Skip to main content
Nature Communications logoLink to Nature Communications
. 2023 Dec 18;14:8422. doi: 10.1038/s41467-023-44254-3

Extending the toolbox for RNA biology with SegModTeX: a polymerase-driven method for site-specific and segmental labeling of RNA

Raphael Haslecker 1, Vincent V Pham 1, David Glänzer 2, Christoph Kreutz 2, Theodore Kwaku Dayie 3, Victoria M D’Souza 1,
PMCID: PMC10728113  PMID: 38110450

Abstract

RNA performs a wide range of functions regulated by its structure, dynamics, and often post-transcriptional modifications. While NMR is the leading method for understanding RNA structure and dynamics, it is currently limited by the inability to reduce spectral crowding by efficient segmental labeling. Furthermore, because of the challenging nature of RNA chemistry, the tools being developed to introduce site-specific modifications are increasingly complex and laborious. Here we use a previously designed Tgo DNA polymerase mutant to present SegModTeX — a versatile, one-pot, copy-and-paste approach to address these challenges. By precise, stepwise construction of a diverse set of RNA molecules, we demonstrate the technique to be superior to RNA polymerase driven and ligation methods owing to its substantially high yield, fidelity, and selectivity. We also show the technique to be useful for incorporating some fluorescent- and a wide range of other probes, which significantly extends the toolbox of RNA biology in general.

Subject terms: RNA, Structure determination


It has been challenging to make long RNAs with site-specific modifications for NMR study. Here the authors present SegModTeX: a method for site-specific and segmental labeling of RNAs independent of their sequence or segment length, with applications for biological- and artificial NTP analogues at purity and scale sufficient for NMR.

Introduction

RNA is positioned at a critical cross-section of biology: it not only disseminates genetic information, but also folds into structures to mediate many biological functions. This is due to its capacity to form numerous basepair types beyond the canonical Watson-Crick pairs, often providing the ability to sample multiple conformations that are critical to drive function13. Additionally, more and more nucleotide modifications at predefined sites are known to further expand the structural, mechanistic, and functional repertoire of RNA4. It is therefore important to understand RNA structures in their various conformations and in the correct chemical context to gain complete insights into its function and the biology it governs.

However, current RNA structural characterization methods suffer from three major drawbacks. The first is specific to NMR. While NMR provides structural data across the full folding landscape of a molecule, it fails for large RNAs due to signal overlap and broad linewidths. Second, with current methods, we cannot easily construct functionally relevant chemical states of RNAs; for example, with existing enzymatic approaches, we cannot add at specific sites N6-methyl-adenosine (m6A), 5-methyl-cytosine (m5C), pseudouridine (Ψ), etc. Third, many biochemical techniques, such as FRET, have limited options on where the probe can be placed and hence are mostly confined to the termini, thus restricting complete characterization of the molecule5.

One way to overcome both the size limitations of NMR and site-specific incorporation of modified nucleotides is to construct RNA segments sequentially, each of which can be manipulated for selective incorporation of isotopes (termed segmental labeling) and/or modified rNTPs and analogues6. There are three methods currently in use for segmental and site-specific labeling. First, one can synthetize individual RNA fragments and then ligate with T4 DNA or RNA ligase — Puglisi and coworkers used this approach to probe a 100 kDa HCV IRES RNA by solution NMR7,8. Others, by extension, have added single isotopically labeled and modified bases at specific ligation sites using chemical or T7 RNA polymerase synthesis9,10. However, ligation itself has many shortcomings that severely limit its use including low yields in individual ligation and preparatory steps, sequence constraints at and around the ligation site, and minimum segment lengths7. Second, position-selective labeling of RNA (PLOR) uses T7 polymerase to extend RNA stepwise by using different unlabeled, labeled, or modified rNTP pools in individual steps11. T7 polymerase starts transcription de novo and cannot reengage with an RNA:DNA duplex. PLOR tries to circumvent this by keeping the RNA polymerase engaged with the duplex while the rNTP pools are washed on and off12,13. However, due to its technical complexity, use of saturating amounts of labeled rNTP pools per wash/step, and limited yield, few researchers have used this method so far.

Finally, a third approach involves chemical RNA synthesis using phosphoramidite nucleotide analogues. This method easily allows for selective incorporation of modified or isotopically labeled nucleotides14. However, chemical synthesis has a length constraint of ~70-nt for NMR spectroscopy. This limitation is imposed by the current stepwise coupling efficiency of ~98% in each step, which leads to overall low yields further diminished by side products during the deprotection steps15,16. Furthermore, many phosphoramidite versions of modified rNTPs are not commercially available and thus off limits to most labs17. Together, these methods have found limited application in overcoming the size and crowding limitations of NMR as only ~2% of deposited NMR structures in the RCSB database are greater than 70 nucleotides (as of April 2023) with the largest being 155-nt8. Out of these, almost half required the use of segmental labeling via ligation to unambiguously assign resonances. Additionally, all deposited structures that incorporate site-specific RNA modifications either used short, chemically synthesized RNAs or RNAs extracted from biological material, both of which severely limit the type and composition of RNAs that can be studied.

While segmental incorporation of nucleotides in RNA is problematic, this is not the case for DNA. With primer extension, labeled or modified dNTP pools are easily incorporated into newly synthesized DNA. This is because DNA polymerases engage an existing primer template duplex and extend from the 3’-end of the primer, allowing the newly synthesized segment to be different from the primer depending on the dNTP mix provided18. On the other hand, virtually all RNA polymerases initiate transcription de novo and are not thermostable, making segmental additions or melting steps impossible. Nevertheless, Cozens et al. reported a mutant DNA polymerase (TGK) from Thermophilus gorgonarius (Tgo) with a unique capability to not only efficiently incorporate rNTPs, but importantly, also extend an RNA primer that is annealed to a DNA template19. Building on that work, we characterized and optimized the enzyme’s fidelity, accuracy, versatility, and yield for extending RNA primers/segments. Here we present a method for ‘Segmental labeling and site-specific Modifications by Template-directed eXtension’ (SegModTeX, Fig. 1). We mainly use NMR as proof-of-principle, both to advance the field and due to its ease of detecting modifications and assessing sample quality. Furthermore, we describe a range of NTP analogues that are accepted by the polymerase, thus greatly expanding the toolbox for RNA biology.

Fig. 1. Schematic of the SegModTeX protocol.

