MmoD regulates soluble methane monooxygenase and methanobactin production in Methylosinus trichosporium OB3b

ABSTRACT

Methane oxidation by aerobic methanotrophs is well known to be strongly regulated by the availability of copper, i.e., the “copper switch.” That is, there are two forms of methane monooxygenase: a cytoplasmic or soluble methane monooxygenase (sMMO) and a membrane-bound or particulate methane monooxygenase (pMMO). sMMO is only expressed and active in the absence of copper, while pMMO requires copper. Previous work has also shown that one gene in the operon of the soluble methane monooxygenase—mmoD—also plays a critical role in the “copper switch,” but its function is still vague. Herein, we show that MmoD is not needed for the expression of genes in the sMMO gene cluster but is critical for the formation of sMMO polypeptides and sMMO activity in Methylosinus trichosporium OB3b, indicating that MmoD plays a key post-transcriptional role in the maturation of sMMO. Furthermore, data also show that MmoD controls the expression of methanobactin, a copper-binding compound used by some methanotrophs, including M. trichosporium OB3b, for copper sequestration. Collectively, these results provide greater insights into the components of the “copper switch” and provide new strategies to manipulate methanotrophic activity.

IMPORTANCE

Aerobic methanotrophs play a critical role in the global carbon cycle, particularly in controlling net emissions of methane to the atmosphere. As methane is a much more potent greenhouse gas than carbon dioxide, there is increasing interest in utilizing these microbes to mitigate future climate change by increasing their ability to consume methane. Any such efforts, however, require a detailed understanding of how to manipulate methanotrophic activity. Herein, we show that methanotrophic activity is strongly controlled by MmoD, i.e., MmoD regulates methanotrophy through the post-transcriptional regulation of the soluble methane monooxygenase and controls the ability of methanotrophs to collect copper. Such data are likely to prove quite useful in future strategies to enhance the use of methanotrophs to not only reduce methane emissions but also remove methane from the atmosphere.

INTRODUCTION

Methanotrophs—microbes that can use methane as their sole carbon and energy source—play an important role in mitigating climate change as methane is a potent greenhouse gas with a global warming potential 28 times higher than that of carbon dioxide over a 100-year time frame (1–4). Perhaps even more importantly, however, is that CH₄ is a short-lived greenhouse gas. As a result, the removal of CH₄ from the atmosphere has the potential to significantly slow near-term climate change. Any such effort to utilize methanotrophs to control methane emissions, however, requires a detailed understanding of the environmental parameters that control methanotrophic activity and how methanotrophs respond to these environmental signals.

The first and perhaps most crucial step for methane metabolism by aerobic methanotrophs is the oxidation of methane to methanol by methane monooxygenase (MMO). There are two forms of MMO—a membrane-bound or particulate MMO (pMMO) and a cytoplasmic or soluble MMO (sMMO) (5–9). pMMO is found in most aerobic methanotrophs, while sMMO is only found in some methanotrophs (3, 10). Moreover, several methanotrophic species, e.g., Methylosinus trichosporium OB3b and Methylococcus capsulatus Bath (among others), can express both pMMO and sMMO (7, 11). In these methanotrophs, the expression and activity of the two forms of MMO are controlled according to copper availability, i.e., the “copper switch.” sMMO is only expressed and active in the absence of copper, while in the presence of copper, sMMO expression is repressed. Conversely, pMMO expression and activity increase with increasing availability of copper (8, 11, 12).

Intriguingly, although there is a great deal known about the structure and genetics of pMMO, there is a still significant amount of debate as to how this form of MMO oxidizes methane. That is, although pMMO is known to be composed of three subunits, α, β, and γ, encoded by pmoB, pmoA, and pmoC, the number and composition of metal centers in pMMO, as well as the mechanism of methane oxidation, are still contested. Originally, work spearheaded at Northwestern argued that pMMO contained one monocopper site, a dicopper site (both within the soluble regions of PmoB), and a zinc site (in the membrane region of PmoC), and that methane oxidation may occur at either the dicopper or zinc site. Subsequently, this group asserted that methane oxidation occurred at the dicopper site, but further study showed that this putative dicopper center was rather a monocopper center and that methane oxidation likely did not occur there. Rather, it is now argued by this group that methane oxidation may occur at the “original” zinc site and that it actually does not contain zinc, but one, possibly two, monocopper center at this location, and these are coordinated by residues from PmoC and/or PmoA (13–18). Another model of pMMO argues that it contains a tri-copper cluster coordinated by amino acid residues of PmoA and PmoC that serves as the active site (19, 20). Finally, others contend that methane oxidation by the pMMO occurs via a diiron metal complex in the “original” zinc site. This diiron site is coordinated by residues from PmoA and PmoC, and electrons are postulated to be shuttled to this center via a monocopper site (21). It should be stressed that although there is still a great deal of controversy regarding the role and location of copper in pMMO, all models agree that copper is important for the activity of pMMO.

