induction, respectively. Although the proportion of Ki‐67‐positive cells was similar in parental and DYRK2‐KO cells under no treatment, the proportions of Ki‐67‐positive cells under 5‐FU and oxaliplatin in parental cells were significantly reduced compared with that in DYRK2‐KO cells (Figure 6E, F). Conversely, the proportion of cleaved caspase‐3‐positive parental cells was significantly higher than that in the DYRK2‐KO group (Figure 6G, H). Collectively, these results indicated that DYRK2‐KO inhibited apoptosis during chemotherapy in p53 wild‐type colorectal xenograft tumors.

4. DISCUSSION

In the present study, we discovered a significant relationship between DYRK2 expression and cytotoxic chemotherapy upon DNA damage in CRC cells. This relationship depends on the p53 status of the CRC cells, suggesting that the DYRK2/p53 axis plays an important role in DNA damage‐dependent apoptosis during CRC chemotherapy. Based on these findings, we propose that DYRK2 may promote the effects of 5‐FU‐ and oxaliplatin‐based chemotherapies such as FOLFOX and XELOX in p53‐wild‐type CRC.

This is the first study to evaluate the function of DYRK2 in CRC cell lines using CRISPR‐Cas9 technology. We found that the DYRK2‐KO reduced p53‐Ser46 phosphorylation and attenuated apoptosis following 5‐FU‐ and oxaliplatin‐induced DNA damage in CRC cells. Interestingly, cell proliferation and the degree of p53‐Ser46 phosphorylation were comparable between the parental and DYRK2‐KO CRC cells under basal conditions. These results suggested that the DNA damage‐dependent function of DYRK2 was induced by chemotherapy. In response to genotoxic stress, ataxia‐telangiectasia mutated kinase phosphorylates DYRK2 at Thr‐33 and Ser‐369, which enables DYRK2 to escape from degradation by dissociation from murine double minute 2, and induces the kinase activity toward p53‐Ser46 in the nucleus. ²⁷ Multiple kinases, including protein kinase C delta, homeodomain‐interacting protein kinase 2, ataxia‐telangiectasia mutated kinase, and p38α could phosphorylate p53‐Ser46 in response to DNA damage. ²⁸ Given that p53‐Ser46 phosphorylation was not induced by 5‐FU or oxaliplatin in DYRK2‐KO CRC cells, DYRK2 may be a major regulator compared with other kinases in CRC.

Based on our results, we propose the molecular mechanisms of apoptosis induced by DYRK2 during chemotherapy (Figure 7 ). DYRK2 contributes to phosphorylate p53‐Ser46 in response to DNA damage under 5‐FU and oxaliplatin and induces apoptosis in p53‐wild‐type CRC (Figure 7A). However, low DYRK2 expression may not be sufficient to induce p53‐dependent apoptosis in response to 5‐FU and oxaliplatin (Figure 7B). Conversely, in p53‐mutated CRC, the function of DYRK2 in p53‐Ser46 phosphorylation may be canceled due to the DNA binding domain mutations. ²⁶ , ²⁹ Therefore, DYRK2 could be a strong predictor of chemosensitivity, particularly in p53 wild‐type CRC.

FIGURE 7.

Function of DYRK2 under 5‐FU and oxaliplatin (A) in p53 wild‐type and DYRK2^high expressing CRC, and (B) in p53 wild‐type and DYRK2^low expressing CRC.

Almost 40% of advanced CRC cases that are indicated for adjuvant chemotherapy have been reported to have p53 wild‐type. ³⁰ A recent study showed that DYRK2‐dependent regulation of F‐box and WD repeat domain‐containing 7 protein accumulation contributes to cytotoxic effects in response to chemotherapy such as doxorubicin or paclitaxel in the HCT116 (p53 wild‐type) cell line. ³¹ Conversely, p53 mutations are associated with poor prognosis and chemoresistance in CRC. ³² Another study showed that DYRK2 overexpression reduced proliferative, migratory, and invasive activities and induced apoptotic death in the LoVo (p53 mutation) 5‐FU resistant CRC cell line. ¹⁹ Although we found no difference in the viability under 5‐FU and oxaliplatin between parental and DYRK2‐KO p53‐mutated CRC cells, DYRK2 may be associated with poor chemosensitivity and prognosis in patients with p53‐mutated CRC undergoing chemotherapy due to mechanism that is different from our findings.