Fig. 1

The RNA segment 1 (red) is annealed to the reverse complementary template 1 (grey) encoding the second segment and a region complementary to the 3’-end of segment 1 (~20nt). Upon extension of segments 2 (yellow and green) using a pool containing the desired modified (left) or isotopically labeled (right) rNTPs, the template is removed and the extended RNA of segment 1 + 2 can undergo another round of extension (segment 3, blue). If the final product requires a non-G start, annealing a DNA primer to a template can undergo SegModTex to generate segment 1 (upper dotted box).

Results

Extending and modifying RNAs with high efficiency and fidelity by SegModTeX

For high quality and easy purification of TGK polymerase, we used an N-terminal GST-tag followed by a PreScission protease cleavage site upstream of the polymerase sequence. We obtained yields of 25 mg of protein per liter of Escherichia coli culture, which is comparable to that obtained for T7 polymerase20 (Supplementary Fig. 1a).

We tested the purified TGK polymerase for properties that would make it conducive for segmental extension and labeling. First, we confirmed the enzyme’s gain-of-function for incorporating rNTPs by extending a diverse set of RNA segments of varying lengths on DNA templates also of varying lengths. Segment 1 (seg1) of the various lengths and compositions were either made by T7 polymerase or by chemical synthesis, including HBV-epsilon (HBV-ε) (25seg1), tRNAlys3 (20seg1), and 7SK snRNA (41seg1). Each seg1 was annealed to a ssDNA template with a complementary 3’-end (~20-nt, Tm: ~65 °C) and the sequence of seg2 encoded at the 5’-end. TGK was then used to extend the various seg1 to produce seg1–seg2: HBV-ε (+1 to 26seg1–seg2), tRNAlys3 (+12 to 32seg1–seg2), and 7SK snRNA (+29 to 70seg1–seg2).

We rigorously tested all relevant parameters, including concentrations of templates, segments, rNTPs, enzyme, and divalent ions and additionally optimized buffer, pH, annealing conditions, temperature, and time for extension. Unlike T7 polymerase, all SegModTeX reactions were robust and went to completion under the same optimized reaction conditions of 0.1 mM template:seg1, 1.5 mM rNTPs, 0.1 mg/ml TGK, 15 mM MgSO4, 1 x ThermoPol buffer (pH: 7.1), at 65 °C (short seg1) or 72 °C for <90 min. Under these conditions, we find the turnover of the various seg1 to seg1–seg2 approaches 100% as evidenced by the complete absence of seg1 in the enzymatically extended lanes and quantification of reaction yields (Fig. 2a and Supplementary Table 1). Overall, we find SegModTeX to be robust across a wide range of temperatures, incubation times, and pH values. First, SegModTeX extends even at room temperature; however, the minimum required temperature for complete extension is 55 °C, presumably due to barriers to melting secondary structures in the template. The upper bound is dependent on the annealing temperature of template:seg1 (Supplementary Fig. 1b). Second, while RNA can undergo hydrolysis at high temperatures, especially in the presence of Mg2+, we only observed degradation for incubation times that far exceeded the optimum range (Supplementary Fig. 1c). Finally, there is no observable difference in activity between pH 5-7 and only a 20% decrease at pH 8, after which, as expected, there is a dramatic loss in yield (Supplementary Fig. 1d).

Fig. 2. Yield, fidelity, and NMR sample quality of SegModTeX.

Fig. 2

a HBV-ε seg1 (25-nt, left), tRNAlys3 seg1 (20-nt, center), and 7SK-SL1apical seg1 (41-nt, right) RNAs are fully extended by 1, 12, and 29 nucleotides, respectively. Loaded reaction equivalents with respect to Seg1 input are denoted due to higher dilution volumes being required for DNase treatment b Accurate incremental extensions of HBV-ε seg1 (25-nt, lane 1) from various NTP mix combinations (lanes 2 to 5). Predicted extensions occur exactly as delimited by complementary rNTPs, indicating a low promiscuity of the polymerase. c Lack of HBV-ε seg1 (25-nt, lane 1) extension with mismatched 3’-end base pairs (C:dC, U:dC, A:dC, lanes 3-5, respectively) indicates high fidelity. Additionally, a 26-nt HBV-ε seg1 with a G:dT mismatch extends inefficiently (lane 2), demonstrating a strong preference for canonical Watson-Crick base pairing. d 2D-NOESY overlays of 7SK-SL1apical (56-nt) constructed by T7 polymerase (black) and by SegModTeX extension of a 28-nt seg1 (red). Source data are provided as a Source Data file.

Next, as TGK can use an expanded range of rNTP analogues as substrates, we tested if misincorporation of complementary bases occurs, which could lead to increased heterogeneity of the RNA constructs and render the method inadequate for segmental labeling. Therefore, we extended HBV-ε seg1 (25seg1) using different combinations of rNTPs (A, AC, ACU, and ACUG) and checked if the enzyme stalls at the predicted site (+1, +3, +5, +10, respectively), or if the polymerase extends beyond that by using the wrong rNTPs. Remarkably, SegModTeX reactions proceed only up to the length expected and have a hard-stop when the complementary NTP is missing, highlighting its high fidelity, a feature that is a prerequisite for segmental labeling (Fig. 2b).

Furthermore, for segmental labeling, it is essential that accurate segment ends are used. In fact, in canonical ligation methods, terminal ribozymes are added to the desired sequence because T7 polymerase has a propensity to add non-templated bases at the end2123. This is of special concern with long RNA segments where purification at single-nucleotide resolution is not feasible. Thus, we tested whether TGK retains its DNA polymerase property to discriminate and not use mismatched base pairs as substrates, which would allow for production of only accurate segment junctions24. We extended HBV-ε seg1 (25seg1) with different versions of mismatched 3’-end base pairs (G:dT, C:dC, U:dC, A:dC) and performed extension assays. Mismatched segments are not extended (Fig. 2c); in fact, even the G:dT pair, which has been shown to be efficiently extended by Taq polymerase shows almost no detectable extension24.

Finally, to confirm the high yield and fidelity of SegModTeX, we compared NMR spectra of a 56-nt 7SK-SL1apical RNA made by T7 polymerase to that made by TGK (28-ntseg1 to 56-ntseg1–seg2)25. 7SK-SL1apical is especially enriched with bulges and non-Watson base pairs which are readily discernable by NMR. Our comparative analysis (Fig. 2d) shows that the sample made by segmental labeling is indistinguishable from that made by T7, emphasizing the high fidelity and accuracy of SegModTeX.