Alternatively, sMMO relies on iron for methane oxidation (6, 7, 22–24). sMMO consists of three components encoded by the mmo gene cluster: (i) mmoXYZ encoding for the α, β, and γ subunits, respectively, of the sMMO hydroxylase (MMOH) that contains a diiron active site where methane is oxidized (note that this diiron center is very similar to that proposed for pMMO by some researchers (21); (ii) mmoC encoding for a reductase that receives electrons from NADH; and(iii) mmoB that encodes an electron shuttle protein that enables sMMO to act as an oxygenase and not an oxidase (6, 25, 26) (Fig. 1). To initiate methane catalysis, two electrons are delivered from MmoC to the diiron center of MMOH, reducing the diiron center from a diferric state to a diferrous state. MmoB binds to MMOH and mediates the transfer of electrons to the active site of MMOH where methane and oxygen are bound (6, 27–30).

Fig 1.

mmo gene cluster of M. trichosporium OB3b. The protein encoded by each gene and the σ promoter (Pσ) region are indicated in the gene cluster. The sigma promoter upstream of mmoD was detected using the Promoter Calculator Tool (31).

The mmo gene cluster includes an additional gene, mmoD, that does not encode for a polypeptide found in the sMMO complex and is not involved in the catalysis of sMMO (Fig. 1) (6, 25). In vitro biochemical analysis indicates MmoD can bind to MMOH and act as a potent inhibitor of sMMO (32). Structural analysis indicates that MmoD and MmoB recognize the same binding site of MMOH, and the binding of either MmoD or MmoB to MMOH leads to inhibition or activation, respectively, of MMOH (33). Besides behaving as an inhibitor of MMOH, other work indicates that MmoD may bind DNA and that MmoD is a regulatory protein involved in regulating the expression of pMMO/sMMO, i.e., it plays a role in the canonical “copper switch” of methanotrophs (34).

Despite these efforts, relatively little is known about MmoD, and there is still some uncertainty as to the number and nature of roles it may play in affecting methanotrophic physiology. For example, is MmoD critical for the formation/assembly of sMMO and methanotrophic growth in the absence of copper? Is MmoD involved in the regulation of other genes besides pmo and mmo? In this study, we further investigated the function of MmoD in controlling gene expression, physiology, and proteome of M. trichosporium OB3b through the construction of a markerless deletion of mmoD.

RESULTS

Deletion of mmoD gene in M. trichosporium OB3b and back complementation in trans

To explore the function of mmoD in M. trichosporium OB3b, a markerless deletion of mmoD was constructed (ΔmmoD, with 300 bp of mmoD deleted, or 80% of the gene sequence, Fig. S1). The absence of mmoD in the genome of M. trichosporium OB3b was verified by PCR (Fig. S2) and sequencing (data not shown).

To further confirm the function of mmoD, a back complementation mutant in trans was constructed by cloning mmoD and its promoter into pTJS-140 vector and transformed into ΔmmoD. Back complementation of mmoD in ΔmmoD (ΔmmoD+pTJS-mmoD) was verified by PCR and kanamycin resistance of ΔmmoD+pTJS-mmoD (Fig. S2).

Growth of wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD strains

In the absence of copper, the growth of wild-type M. trichosporium OB3b was stable for three consecutive transfers in NMS medium, i.e., growth rate (~1.5 d⁻¹) and final OD₆₀₀ (0.6–0.7) for each transfer were comparable and not significantly different (Fig. 2A, G, and H; note that data in Fig. 2G and H also include growth in the presence of copper). In contrast, the growth of ΔmmoD in the absence of copper was significantly reduced (P = 0.00006) after the first transfer (1.3 d⁻¹ in the first growth cycle to 0.3–0.4 d⁻¹ for the second and third cycles; Fig. 2C and H). In addition, the final OD₆₀₀ of ΔmmoD was approximately one-third that of wild-type M. trichosporium OB3b, despite incubating ΔmmoD for approximately twice as long (P = 0.002) (Fig. 2G). More robust growth of ΔmmoD in the first cycle was likely due to the transfer of copper from the initial inoculum (this strain was normally maintained in copper-containing growth medium), but such copper contamination was diluted in the second and subsequent transfers. Growth recovered in the ΔmmoD strain back-complemented with mmoD in trans (pTJS-mmoD), and the final OD₆₀₀ of each transfer (~0.7) was similar to wild type (Fig. 2E and G). The growth rate of ΔmmoD+pTJS-mmoD was significantly higher (0.6 vs 0.3 d⁻¹) than ΔmmoD but was also significantly lower than the growth of wild-type M. trichosporium OB3b (0.6 vs 1.5 d⁻¹) (Fig. 2H).