Thus far, we have reported various functional aspects of DYRK2 as a tumor suppressor. ¹⁴ , ¹⁵ Recently, we have reported that overexpression of DYRK2 by Advs inhibits growth and induces apoptosis in CRC and hepatocellular carcinoma using in vitro and in vivo experiments. ¹⁸ , ²² In addition, our study has demonstrated the potential of a new treatment using DYRK2‐targeted Advs for unresectable metastatic CRC. ¹⁸ Advs are widely used in human gene therapy because of their efficiency and ability to induce p53‐dependent apoptosis. ³³ , ³⁴ , ³⁵ In the present study, the combination of Ad‐DYRK2‐WT overexpression by Advs and low‐dose chemotherapy (5‐FU and oxaliplatin) had synergistic antitumor effects inducing p53‐Ser46 phosphorylation and apoptosis in vitro. This evidence supports the idea that the combination therapy of gene therapy using DYRK2 function and chemotherapy may have strong antitumor effects in several cancers including CRC. Furthermore, this novel therapy may reduce the required anticancer drug concentrations, resulting in the reduction of adverse effects such as myelosuppression and peripheral neuropathy.

In the last decade, preoperative chemoradiotherapy and total neoadjuvant chemotherapy have been administered as 5‐FU‐ and oxaliplatin‐based treatments that can trigger DNA damage and induce apoptosis in CRC. ³⁶ , ³⁷ , ³⁸ , ³⁹ These are organ‐preserving strategies due to tumor shrinkage and provide a watch‐and‐wait option as a new strategy for rectal cancer. ⁴⁰ , ⁴¹ In a meta‐analysis, p53 wild‐type rectal cancers are known to be more sensitive to these treatments. ³² Therefore, DYRK2 may contribute to increased response rates and may be a key marker for these new treatments and potential therapeutic applications in the future. ¹⁸

In conclusion, we showed that DYRK2 expression was associated with chemosensitivity to 5‐FU and oxaliplatin in p53 wild‐type CRC cells. Routine preoperative measurements of the p53 status and DYRK2 expression may be useful for predicting patient sensitivity and in the selection of new therapeutic strategies for patients undergoing chemotherapy for CRC.

AUTHOR CONTRIBUTIONS

YT and KY developed the main concept and designed the study. YT, SY, YI, HK, YK, KE, and KY were responsible for the acquisition of data. YT and SY performed the data analysis and interpretation. YT, SY, and KY drafted the manuscript. KY contributed to the editing and critical revision of important intellectual content.

FUNDING INFORMATION

This work was supported by grants from the Japan Society for the Promotion of Science KAKENHI Grants 22 K06918 (to SY), JP17H03584, JP18K19484, and JP20H03519 (to KY), the Jikei Universtiy Research Fund (to YI), and the Jikei University Graduate Research Fund (to YT).

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflict of interest.

ETHICS STATEMENT

The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki.

Approval of the research protocol by an Institutional Reviewer Board: N/A.

Informed Consent: N/A.

Registry and the Registration No. of the study/trial: N/A.

Animal Studies: All animal experiments were approved by the Animal Welfare Committee of the Jikei University School of Medicine (ethics approval license: 2021‐038).

Supporting information

Figure S1.

Takano Y, Yogosawa S, Imaizumi Y, et al. DYRK2 promotes chemosensitivity via p53‐mediated apoptosis after DNA damage in colorectal cancer. Cancer Sci. 2023;114:4558‐4570. doi: 10.1111/cas.15973

DATA AVAILABILITY STATEMENT

The unprocessed source data and the statistical source data that support the findings of this study are available, and correspondence and requests for materials should be addressed to kyoshida@jikei.ac.jp.