SegModTeX allows for rapid NMR assignments of large multidomain RNAs

Since current segmental labeling techniques are inefficient and laborious, RNA assignments by NMR largely rely on atom- or nucleotide-specific labeling. Atom-specific labeling strategies only allow for assignments of up to 70-nt with ease. Furthermore, deuteration, wherein proton positions are substituted for deuterons, leads to loss of structural information at those sites, which is especially critical for solving the structures of loops and bulges. Nucleotide-specific labeling strategies have been used to investigate RNAs over 100-nt but are a resource- and time-consuming process. It requires the parallel assignments from numerous nucleotide specifically labeled samples; for example, assignments of the MLV-Ψ packaging signal (SL-BCD) required four specifically deuterated samples, four 15N/13C labeled samples, each of which required 3D and 4D datasets26. For comparative analysis, we used SegModTeX to make the three-domain SL-BCD construct wherein the B domain (seg1, 35-nt) was left protonated while domains C and D were extended using deuterated rNTPs, rendering these domains invisible to NMR (seg1–seg2, 101-nt) (Fig. 3). Thus, use of such segmental labeling would only require three domain-specific protonated samples, each of which can be used to fully assign the respective domain, thereby significantly reducing the time required to solve the structure. Furthermore, this strategy can be combined with atom-specific deuteration at ribose moieties to significantly reduce the overlap, and further aid in assignments of full domains within large RNAs27.

Fig. 3. Labeling large RNA segments for crowded spectra (MLV).

Fig. 3

a Schematic of the segmental labeling of MLV-BCD. Seg1 (red) is fully protonated, whereas seg2 (grey) is fully deuterated. b Extension of seg1 (lane 1) to seg1- 2 (lane 2). The loaded reaction equivalent with respect to Seg1 input are denoted due to higher dilution volumes being required for DNase treatment. c 2D-NOESY overlay of segmentally deuterated MLV-BCD RNA (red) and fully protonated MLV-BCD (black). The vastly simplified spectra allows for easy peak assignments in the context of the full RNA. Source data are provided as a Source Data file.

SegModTeX allows for multiple extensions without segment length or sequence constraints

Assignments of domains in the middle of RNAs, for example domain C in the SL-BCD above would traditionally require two or more steps of differentially labeled segments. Thus, we tested if multiple segments of RNA can be efficiently added using SegModTeX. For this we used two variations of segment designs to produce a 324-nt 7SK snRNA. In the first, we designed a multi-step extension protocol to only visualize guanosines and adenosines from residues 181 to 253, while completely deuterating the segments on either end (7SK snRNA180/253) (Fig. 4a). In the second, we wanted to visualize only the five adenosines present in regions between 149 and 178, while completely deuterating all other bases (7SK snRNA148/178) (Fig. 4b). After extending seg1 to seg1–seg2 and subsequent DNase digestion, we repeated SegModTeX using new ssDNA templates to add seg3. Comparison with a G and A protonated, full-length 7SK snRNA made by T7 polymerase shows the individually identifiable proton shifts of the specified nucleotides in both samples; for example, five expected adenosines are visible in 7SK snRNA148/178 that align reasonably well with the resonances of the control sample. Such drastic reduction of spectral complexity should easily allow for structural characterizations of specific domains and/or nucleotides in large RNAs (Fig. 4a, b).

Fig. 4. Multi-segment labeling of large 7SK snRNAs.

Fig. 4

Left: Schematics of segmental labeling of 7SK snRNA. Seg1 and 3 (black) are fully deuterated in both. In a only C and U are fully deuterated, while all G and A are protonated in seg2 (orange), whereas in b, seg2 (red) has G, C, and U fully deuterated and only five A’s protonated. Center: Stepwise extensions of RNA segments 1 to 3 [lanes 1-3 in (a) and 2–4 in (b)]. Loaded reaction equivalents with respect to Seg1 input are denoted. Right: Overlay of 2D-NOESY spectra of a T7-transcribed G and A protonated sample (blue) and segmentally labeled samples [orange for (a) and red for (b)]. c Comparative RT-seq of 7SK snRNA NMR samples made by canonical T7 and the SegModTex schema in (a) match at the junction of seg2 and seg3. d Comparative RT-seq of the SegModTex 7SK snRNA NMR samples using chemically synthesized ssDNA template (left) and asymmetric PCR derived template (right) show degenerate ends and correct ends, respectively. The dashed portion of the plots are scaled down to fit the displayed area. Source data are provided as a Source Data file.

To confirm that non-complementary base pairs are not extended (see Fig. 2c), we allowed for incomplete extensions of seq1–seg2 during the extension of 7SK snRNA180/253 (Fig. 4a). While shorter fragments would naturally lack complementarity to the next template and thus be excluded from further extensions, mismatched fragments that still anneal to the template would cause inaccurate junctions. Sequencing of 7SK snRNA180/253 shows that the junction made in the 7SK snRNA180/253 sample is comparable to that region made by non-segmented T7 polymerase transcription, confirming the above observation that SegModTeX does not extend inaccurate or mismatched ends (Fig. 4c). On the other hand, we find that the 3’-ends of the 7SK snRNA180/253 seg3 has significant heterogeneity. Given the high fidelity of the enzyme, we reasoned this heterogeneity arose from varying template sizes produced by chemical DNA synthesis. To circumvent this heterogeneity problem, we tested the use of asymmetric PCR to construct a homogenous ssDNA template. We synthesized the whole 324-nt 7SK snRNA template sequence, which was used for the 7SK snRNA148/178 synthesis above28. As expected, sequencing results showed that the 3’ end was accurately extended, highlighting the ability of SegModTeX to construct RNA segments of any length, with the heterogeneity arising from the input templates of varying lengths.

As for the specification of 5’ ends, one current limitation when making any RNA construct, or in this case, preparation of seg1, is that T7 polymerase only initiates transcription from at least one guanosine with T7 class III promoter or, with lower efficiency, adenosine with a class II ϕ2.5 promoter29,30. Since SegModTeX extension of RNA is a novel function of a mutant DNA polymerase, we surmised it could also add RNA onto DNA segments without sequence constraints. Hence, we tested the extension of a short DNA segment annealed onto a longer ssDNA template encoding HBV-ε. The RNA sample obtained after DNase digestion is identical to that made by T7 polymerase (Fig. 5a). Therefore, SegModTeX can be used to synthesize the first RNA segment as well, making its design independent of any sequence constraints.

Fig. 5. Multi-segment extension with SegModTeX.