Fig 2.

Consecutive transfer and growth of wild-type M. trichosporium OB3b (WT), ΔmmoD, and ΔmmoD with pTJS-mmoD in NMS medium without copper (A, C, E) and with 1 µM copper (B, D, F). Highest OD₆₀₀ (G) and growth rate (H) in each transfer were measured and calculated. Error bars indicate standard deviations from triplicate biological cultures. The one-way ANOVA test was performed for variance analysis of the growth rate and OD₆₀₀ between different transfers and growth conditions of wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD with pTJS-mmoD. Bars within each plot labeled by different letters are significantly different (P < 0.05).

In the presence of 1 µM copper, the growth of wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD strains was comparable for all cycles (growth rate ~1.6 d⁻¹, final OD₆₀₀ ~0.8) (Fig. 2B, D, F, G, and H). Interestingly, the growth rate and final OD₆₀₀ of all strains were significantly higher when grown in the presence of copper vs the absence of copper (final OD₆₀₀: 0.8 vs 0.3–0.7, growth rate 1.6 vs 0.3–1.5 d⁻¹, P < 0.05, Fig. 2G and H).

sMMO activity

Due to the growth inhibition observed in M. trichosporium OB3b ΔmmoD when grown in the absence of copper, we suspected that the deletion of mmoD reduced sMMO activity. sMMO activity was only detected in wild-type M. trichosporium OB3b and ΔmmoD+pTJS-mmoD strains but not in ΔmmoD in the absence of copper (Fig. 3A).

Fig 3.

Naphthalene assay of sMMO activity (A) and RT-qPCR analysis of the relative expression of mmoX (B), mmoC (C), mmoD (D), pmoA (E), and mbnA (F) in wild-type M. trichosporium OB3b (WT) (left panel), ΔmmoD (middle panel), and ΔmmoD with pTJS-mmoD (left panel) grown with and without 1 µM copper. Error bars indicate standard deviations from triplicate biological cultures. A t-test was performed for variance analysis between wild-type M. trichosporium OB3b and ΔmmoD under different growth conditions. Bars within each plot labeled by different letters are significantly different (P < 0.05).

Transcriptional analysis of MMO encoding genes and genes involved in copper uptake

RT-qPCR of mmoX, mmoC, and mmoD was performed to quantify the expression of sMMO genes. mmoX expression was over four orders of magnitude higher in the absence vs in the presence of copper for all three strains, i.e., wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD (Fig. 3B). No significant difference in mmoX expression was observed between wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD with pTJS-mmoD when grown under the same condition (i.e., with or without 1 µM copper) (Fig. 3B). mmoC expression in all the strains was similar to each other, i.e., mmoC expression was 50–100-fold higher in the absence of copper than in the presence of 1 µM copper (Fig. 3C). Moreover, mmoD expression was over three orders of magnitude higher in the absence vs presence of copper in wild-type M. trichosporium OB3b (Fig. 3D). The expression level of mmoD decreased less in the absence vs presence of copper for ΔmmoD+pTJS-mmoD (~3× decrease), but such a difference was significant (P < 0.003). In the absence of copper, mmoD expression was 10-fold higher (P = 0.006) in wild-type M. trichosporium OB3b than that observed in ΔmmoD+pTJS-mmoD. Conversely, in the presence of copper, the expression of mmoD was significantly lower (~70 fold) in wild-type M. trichosporium OB3b vs ΔmmoD+pTJS-mmoD (Fig. 3D).

pMMO expression was also monitored by RT-qPCR of pmoA. In the absence of copper, pmoA expression in wild-type M. trichosporium OB3b and ΔmmoD and ΔmmoD+pTJS-mmoD was without any significant difference (Fig. 3E). In the presence of 1 µM copper, pmoA expression increased 3–9× in all three strains, and such increase was significant for wild-type M. trichosporium OB3b and ΔmmoD strains, but not for the back-complemented mutant (ΔmmoD+pTJS-mmoD). There was little difference, however, in the expression of pmoA in the presence of copper for all three strains.

Intriguingly, mbnA [encoding the precursor polypeptide of a copper chelating compound, methanobactin (MB)] expression is different in M. trichosporium OB3b ΔmmoD and ΔmmoD+pTJS-mmoD as compared to wild-type M. trichosporium OB3b. In each of these three strains, mbnA expression was 10- to 40-fold higher in the absence vs presence of 1 µM copper. However, in the absence of copper, mbnA expression was 22- to 35-fold higher in ΔmmoD and ΔmmoD+pTJS-mmoD than wild-type M. trichosporium OB3b (Fig. 3F). In contrast to mbnA, two other genes of the mbn operon (mbnB and mbnN, involved in processing the precursor peptide encoded by mbnA) did not show significant differences in expression among the three strains in the absence of copper (Fig. S3).

UV-Vis spectroscopy analysis of methanobactin production

Due to the higher expression of the methanobactin precursor gene—mbnA—in ΔmmoD and ΔmmoD+pTJS-mmoD, we measured and compared the production of methanobactin in wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD via UV-Vis spectroscopy. Absorbances at 340 and 394 nm (associated with the two oxazolone rings critical for binding copper) increased over 2.4-fold in M. trichosporium OB3b ∆mmoD vs wild type, but only ~1.7-fold when comparing M. trichosporium OB3b ∆mmoD+pTJS-mmoD vs wild type (Fig. 4). These data indicate a much higher MB production in ΔmmoD and ΔmmoD+pTJS-mmoD strains than wild-type M. trichosporium OB3b, which is in line with the transcription of mbnA (Fig. 3F).

Fig 4.

UV-Vis absorption spectra of the supernatant of wild-type M. trichosporium OB3b (WT, black), ΔmmoD (red), and ΔmmoD with pTJS-mmoD (green) cultures growing without copper. The OD₆₀₀ of the active growing culture of these strains was ~0.6.

Proteomic analyses

To further investigate the role of MmoD in the physiology of M. trichosporium OB3b, the proteome of wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD strains was characterized when grown in the absence of copper. In total 2,411, 2,450, and 2,421 proteins were identified in at least two of three replicate samples of wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD, respectively (Fig. S4; Tables S1 to S3). Of these proteins, 44 proteins were found to be differentially expressed (|log₂ fold change| > 2, adjusted P < 0.05) in M. trichosporium OB3b ΔmmoD vs wild type, including polypeptides of sMMO—MmoX, Y, Z, and B being significantly lower in the ΔmmoD strain [although we should stress expression of mmo genes was not different between these strains (Fig. 5; Table S4)]. MmoC, although not significantly different between M. trichosporium OB3b ΔmmoD vs wild type using our cutoff criteria, did show a log₂ fold change of −1.42, with an adjusted P value of 3 × 10⁻⁵ (Table S4). Polypeptides for conversion of the methanobactin precursor polypeptide to mature methanobactin (MbnB, C, and N) were not found to have differential abundance in M. trichosporium ΔmmoD vs wild-type M. trichosporium (Table S4), which agrees with the transcriptional results for mbnB and mbnN (Fig. S3). It should be stressed that the precursor polypeptide of MB—MbnA—was not found in any sample, presumably due it being modified to MB, and thus unable to be detected using standard proteomic methodologies.

When M. trichosporium OB3b ∆mmoD was back-complemented in trans, MmoD was apparent, but less than that observed in wild-type M. trichosporium OB3b (~16-fold lower; Table S5). In addition, sMMO polypeptides (MmoXYB and C) in M. trichosporium OB3b ∆mmoD+pTJS-mmoD, although ~1.5–6× lower than that observed in wild-type M. trichosporium OB3b, were substantially higher than that observed in M. trichosporium O3b ∆mmoD, i.e., ~2–16-fold higher (Table S6).

DISCUSSION

Unlike methanotrophs that only express pMMO, e.g., Methylomicrobium album BG8 and Methylocystis sp. strain SB2 (35, 36), M. trichosporium OB3b can survive, if not thrive, in the absence of copper due to the expression of sMMO under low copper (<0.2 µM) conditions (11, 36, 37), aka, the “copper switch.” Although the importance of copper in regulating sMMO/pMMO has been known for over 40 years (11, 12), the underlying regulatory mechanism(s), however, is(are) still not completely clear.

Previously, we characterized a mutant of M. trichosporium OB3b where mmoXYBZD was deleted. In this mutant, pmoA expression decreased with increasing copper availability (34). Given this finding, we concluded that MmoD is a key regulatory protein for the copper switch in M. trichosporium OB3b. Our results here support this conclusion that MmoD is a critical element for the growth of M. trichosporium OB3b ∆mmoD in the absence of copper. Unlike our earlier results, however, herein, where we constructed a deletion of mmoD only, the expression of neither pmo nor mmo genes varied with respect to copper (Fig. 2). Thus, although MmoD is important for the growth of M. trichosporium OB3b in the absence of copper, we must re-consider our hypothesis that it controls the “copper switch” at the level of transcription.