Fig. 5

a Left: DNA-primed RNA synthesis via SegModTex. DNA seg1 (25-nt, lane 1) is extended with U, G (red), A, and C starts (lanes 4, 6, 10, 12, respectively). Upon DNase digestion, 32-nt RNA products remain (lanes 3, 5, 9, 11, respectively). Right: Overlay of 2D-NOESY spectra of DNA-primed SegModTeX-derived (red) and T7-derived (black) HBV-εstem 1, b Left: Schematic and PAGE of HBV-ε seg1 (lane 1) extension by a single m6A segment (lane 2) followed by a 9-nt segment (lane 3). Loaded reaction equivalents with respect to Seg1 input are denoted. Right: Overlay of 2D-NOESY spectra of a SegModTex-derived m6A-modified (orange) with an unmodified T7-transcribed sample (black). The asterisk denotes the cross-peak of the N6-methyl protons and the H8 proton of residue G25 c Left: Schematic and PAGE of tRNAlys3 seg1 (lane 1) extended by a 12-nt seg2 containing Ψ at position 27 (lane 2) followed by a 44-nt seg3 (lane 4) using SegModTeX. Loaded reaction equivalents with respect to Seg1 input are denoted. Right: Overlay of 2D-NOESY spectra of the Ψ-modified tRNAlys3 (red) and T7-transcribed fully protonated tRNAlys3 (blue). The asterisk denotes the H5 proton of U27 in the non-modified tRNAlys3, which is absent in the Ψ-modified tRNAlys3. d Left: Similar to (b) but extended by a single 2-19F-A segment (lane 1) and then the 9-nt segment (lane 3) Right: 1D-NMR spectra shows the incorporation of the 2-19F-A into only one position in HBV-ε RNA. The corresponding full spectrum showing a larger 20 ppm chemical shift region is overlaid with spectrum with a smaller 5 ppm chemical shift region to highlight the fact that only one 2-19F atom is incorporated. Source data are provided as a Source Data file.

Site-specific incorporation of modified NTPs by SegModTeX

Many RNAs are modified in cells to control function. The most prevalent modifications are N6-methyladenosine (m6A), N1-methyladenosine (m1A), inosine (I), 2’-O-methylation (2’-OMe), 5-hydroxymethylcytosine (hm5C), 5-methylcytosine (m5C), and pseudouridine (Ψ)31. Cozen et al. showed that the latter two could substitute for Cs and Us19. Given that SegModTeX can be used for multi-segment extension, we wanted to test if we can site-specifically introduce these and other biologically relevant modifications.

We first tested incorporation of Ψ at position 27 in tRNAlys3 and m6A at position 26 (HBV-genome: 1907) in the distal HBV-ε stem-loop32,33. Both Ψ and m6A are widely used modifications and occur naturally in these constructs. In the first step, we used the same template:seg1 setup as before (Fig. 2), except that the single base extension in HBV-ε was carried out in the presence of m6ATP and then extended to completion in the second step (Fig. 5b). Similarly, a 12-nt seg2 extension for tRNAlys3 was carried out in the presence of ΨTP, where U is specified only once in the sequence. A subsequent extension with regular rNTPs was used to complete the tRNAlys3 to 76-nt (Fig. 5c). NMR assignments confirmed incorporation of the m6A at the correct position 26 in HBV-ε through the presence of an upfield shifted resonance (~ 2.8 ppm)3, which is absent in the sample made by T7 polymerase without an m6A modification (Fig. 5b). Similarly, NMR assignments of tRNAlys3, confirmed the incorporation of Ψ at position 27 by the expected disappearance of the H5 resonance of U27, which is seen in the samples made by T7 polymerase (Fig. 5c). In both cases, no other resonance of m6A or Ψ were observed and the spectra showed that the RNAs folded similar to their unmodified counterparts, indicating that the incorporation occurs accurately and only at the specified site. Finally, to further advance the NMR field, we introduced 2-19F-ATP in the HBV-ε construct at the same nucleotide position as m6A described above. As seen in Fig. 5d, the 1D spectra confirms the incorporation of a single 2-19F-Adenine in the RNA. We also show that 2-19F-2-13C-ATP can be incorporated in large RNAs, which are of special interest to NMR spectroscopists, for example in 7SK snRNA148/178 (Supplementary Fig. 1f).

We also tested other biologically relevant base modified NTPs including inosine, 5-methyl-C, and 2-thio-U. To test these, we made various HBV-ε templates that encoded each modified base only at a single specified site (position 29 of 35 for modified UTPs and position 28 of 32 for all other modified NTPs). Extension stalls at expected lengths in the absence of the specified NTPs but goes to completion with modified NTPs: The HBV-ε (25seg1) extends by 7 nucleotides (for CTP-, GTP-, and ATP-analogues (Fig. 6a, c)) or 10 nucleotides (for UTP-analogues, Fig. 6b).

Fig. 6. Site-specific incorporation of modified NTPs by SegModTeX.

Fig. 6

Extensions of 25-nt HBV-ε seg1 using a set of three regular rNTPs and a fourth modified NTP. Schematic (left) and PAGE (right) are shown of ATP/GTP a UTP b and CTP c analogues. Biologically relevant NTP analogues (green lanes) are incorporated and fully extended. Orange lanes indicate analogues that are incorporated but are then stalled. Blue lanes show fluorescent analogues that either are incorporated but stall or fully extend by eliminating the probe moiety. d Visible light and UV imaging of fluorescent analogue extensions. Fluorescein-12 (lane 2) is incorporated and fully extended, whereas Alexa-Fluor-647-ATP, Alexa Fluor-555-aha, and MANT-GTP (lanes 3–5, respectively) lead to two products. One fraction stalls (arrows) and exhibits color in visible light (middle) and UV (bottom), while the other fraction fully extends but shows no evidence of incorporation in light and UV readings. The Alexa-Fluor-647-ATP’s stalled band is too faint for detection (visible). e 2D-NOESY spectra of HBV-ε seg1 (25-nt) shows successful incorporation of 2’O-methyl UTP before stalling. Source data are provided as a Source Data file.

Since SegModTeX readily incorporated these base modified NTPs, we wanted to test if bulkier functionalized NTP analogues that can be used for various biochemical techniques would also be incorporated. Thus, we tested: (i) Alexa-Fluor-555-aha-dCTP and Fluorescein-12-dUTP for fluorescence labeling; (ii) 5-Aminoallyl-CTP, 5-Aminoallyl-UTP, and 5-Ethynyl-UTP for crosslinking; (iii) biotin-16-UTP for affinity biology; (iv) 5-Bromo-UTP, 5-Iodo-UTP, and 5-Iodo-CTP for halogeno labeling. As seen in Fig. 6a–c, all the base modified NTPs, with the exception of Alexa-Fluor-555-aha-dCTP, are incorporated and fully extended. Alexa-Fluor-555-aha-dCTP is also incorporated but leads to termination without further extension (Fig. 6d). Given that Fluorescein-12 UTP and Alexa-Fluor-555-aha-dCTP are similar in size, it is unclear what leads to this phenomenon with one possibility being the difference in linker length between the base and the fluorophore.