Intriguingly, no sMMO activity was apparent in M. trichosporium OB3b ΔmmoD when grown in the absence of copper. In addition, proteomic analysis revealed that the abundance of sMMO polypeptides was significantly lower in ΔmmoD than wild-type M. trichosporium OB3b and ΔmmoD+pTJS-mmoD (Fig. 5; Tables S4 and S6). These findings suggest that MmoD may act as a post-transcriptional regulator of sMMO. Such regulation, however, does not appear to extend to pMMO, i.e., neither the expression of pmoA nor the presence of pMMO polypeptides was markedly different in M. trichosporium OB3b ΔmmoD, wild type, or ΔmmoD+pTJS-mmoD (Fig. 3 and 5; Tables S1 to S6).

Fig 5.

Volcano plot comparing protein intensity of M. trichosporium ΔmmoD to wild type (A) and ΔmmoD to ΔmmoD carrying pTJS-mmoD (back-complemented strain) (B). Dotted horizontal and vertical lines indicate significant adjusted P-value of 0.05 and |log₂ fold change| equal to 2.

With the available data, we can only speculate on the mechanism of such regulation, but at least two general hypotheses can be put forward. First, the translation of mmo transcripts may only effectively occur in the presence of MmoD. Second, sMMO polypeptides may be synthesized in M. trichosporium OB3b ΔmmoD but require MmoD to be assembled to form active sMMO. In this case, the unassembled sMMO polypeptides may be subject to protease attack, e.g., by ClpXP, a bacterial AAA+proteolytic enzyme for damaged/misfolded/unneeded protein degradation (38, 39), leading to the lower abundance of sMMO polypeptides observed in M. trichosporium OB3b ΔmmoD. This hypothesis has some support as proteases, including ClpXP, are highly expressed in both M. trichosporium OB3b ΔmmoD and wild type (Tables S1 and S2). This hypothesis is further bolstered by a previous study suggesting that MmoD may act as a protein chaperone to protect MMOH during protein folding (33).

In any event, although the exact role of MmoD in the copper switch is still unclear, it is apparent that the “copper switch” has multiple layers at both transcription and translation to ensure appropriate regulation of pMMO/sMMO. For example, our previous study demonstrates that the copper switch in M. trichosporium OB3b involves two TonB-dependent transporters responsible for the uptake of different forms of methanobactin (40, 41). MmoD may serve as an additional regulatory protein to ensure the appropriate response of M. trichosporium OB3b to copper.

In addition to the finding that MmoD post-transcriptionally controls sMMO activity, it also appears that it can directly control the expression of methanobactin, a specialized copper uptake system found in M. trichosporium OB3b. That is, the expression of mbnA, encoding for the precursor polypeptide of MB, was significantly higher in M. trichosporium ΔmmoD than wild-type M. trichosporium OB3b, and UV-Vis spectroscopy indicated the greater presence of MB. Interestingly, although ∆mmoD clearly produced more MB than wild type, such increase was not due to the increased expression of other genes in the mbn operon, i.e., the expression of mbnB and mbnN that are critical for the conversion of the precursor polypeptide to mature MB was not significantly different between M. trichosporium ΔmmoD and wild-type M. trichosporium OB3b, nor was the presence of MbnB or MbnN (Fig. S3). Thus, it appears that(i) MB production in M. trichiosporium OB3b is primarily controlled by the expression of mbnA, (ii) the expression of mbnA is controlled by MmoD, and (iii) the expression of other genes in the mbn operon can be uncoupled from the expression of mbnA.

Previous in vitro biochemical study indicates MmoD behaves as an inhibitor for sMMO by competing with MmoB for binding to MMOH, leading to a conformational change of MMOH (33). In this study, we demonstrate that the lack of MmoD causes the inactivation of sMMO and thereby strongly inhibits the growth of M. trichosporium OB3b under no copper condition. Proteomic analysis shows a significantly lower abundance of sMMO polypeptides in cells of ∆mmoD as compared to wild type and ∆mmoD+pTJS140-mmoD (Tables S1 to S6). MmoD clearly has another role other than as an inhibitor of sMMO, likely in facilitating the translation and/or assembly of sMMO polypeptides. Moreover, it should be noted that in vitro biochemical analyses found that the inhibition of MmoD on sMMO only occurred when the ratio of MmoD to MMOH was greater than 1 (33). Such a condition is unlikely to occur in vivo as the ratio of MmoD to polypeptides of MMOH (MmoX, Y, and Z) is on the order of 0.001 in wild-type M. trichosporium OB3b (Table S1). Thus, we conclude that MmoD is involved in controlling the assembly, rather than the catalysis, of sMMO. That is, after the synthesis of sMMO, MmoD is unneeded and will likely be subjected to protease degradation and thus avoid being bound to MMOH. Such an assumption is supported by previous findings showing that the absence of MmoD in purified sMMO (25) as well as the proteomic investigation of M. capsulatus Bath showing MmoD polypeptide cannot be detected by LTQ-ORBITRAP mass spectrometry, whereas all sMMO polypeptides (MmoXYZBC) are detected (42).