Next, we wanted to test if modifications on the sugar moieties would be incorporated. We tested both biologically relevant 2’-O-methyl-NTPs, as well as dNTPs, ddNTPs, and 2’ (or 3’) linked-Alexa Fluor™ 647 ATP, -BODIPY FL ATP, and -MANT-GTP. As expected, dNTPs are fully extended while ddNTPs cause chain termination at the specified site after incorporation. Surprisingly, even a small moiety like a methyl at the 2’ position is not conducive for extension (Fig. 6a–c); however, the NMR data shows that termination occurs only after incorporation of the 2’-O-methyl (Fig. 6e). Accordingly, two bands of varying intensities are observed for reactions containing a mix of fluorophores that are linked to either the 2’ or 3’ positions: one stalled due to the incorporation of the 2’-modified NTP, and one fully extended, but without the fluorophore present, presumably due to its expulsion during polymerization and formation of the 3’ phosphodiester linkage (Fig. 6d). Overall, these results show that SegModTeX is not conducive for labeling of the 2’ position of RNAs at internal sites but can be used successfully for labeling the last residue of RNA constructs.

Discussion

RNA biology is a rapidly advancing field; however, the construction of RNA samples with native modifications remains challenging. Furthermore, NMR, one of the main methods for structural analysis accounting for 35% of deposited RNA structures17, is severely limited due to the complexity of assigning spectra without the ability to isotopically label individual segments. Finally, biochemical methods such as FRET, RNA-crosslinking, etc., are confined to end-labeling or cumbersome ligation techniques to achieve site-specific incorporation. In this paper we showcase the use of a mutant Tgo DNA polymerase for ‘Segmental labeling and site-specific Modifications by Template-directed eXtension’ (SegModTeX) — a one-stop protocol to address all these limitations.

First, unlike ligations, the extension reaction goes to completion, which addresses the biggest hurdle of segmental labeling. Thus, insofar as the product is recovered efficiently, the yield can approach 100%. Even the stringent method of gel electrophoresis followed by electro-elution produces yields of around 80% of the input. This in principle allows for multiple rounds of extensions. Second, although the enzyme has been mutated to accommodate rNTPs, it has not resulted in a loss of complementary base recognition, maintaining the high fidelity of DNA polymerases. This directly benefits junction homogeneity because mismatched 3’-ends are consequently selected against for extension; therefore, the end product only contains the desired sequences. Similarly, unlike RNA polymerases, no RNA self-templating occurs34, leading to homogeneous 3’-ends to the extent that the ssDNA template is accurate. In fact, use of asymmetric PCR to make high quality ssDNA template renders the process independent of any sequence length constraints that arise from restrictions of chemical synthesis.

Third, since all extensions require the same optimized conditions, no further optimization for reaction conditions or special sequence considerations are required. Moreover, compared to even a single-step ligation protocol, which involves separate preparation of the two segments that are appropriately protected or primed for ligation followed by splinting and addition of ligase, SegModTeX allows for a one-step reaction to achieve segment joining. Fourth, compared to T7 polymerase-driven RNA production, this method has a few additional advantages, in that no base-type restrictions exist for the initiating nucleotide and the use of high temperature can resolve any potential terminators in the RNA. On the other hand, the high temperatures used in SegModTeX may preclude studies of RNA that require co-transcriptional folding. Furthermore, the retention of DNA-primed extension by the enzyme allows seg1 to have no minimum length requirement because the RNA segment alone does not have to be long enough to anneal. Finally, the salient feature of SegModTeX is the ability to use multi-step extensions to site-specifically incorporate a plethora of modified NTPs at any desired position(s) without sequence constraints around the modified site(s). For example, one could specifically modify or label any cytosine, even if it is flanked by other cytosines, via single nucleotide extensions.

This versatility and ease of SegModTeX has the potential to transform RNA structural biology. First, this technique can be used to build more sophisticated tools for existing methods. For example, currently RNA FRET is mostly limited to labels at the two ends, whereas SegModTeX permits easy incorporation of fluorescent labels at least Fluorescein-12 at any position on an RNA, thus granting access to the whole molecule. Second, we see similar potential for selective halogeno-labeling for x-ray crystallography, crosslinking, or affinity tags. Finally, SegModTeX has the potential to transform structure determination by NMR. For instance, structures of smaller domains can be solved within its larger context due to the drastic reduction of spectral crowding. This, along with the current progress in assignment prediction software can allow for a rapid workflow for characterizing large RNAs currently outside the scope of solution NMR35. Thus, we anticipate that this technology (together with others) will enable NMR spectroscopy to play a central role in illuminating the structure, dynamics, and function RNAs in vitro and in cells.

Methods

TGK polymerase

The plasmid for TGK-polymerase expression was cloned to encode an N-terminal Glutathione-S-transferase, a PreScission protease cleavage site, and the polymerase insert between the BamHI and NotI restriction sites of a pGEX-6P-3 vector. Plasmid DNA was transformed into One Shot™ BL21 Star™ cells and grown to 2 L from overnight cultures. Subsequent IPTG induction at ~O.D. 0.7 was followed by 3–4 h growth. Cells were concentrated by centrifugation, resuspended in 40 ml lysis buffer (25 mM Tris pH 7.5, 300 mM NaCl, 1 mM EDTA, 2 mM DTT), and sonicated on ice with six 1-min cycles at 60–70% duty and 5-6 output control, with 1 min cool down between each pulse. Lysate was incubated with washed Pierce™ Glutathione Agarose slurry from ThermoFisher (cat. #16101) in lysis buffer for 2 h at 4 °C. Subsequently, the beads were washed with 750 ml lysis buffer and cleaved overnight in 10 ml of elution/storage buffer (0.01 M Tris-HCl pH 7.6, 0.1 M KCl, 0.1 mM EDTA, 1 mM DTT, 0.1 % v/v Triton X-100, 5 % glycerol) with 60 µl aliquot of PreScission protease (13 mg/ml made inhouse). After elution from the column, TGK was stored at 4 °C for short-term or diluted with one volume glycerol at −20 °C for long-term. Typical yield is around 25 mg per liter of culture. The purity after elution is shown in Supplementary Fig. 1a.

DNA template design

The ssDNA templates contain a 3’end reverse complementary to the 3’ end of the RNA segment for their hybridization. The length should translate to a melting temperature (Tm) of ~65 °C, though lower melting temperatures are possible if the reaction is run at lower temperatures (see below). Longer hybridization regions do not affect SegModTeX. As the template is single-stranded, it is advised to avoid long self-complementarity at the 3’ends to avoid the template serving as primer for the TGK polymerase in an off-target reaction, however, as the reaction occurs at 72 °C, we have not encountered this problem in any tested construct thus far. Moreover, if self-templating is observed, non-extendable ssDNAs with di-deoxy or 3’-monophosphate ends can be used.

DNA template preparation

For SegModTeX templates shorter than 100-nt, ssDNA was ordered from Integrated DNA Technologies (IDT) and if necessary, purified on a 6% polyacrylamide 25% formamide sequencing gel. SegModTeX templates longer than 100-nt were prepared using asymmetric PCR as described in28, extracted via a 2-step ammonium acetate (2.5 M) and 70% ethanol precipitation, and subsequently washed and concentrated with H2O in Amicon® Ultra-15 Centrifugal Filter Units.

Similarly, for control samples made by T7 polymerase, shorter templates were ordered from IDT, with 2′-O-methylated 5’-ends36. For the longer 7SK snRNA samples, plasmids containing the T7 promoter, insert, and SmaI recognition sequence were cloned in between the EcoRI and BamHI restriction sites of a pUC19 vector. Plasmid DNA was prepared for PCR amplification from a 2 mL overnight culture of NEB 5α Competent Escherichia coli (C29871) transformed with the plasmid. Subsequently, the precise template sequences were amplified using primers ordered from IDT and EconoTaq® PLUS 2X Master Mix. PCR products were extracted via a 2-step ammonium acetate (2.5 M) and 70% ethanol precipitation.

RNA seg1 preparation

RNA seg1 for the various constructs were synthesized by in vitro transcription using T7 RNA polymerase. Chemically synthesized RNAs were also tested for constructs with RNA seg1 smaller than 26-nt (ordered from IDT). Resuspended RNA segments from in vitro transcription and ethanol precipitation or chemical synthesis were directly used for SegModTeX. For most reactions, the RNA was PAGE purified before every round of SegModTeX to avoid any carryover of rNTPs from previous reactions which SegModTeX might mistakenly incorporate into the new segment as well. However, we found that for smaller RNA constructs (<70-nt), ammonium acetate – ethanol precipitation successfully removes rNTPs from the previous step.

SegModTeX reaction conditions

Reaction mix

All SegModTeX reactions were conducted according to the following optimized protocol: 1 x ThermoPol buffer (NEB), 15 mM MgSO4, 1.5 mM rNTPs, 0.1 mM RNA seg:ssDNA template, and TGK polymerase to a final concentration of ~0.1 mg/ml were mixed at 4 °C. For large RNAs, SUPERase•In™ RNase Inhibitor was added according to the manufacturer’s specifications.

NTPs

The NTP mix contained the individual bases at concentrations according to their demand in the extension reaction. For rare or expensive NTPs, ratios as low as 15-fold excess per base incorporation were successfully tested. Higher concentrations of NTPs require special considerations for the DNase treatment step (see below).

Temperature

The reaction mixture was incubated at either 65 °C (for RNA segments with a calculated Tm of the template hybridization sequence of less than 63 °C) or else 72 °C. If experimental design requires very short RNA:DNA hybridization regions (<~15-nt), extension can be started at lower temperatures to allow for the addition of initial bases so as to increase the Tm, after which the temperature can be increased to allow for fast completion.

Time

The SegModTeX reactions were incubated for 20 min (extensions of fewer than 30-nt) to up to 90 min. Extended incubation time of up to 90 min can be beneficial for long extensions or highly structured segments but did not impact RNA integrity in our experiments. As TGK is a thermostable polymerase, heat-denaturation, either at the beginning or in between the incubation, akin to PCR cycles, was successfully tried and can be used for reaction optimization but was not required for any RNA sample shown. Moreover, we found that increasing the polymerase concentration was an easier and effective way to achieve extension completion.

DNA removal and RNA purification

Template DNA was digested with Turbo DNase according to the manufacturer protocol (37 °C, 15 min). It is important to note that incomplete DNA digestion has a detrimental impact on data quality due to the difficulty in separating it from the RNA in subsequent steps. Hence, for the digestion, special consideration should be given to the maximum allowed DNA concentration as specified in the Turbo DNase protocol as high template and NTP concentrations are inhibitory. This also limited the amount of SegModTeX product added in polyacrylamide gel wells due to volume constraints. In most cases, three-fold dilution of the reaction mix was necessary and sufficient to ensure complete digestion. To stop the reaction, EDTA was added equimolar to the Mg2+ concentration and denatured at 95 °C for 2 min.

For purification without PAGE, ½ volumes 7.5 M ammonium acetate were added, the samples vortexed for 10 s, placed on ice for 10 min, and centrifuged at 15,000 g for 20 min at 4 °C. This step is necessary to remove the enzymes in the sample, which might interfere with applications downstream. In a new tube, the supernatant and 4 volumes ethanol were added, mixed, and precipitated for 2 h at −80 °C. The centrifuged pellet was washed twice with 80% cold ethanol, dried at room temperature for 6 h, and resuspended in H2O. The sample was then ready for another round of SegModTeX.

For PAGE purification, the digestion reaction was precipitated using 0.3 M sodium acetate in 4 volumes ethanol at −80 °C and subsequently resuspended in RNA gel-loading buffer (50% formamide, 25 mM EDTA) and purified using urea-PAGE with 25% formamide. The choice of purification method depends on the subsequent use of the RNA. As the extension of RNA in SegModTeX is essentially 100%, size-based separation of the RNA product is not necessary in general. However, as the sample is in a mix of salts, proteins, NTPs, dNMPs and DNA oligos, precipitation or filter-based methods might be insufficient for highly sensitive applications, such as NMR.

Yield quantification

For yield quantifications by centrifugal filtration, the reactions were washed six times with 5 M Guanidinium•HCL, 1 M Tris pH 8.0 at 12.6 krpm for 10 min at room temperature. The concentrates were then diluted in water (1:50) and ODs were measured using a Nanodrop 2000 Spectrophotometer after blanking with a similarly diluted wash solution. For an approximate yield quantification of the long exposure and pH titration experiments (Supplementary Fig. 1c, d), NIH ImageJ 1.53 k was used to measure the intensity of the individual product size bands, normalized to lane 1, respectively.