In conclusion, we show that MmoD is essential for the activity of M. trichosporium OB3b in the absence of copper and is involved in regulating the expression of genes needed for methanobactin synthesis. Further study is needed to investigate the roles of MmoD in the biochemistry of sMMO through multiple approaches, such as the expression of sMMO polypeptides with and without MmoD followed by enzymatic assays to elucidate the potential involvement of MmoD in the translation and assembly of sMMO.

MATERIALS AND METHODS

Growth conditions

Wild-type Methylosinus trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD (with 25 µg/mL kanamycin) were grown in nitrate mineral salt (NMS) medium (43) in the absence (no added) or presence of copper (1 µM as CuCl₂). Methane and air were added at a methane-to-air ratio of 1:2. Cultures were incubated in the dark at 30°C. The solid NMS medium was supplemented with 1.2% agar. Liquid cultures were grown in 250 mL sidearm Erlenmeyer flasks with 20 mL NMS medium with shaking at 200 rpm. Growth was monitored by measuring the optical density at 600 nm (OD₆₀₀) with a Genesys 20 visible spectrophotometer (Spectronic Unicam, Waltham, MA). Triplicate biological cultures were prepared for all experimental conditions. One-way ANOVA tests were performed for variance analysis of the growth rate and OD₆₀₀ between different transfers and growth conditions of wild-type M. trichosporium OB3b, ΔmmoD, and ΔmmoD with pTJS-mmoD. Cultures were harvested at the middle to late exponential phase for RNA isolation and transcriptional analysis of a specific gene expression. Escherichia coli was grown in Luria–Bertani broth (LB) at 37°C with or without supplementation of 25 µg/mL kanamycin.

Construction of M. trichosporium OB3b ΔmmoD

mmoD was knocked out using a previously described protocol (44) with modifications. Briefly, upstream and downstream regions of mmoD (arms A and B, respectively) were amplified using the primers listed in Table 1. Arms A and B were digested with the appropriate restriction enzymes and ligated together to form armAB, which was subsequently inserted into pK18mobsacB mobilizable suicide vector (Fig. S1) (45). pK18mobsacB vector with armAB was transferred to E. coli Top10 (Invitrogen, Carlsbad, CA). The plasmid was then extracted from transformed E. coli Top10 using the Plasmid Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The extracted plasmid was then transferred to E. coli S17-1 (46). Conjugation of E. coli S17-1 carrying the constructed vector with M. trichosporium OB3b was performed as described by Martin and Murrell (47). Transconjugants were grown on NMS plates supplemented with 25 µg/mL kanamycin and 10 µg/mL nalidixic acid. One kanamycin-resistant transconjugant colony (generated after 10 d of incubation) was transferred to an NMS plate with kanamycin (25 µg/mL) and incubated for 7 d, and subsequently transferred to an NMS plate with 2.5% sucrose (mass/vol). Sucrose-resistant colonies were generated after a 10-d incubation and were screened for deletion of mmoD by colony PCR using checking primers (Table 1). Successful mmoD deletion mutant was further confirmed by PCR with DNA extracted from the mutant using the DNeasy PowerSoil Pro Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.

TABLE 1.

Primers used in this study

Primer name	Sequence (5′–3′)a	Application	Reference
qmmoC_F qmmoC_R	TCAATCACCGTTCCCTTGTC ATCGCGAGGAATTGTTCTATGT	RT-qPCR	This study
qmmoD_F qmmoD_R	CGAGCGCTATCAAGCCTATAC AAAGTGGCTCAGCACATGA	RT-qPCR	This study
qmmoX_F qmmoX_R	TCAACACCGATCTSAACAACG TCCAGATTCCRCCCCAATCC	RT-qPCR	(48)
qpmoA_F qpmoA_R	TTCTGGGGCTGGACCTAYTTC CCGACAGCAGCAGGATGATG	RT-qPCR	(48)
qmbnA_F qmbnA_R	TGGAAACTCCCTTAGGAGGAA CTGCACGGATAGCACGAAC	RT-qPCR	(34)
qmbnB_F qmbnB_R	CGTATTCCACGAGGCGAAGA GCTTCCCGAGCTTCTCCAAT	RT-qPCR	This study
qmbnN_F qmbnN_R	GATTTCGCCGAAGTGGAAAA GCGTAATGAGCATACATCGG	RT-qPCR	This study
Eub-341_F Eub-534_R	CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGGC	RT-qPCR	(49)
mmoD-armA_F mmoD-armA_R	ATTTTT gaattc GGCACCAAATTCACCATCACCb ATTTTT ggtacc GAACGCATGTCTTTCGCAAT	Arm PCR	This study
mmoD-armB_F mmoD-armB_R	ATTTTT ggtacc TGCTGCGCGAGATCGGAAb ATTTTT aagctt GACGGATGAAGAATTCGAGCTG	Arm PCR	This study
mmoD-check_Fc mmoD-check_Rc	TTATTACGGCACTCCGCTCG TCAGCTCATAATCGCCGTCC	PCR for mutant check	This study
mmoD_F mmoD-R	ATTTTT ggtacc GAGTTCCGGCAGCTCTACA ATTTTT gcatgc GAACGAACAGGTTTCTCCGTC	mmoD PCR for back complementation	This study