NMR data acquisition and resonance assignment

RNA samples were suspended in the appropriate buffer (MLV: 5 mM Tris•HCl, 10 mM NaCl, pH: 7.0, 37 °C; 7SK snRNA: 5 mM Tris•HCl, pH: 7.0, 25 °C; 7SK-SL1apical: 10 mM potassium phosphate, 70 mM NaCl, and 0.1 mM EDTA, pH 5.2; HBV: D2O, pH: 7.0, 25 °C; tRNA: 10 mM Tris•HCl, 10 mM NaCl, 7 mM MgCl2, pH: 7.5 buffer, 37 °C). All NMR experiments were acquired in 5 mm Shigemi tubes with Bruker 700 and 800 MHz instruments containing cryogenic probes. Spectra for observing non-exchangeable protons were collected in 100% D2O and for exchangeable protons in 90% H2O/10% D2O. All 19F/1H spectra were collected at 298 K using a Bruker 600 MHz Avance III spectrometer equipped with BBFO (broad band with 19F observe and 1H decoupling) probes. Spectra were taken with carrier at −51.8 ppm. All data was analyzed using NMRDraw v11.1, NMRviewJ 8.0.3, and NMRFx Analyst v11.2.4-c.

Sequencing

The DNA oligo (5’TAATACGACTCACTATAGGGTCTCTTGTTCATGAGTCATGG3’) was 5’ phosphorylated with T4 PNK (NEB, #M0201S) and ligated onto the 3’ ends of PAGE purified SegModTeX and T7 constructed 7SK snRNA NMR samples with T4 RNA ligase 1 (NEB, #M0437M) according to the manufacturer’s protocols. Reverse transcription was performed with a short (25-nt) primer (5’TCCATGACTCATGAACAAGAGACCC3’) using GoScript™ Reverse Transcriptase (Promega A5003). PCR amplification of the RT product was done with EconoTaq® PLUS (LGC Biosearch Technologies #300331) with the RT primer and primers complementary to the 5’ start of 7SK snRNA. The agarose-gel purified PCR products were sent for Sanger sequencing.

Statistics and reproducibility

Representative gel images from Fig. 2a–c, Fig. 4a, b, to Fig. 5 b–d are from n = 3 replicates whereas images from Fig. 3b, Fig. 5a, to Fig. 6a–d from n = 2 replicates.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Peer Review File (408.5KB, pdf)
Reporting Summary (1.4MB, pdf)

Source data

Source data (4.3MB, zip)

Acknowledgements

This work was supported by HHMI grant 55108516 (to V.M.D.) and NIH grant U54 AI50470 (formerly U54 GM103297) and U54 AI170660 (both to V.M.D. and T.K.D.). We thank Samuel Carlson for providing PreScission protease.

Author contributions

R.H. conceived, designed, and optimized the experiments. R.H. and V.V.P. prepared the samples and performed the NMR experiments. R.H. performed the fidelity, NTP analogue, multi-step, and reviewer experiments. R.H. and V.M.D. analyzed and interpreted the data and wrote the manuscript. D.G. and C.K. synthesized and provided the 2-19F-2-13C-ATP and C.K., T.K.D., and V.V.P. edited the manuscript.

Peer review

Peer review information

Nature Communications thanks Jinwei Zhang, Hashim Al-Hashimi and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Data availability

All data presented in the manuscript are available from the corresponding author upon request. Source data and sequences for the DNA and RNA oligoes used are provided with this paper. Source data are provided with this paper.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

The online version contains supplementary material available at 10.1038/s41467-023-44254-3.