^a Y, S, and R are the IUPAC DNA codes for the C/T, C/G, and A/G nucleobases, respectively.

^b Lowercase letters indicate EcoRI, KpnI, SphI, or HindIII restriction site sequences included in these primers.

^c Targeting region indicated in Fig. S2.

Back complementation of ΔmmoD

mmoD with its native promoter was PCR-amplified using the primer listed in Table 1 and cloned into pTJS140 broad-host-range cloning vector (50). The pTJS140 vector with mmoD (pTJS-mmoD) was transformed to E. coli S17-1. The back complementation strain (ΔmmoD carrying pTJS-mmoD) was obtained by introducing pTJS-mmoD into ΔmmoD via conjugation as described above. ΔmmoD carrying pTJS-mmoD was growing and maintained in NMS medium with 25 µg/mL kanamycin.

RNA isolation and reverse transcription-quantitative PCR

RNA was isolated from biomass in the middle to late exponential growth phase of the first growth iteration of each strain. RNA isolation was performed using a bead-beating procedure followed by column purification using an RNeasy Mini Kit (Qiagen, Hilden, Germany) as described before (51). Genomic DNA was removed from the column with RNase-free DNase (Qiagen, Hilden, Germany) treatment. The absence of genomic DNA was confirmed by 16S rRNA gene-targeted PCR with extracted RNA samples as templates. Purified RNA was quantified using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE). cDNA was synthesized from 200 ng total RNA using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions.

RT-qPCR was performed to determine the relative expression of the pmoA, mmoX, mmoC, mmoD and mbnA in M. trichosporium OB3b, ΔmmoD, and ΔmmoD carrying pTJS-mmoD grown in the presence or absence of copper, as well as mbnB and mbnN in the absence of copper. Primers were designed using the NCBI online primer design tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Primer specificity was checked with the online tool and further verified by PCR, gel electrophoresis, and sequencing. RT-qPCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA) with 96-well PCR plates on a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA). The RT-qPCR program was 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 56°C for 30 s, and 72°C for 30 s. Melting curves were measured from 65°C to 95°C with increments of 0.5°C and 10 s at each step. The transcription of the targeted genes was determined using cDNA as the template. The transcript levels were calculated by relative quantification using the 2^−ΔΔCq method (52) with the 16S rRNA gene as the reference gene (53).

sMMO activity

sMMO activity was measured using resting cells of M. trichosporium OB3b, ΔmmoD, and ΔmmoD carrying pTJS-mmoD grown in the absence (no added) of copper and the presence of 1 µM copper. Cells were harvested at the middle to late exponential growth phase of the first growth iteration and resuspended in 1.6 mL NMS medium (without copper) in a 2 mL screw-cap tube. Naphthalene was then added to the cell suspensions and incubated at 30°C for 1 h with shaking at 200 rpm. Fast Blue B (tetrazotized o-dianisidine, 4.21 mM) was subsequently added to the supernatant of the cell suspensions for visualization of the production of napthol from naphthalene, a process that can only be mediated by sMMO and not pMMO (54).