References

  • 1.Dayie TK, Olenginski LT, Taiwo KM. Isotope labels combined with solution NMR spectroscopy make visible the invisible conformations of small-to-large RNAs. Chem. Rev. 2022;122:9357–9394. doi: 10.1021/acs.chemrev.1c00845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Schnieders R, Keyhani S, Schwalbe H, Furtig B. More than proton detection-new avenues for NMR spectroscopy of RNA. Chemistry. 2020;26:102–113. doi: 10.1002/chem.201903355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu B, Shi H, Al-Hashimi HM. Developments in solution-state NMR yield broader and deeper views of the dynamic ensembles of nucleic acids. Curr. Opin. Struct. Biol. 2021;70:16–25. doi: 10.1016/j.sbi.2021.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Boccaletto P, et al. MODOMICS: a database of RNA modification pathways. 2021 update. Nucleic Acids Res. 2022;50:D231–D235. doi: 10.1093/nar/gkab1083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ahunbay E, Steffen FD, Zelger-Paulus S, Sigel RKO. Chemical dual end-labeling of large ribozymes. Methods Mol. Biol. 2022;2439:191–204. doi: 10.1007/978-1-0716-2047-2_13. [DOI] [PubMed] [Google Scholar]
  • 6.Lu K, Miyazaki Y, Summers MF. Isotope labeling strategies for NMR studies of RNA. J. Biomol. NMR. 2010;46:113–125. doi: 10.1007/s10858-009-9375-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kotar A, Foley HN, Baughman KM, Keane SC. Advanced approaches for elucidating structures of large RNAs using NMR spectroscopy and complementary methods. Methods. 2020;183:93–107. doi: 10.1016/j.ymeth.2020.01.009. [DOI] [PubMed] [Google Scholar]
  • 8.Kim I, Lukavsky PJ, Puglisi JD. NMR study of 100 kDa HCV IRES RNA using segmental isotope labeling. J. Am. Chem. Soc. 2002;124:9338–9339. doi: 10.1021/ja026647w. [DOI] [PubMed] [Google Scholar]
  • 9.Feyrer H, Gurdap CO, Marusic M, Schlagnitweit J, Petzold K. Enzymatic incorporation of an isotope-labeled adenine into RNA for the study of conformational dynamics by NMR. PLoS ONE. 2022;17:e0264662. doi: 10.1371/journal.pone.0264662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sudakov A, et al. Site-specific labeling of RNAs with modified and 19F-labelled nucleotides by chemo-enzymatic synthesis. Chemistry. 2023;29:e202203368. doi: 10.1002/chem.202203368. [DOI] [PubMed] [Google Scholar]
  • 11.Liu Y, et al. Synthesis and applications of RNAs with position-selective labelling and mosaic composition. Nature. 2015;522:368–372. doi: 10.1038/nature14352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stagno JR, Yu P, Dyba MA, Wang YX, Liu Y. Heavy-atom labeling of RNA by PLOR for de novo crystallographic phasing. PLoS ONE. 2019;14:e0215555. doi: 10.1371/journal.pone.0215555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhang X, Li M, Liu Y. Optimization and characterization of position-selective labelling of RNA (PLOR) for diverse RNA and DNA sequences. RNA Biol. 2020;17:1009–1017. doi: 10.1080/15476286.2020.1749797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Becette O, Olenginski LT, Dayie TK. Solid-phase chemical synthesis of stable isotope-labeled RNA to aid structure and dynamics studies by NMR spectroscopy. Molecules. 2019;24:3476. doi: 10.3390/molecules24193476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Shiba Y, et al. Chemical synthesis of a very long oligoribonucleotide with 2-cyanoethoxymethyl (CEM) as the 2’-O-protecting group: structural identification and biological activity of a synthetic 110mer precursor-microRNA candidate. Nucleic Acids Res. 2007;35:3287–3296. doi: 10.1093/nar/gkm202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kremser J, et al. Chemical synthesis and NMR spectroscopy of long stable isotope labelled RNA. Chem. Commun. 2017;53:12938–12941. doi: 10.1039/C7CC06747J. [DOI] [PubMed] [Google Scholar]
  • 17.Olenginski LT, Taiwo KM, LeBlanc RM, Dayie TK. Isotope-labeled RNA building blocks for NMR structure and dynamics studies. Molecules. 2021;26:5581. doi: 10.3390/molecules26185581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Eremeeva E, Herdewijn P. PCR amplification of base-modified DNA. Curr. Protoc. Chem. Biol. 2018;10:18–48. doi: 10.1002/cpch.33. [DOI] [PubMed] [Google Scholar]
  • 19.Cozens C, Pinheiro VB, Vaisman A, Woodgate R, Holliger P. A short adaptive path from DNA to RNA polymerases. Proc. Natl. Acad. Sci. USA. 2012;109:8067–8072. doi: 10.1073/pnas.1120964109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.He B, et al. Rapid mutagenesis and purification of phage RNA polymerases. Protein Expr. Purif. 1997;9:142–151. doi: 10.1006/prep.1996.0663. [DOI] [PubMed] [Google Scholar]
  • 21.Milligan JF, Groebe DR, Witherell GW, Uhlenbeck OC. Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Res. 1987;15:8783–8798. doi: 10.1093/nar/15.21.8783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Melton DA, et al. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 1984;12:7035–7056. doi: 10.1093/nar/12.18.7035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Szafraniec M, Blaszczyk L, Wrzesinski J, Ciesiolka J. Trans-acting antigenomic HDV ribozyme for production of in vitro transcripts with homogenous 3’ ends. Methods Mol. Biol. 2012;941:99–111. doi: 10.1007/978-1-62703-113-4_8. [DOI] [PubMed] [Google Scholar]
  • 24.Simsek M, Adnan H. Effect of single mismatches at 3’-end of primers on polymerase chain reaction. J. Sci. Res. Med. Sci. 2000;2:11–14. [PMC free article] [PubMed] [Google Scholar]
  • 25.Pham VV, et al. HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry. Nat. Commun. 2018;9:4266. doi: 10.1038/s41467-018-06591-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.D’Souza V, Dey A, Habib D, Summers MF. NMR structure of the 101-nucleotide core encapsidation signal of the Moloney murine leukemia virus. J. Mol. Biol. 2004;337:427–442. doi: 10.1016/j.jmb.2004.01.037. [DOI] [PubMed] [Google Scholar]
  • 27.Duss O, Lukavsky PJ, Allain FH. Isotope labeling and segmental labeling of larger RNAs for NMR structural studies. Adv. Exp. Med. Biol. 2012;992:121–144. doi: 10.1007/978-94-007-4954-2_7. [DOI] [PubMed] [Google Scholar]
  • 28.Tolnai Z, et al. A simple modification increases specificity and efficiency of asymmetric PCR. Anal. Chim. Acta. 2019;1047:225–230. doi: 10.1016/j.aca.2018.10.017. [DOI] [PubMed] [Google Scholar]
  • 29.Coleman TM, Wang G, Huang F. Superior 5’ homogeneity of RNA from ATP-initiated transcription under the T7 phi 2.5 promoter. Nucleic Acids Res. 2004;32:e14. doi: 10.1093/nar/gnh007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Brieba LG, Padilla R, Sousa R. Role of T7 RNA polymerase His784 in start site selection and initial transcription. Biochemistry. 2002;41:5144–5149. doi: 10.1021/bi016057v. [DOI] [PubMed] [Google Scholar]
  • 31.Shi H, Chai P, Jia R, Fan X. Novel insight into the regulatory roles of diverse RNA modifications: re-defining the bridge between transcription and translation. Mol. Cancer. 2020;19:78. doi: 10.1186/s12943-020-01194-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Imam H, et al. N6-methyladenosine modification of hepatitis B virus RNA differentially regulates the viral life cycle. Proc. Natl. Acad. Sci. USA. 2018;115:8829–8834. doi: 10.1073/pnas.1808319115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kim GW, Moon JS, Siddiqui A. N6-methyladenosine modification of the 5’ epsilon structure of the HBV pregenome RNA regulates its encapsidation by the viral core protein. Proc. Natl. Acad. Sci. USA. 2022;119:e2120485119. doi: 10.1073/pnas.2120485119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Gholamalipour Y, Karunanayake Mudiyanselage A, Martin CT. 3’ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character-RNA-Seq analyses. Nucleic Acids Res. 2018;46:9253–9263. doi: 10.1093/nar/gky796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Norris M, Fetler B, Marchant J, Johnson BA. NMRFx processor: a cross-platform NMR data processing program. J. Biomol. NMR. 2016;65:205–216. doi: 10.1007/s10858-016-0049-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kao C, Zheng M, Rudisser S. A simple and efficient method to reduce nontemplated nucleotide addition at the 3 terminus of RNAs transcribed by T7 RNA polymerase. RNA. 1999;5:1268–1272. doi: 10.1017/S1355838299991033. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Peer Review File (408.5KB, pdf)
Reporting Summary (1.4MB, pdf)
Source data (4.3MB, zip)

Data Availability Statement

All data presented in the manuscript are available from the corresponding author upon request. Source data and sequences for the DNA and RNA oligoes used are provided with this paper. Source data are provided with this paper.


Articles from Nature Communications are provided here courtesy of Nature Publishing Group

RESOURCES