Sample preparation for proteomic analysis

M. trichosporium OB3b, ΔmmoD, and ΔmmoD+pTJS-mmoD grown without copper were collected at the middle to late exponential growth phase of the first growth iteration of each strain for proteomic analysis. Cells were lysed in modified RIPA buffer (2% SDS, 50 mM Tris HCl pH 8, 150 mM NaCl, 1× Roche cOmplete protease inhibitor) using a QSonica sonic probe with the following settings: amplitude 50%, pulse 10 × 1 s, 1 on, 1 off. Extracts were subjected to TCA precipitation according to the method of Jessie et al. (55). Washed protein pellets were solubilized in 500 µL of urea buffer (8 M urea, 150 mM NaCl, 50 mM Tris pH 8, 1× Roche cOmplete protease inhibitor). Protein quantitation was performed using Qubit fluorometry (Invitrogen). Fifty micrograms of each lysate was digested with the protocol as follows: (i) reduction with 15 mM dithiothreitol at 25°C for 30 min followed by alkylation with 15 mM iodoacetamide at 25°C for 45 min in the dark; (ii) digestion with 2.5 µg sequencing grade trypsin (Promega) at 37°C overnight. The final digest volume was amended with 0.5 mL 25 mM ammonium bicarbonate; (iii) the resulting mixture was cooled to 25°C, acidified with formic acid, and desalted using a Waters Oasis HLB solid-phase extraction plate. Eluted samples were then frozen and lyophilized; and (iv) a pooled sample was made by mixing equal amounts of digested material from each sample. This pooled sample was used to generate a gas phase fractionation library.

Mass spectrometry analysis

Data-independent-acquisition chromatogram library generation

One microgram of the pooled sample was analyzed by nano LC-MS/MS with a Waters M-class HPLC system interfaced with ThermoFisher Exploris 480. Peptides were loaded on a trapping column and eluted over a 75-µm analytical column at 350 nL/min where both columns were packed with XSelect CSH C18 resin (Waters). The trapping column was composed of 5-µm particles, and the analytical column contained 2.4-µm particles. The column was heated to 55°C using a column heater (Sonation). The sample was analyzed using 6 × 0.5-h gradients. Six gas-phase fraction injections were acquired for six ranges: 396–502, 496–602, 596–702, 696–802, 796–902, and 896–1,002. Sequentially, full-scan MS data [60,000 full width at half maximum (FWHM) resolution] was followed by 26 × 4 m/z precursor isolation windows, another full scan, and 26 × 4 m/z windows staggered by 2 m/z. The products were acquired at 30,000 FWHM resolution. The automatic gain control (AGC) target was set to 10⁶ for both full MS and production data. The maximum ion inject time (IIT) was set to 50 ms for full MS and dynamic mode for products with nine data points required across the peak. The normalized collision energy (NCE) was set to 30.

Sample analysis

Samples were randomized for acquisition. One microgram per sample was analyzed by nano LC/MS with a Waters M-class HPLC system interfaced with ThermoFisher Exploris 480. Peptides were loaded on a trapping column and eluted over a 75 µm analytical column at 350 nL/min; both columns were packed with XSelect CSH C18 resin (Waters); the trapping column contained 5-µm particles, and the analytical column contained 2.4-µm particles. The column was heated to 55°C using a column heater (Sonation). Samples were analyzed using a 0.5-h gradient. The mass spectrometer was operated in a data-independent mode. Sequentially, full scan MS data (60,000 FWHM resolution) from 385–1,015 m/z was followed by 61 × 10 m/z precursor isolation windows; another full scan from 385–1,015 m/z was followed by 61 × 10 m/z windows staggered by 5 m/z; products were acquired at 15,000 FWHM resolution. The maximum ion inject time was set to 50 ms for full MS and dynamic mode for products with nine data points required across the peak; the NCE was set to 30.

Data processing

DIA data were analyzed using Scaffold DIA 3.3.1 (Proteome Software). DIA-MS data files were converted to mzML format using ProteoWizard (3.0.21072). Deconvolution of staggered windows was performed. Analytic samples were aligned based on retention times and individually searched against the Prosit library (DLIB) and the chromatogram/reference library to create a custom EncyclopeDIA library. The digestion enzyme was assumed to be trypsin with a maximum of one missed cleavage site allowed. Peptides identified in each sample were filtered by Percolator to achieve a maximum FDR of 0.01. Individual search results were combined, and peptide identifications were assigned posterior error probabilities and filtered to an FDR threshold of 0.01 by Percolator. Peptide quantification was performed by Encyclopedia (1.12.31). For each peptide, the five highest-quality fragment ions were selected for quantitation. Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis were grouped to satisfy the principles of parsimony. Protein groups with a minimum of two identified peptides were thresholded to achieve a protein FDR of less than 1.0%. The sample q-value was set to less than 0.01. Statistical difference in protein intensity between the groups was analyzed by ANOVA. The P-value was adjusted using the standard Benjamini and Hochberg procedure, and the proteins with adjusted P-value <0.05 were considered statistically significant.

DATA AVAILABILITY

Data that supports the findings of this study are available in the supplementary material of this article. In addition, proteomic data are available at the PRIDE database, accession number PXD045741.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aem.01601-23.

Tables S1 to S6. aem.01601-23-s0001.xlsx.

Proteomic data sets.

Fig. S1 to S4. aem.01601-23-s0002.docx.

General protocols and supplemental data.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.