KPNA2 suppresses porcine epidemic diarrhea virus replication by targeting and degrading virus envelope protein through selective autophagy

ABSTRACT

Porcine epidemic diarrhea virus (PEDV) infection in pigs is characterized by vomiting, dehydration, and diarrhea. Structural proteins of PEDV play crucial roles in viral entry, release, assembly, budding, and host immune regulation. Similar to other viruses, PEDV relies heavily on the host cellular machinery for productive infection. However, the host factors involved in PEDV infection remain unidentified. Thus, this study aims to map the PEDV structural proteins interacting with host factors in Vero cells. Results revealed karyopherin α 2 (KPNA2) as a potential host factor to suppress PEDV replication. KPNA2 overexpression in target cells significantly inhibited PEDV infection, whereas KPNA2 silencing by small interfering RNA promoted PEDV infection. Mechanistically, KPNA2 interacted with PEDV E, which led to the degradation of PEDV E protein. These results indicate the probable involvement of KPNA2 in the host antiviral response against PEDV. This study provides novel KPNA2-mediated viral restriction mechanisms in which KPNA2 overexpression suppresses PEDV replication by targeting and degrading the viral E protein by autophagy. KPNA2 may serve as a target in developing strategies to control PEDV infection.

IMPORTANCE

Porcine epidemic diarrhea, characterized by vomiting, dehydration, and diarrhea, is an acute and highly contagious enteric disease caused by porcine epidemic diarrhea virus (PEDV) in neonatal piglets. This disease has caused large economic losses to the porcine industry worldwide. Thus, identifying the host factors involved in PEDV infection is important to develop novel strategies to control PEDV transmission. This study shows that PEDV infection upregulates karyopherin α 2 (KPNA2) expression in Vero and intestinal epithelial (IEC) cells. KPNA2 binds to and degrades the PEDV E protein via autophagy to suppress PEDV replication. These results suggest that KPNA2 plays an antiviral role against PEDV. Specifically, knockdown of endogenous KPNA2 enhances PEDV replication, whereas its overexpression inhibits PEDV replication. Our data provide novel KPNA2-mediated viral restriction mechanisms in which KPNA2 suppresses PEDV replication by targeting and degrading the viral E protein through autophagy. These mechanisms can be targeted in future studies to develop novel strategies to control PEDV infection.

INTRODUCTION

Porcine epidemic diarrhea virus (PEDV), the primary causative agent of porcine epidemic diarrhea (PED), is an enveloped, positive-sense, single-stranded RNA alphacoronavirus belonging to the family Coronaviridae (1, 2). The PEDV genome is approximately 28 kb long, encoding four structural proteins (spike, S; envelope, E; membrane, M; and nucleocapsid, N), two polyproteins (pp1a and pp1ab), and an accessory protein, open reading frame 3 (ORF 3) protein (3). PED is an acute and highly contagious enteric disease in neonatal piglets that is characterized by vomiting, dehydration, diarrhea, and high mortality rate. Since its first outbreak in 1971, PED has been reported in several countries, leading to significant economic losses to the porcine industry worldwide (4–6).

Karyopherin α 2 (KPNA2), comprising 529 amino acids, is a member of the importin α family, which contains seven isoforms of importin α (KPNA1–KPNA7). KPNAs are composed of an N-terminal importin-β binding domain (IBB) and a central domain of 10 tandem armadillo repeats, including two nuclear localization sequence (NLS)-binding sites (7). The α subunit recognizes the NLS of cargo proteins and then binds to the β subunit through the NLS-binding site and the N-terminal IBB. The β subunit carries and subsequently facilitates translocation of the α subunit cargo protein complex into the nucleus (8). KPNAs mediate the nucleocytoplasmic transport of the transcription factors involved in a multitude of cellular processes, including proliferation, metastasis, apoptosis, differentiation, and host immunity (9–12). Following viral infection, ubiquitin-specific peptidase (USP) 22 promotes the nuclear translocation of interferon regulatory factor 3 in a KPNA2-dependent manner to induce host cellular antiviral responses. Aberrant KPNA2 expression is a prognostic marker for various human cancers, such as breast (13), melanoma (14), brain (15), and lung cancers (16). KPNA2 plays a crucial role in the maintenance of undifferentiated embryonic stem cells by transporting transcription factors that maintain pluripotency (17). It also performs non-transport functions, including protein degradation, spindle assembly, and mRNA-related functions (7). For example, Zika virus promotes KPNA2 degradation through chaperone-mediated autophagy, which increases viral yield (18).

Macroautophagy/autophagy is a major degradative process in controlling host intracellular homeostatic pathways, which are activated by several stresses, such as viral infection, cellular starvation, and damaged organelles (19). SQSTM1/P62 is an autophagy receptor that induces the selectivity of autophagy by recognizing and recruiting complexes to autophagosomes and then fuses with lysosomes to degrade their engulfed contents (20). Autophagy plays an essential role in viral replication (21). For instance, alphaherpesvirus proliferation is influenced by USP14 inhibition through endoplasmic reticulum (ER) stress-mediated selective autophagy, and PEDV replication is inhibited by bone marrow stromal cell antigen 2 (BST2) via a selective autophagy pathway (22, 23). Many factors involved in innate immune response have been identified. In addition, other factors have been described using cell cultures (24, 25). Autophagy in PEDV infection has been previously described, even ORF 3 was involved (26). However, the host factors involved in PEDV infection remain to be identified.

Thus, we aimed to map the PEDV structural proteins interacting with host factors in Vero cells. Results revealed that KPNA2 targeted the E protein from PEDV to inhibit PEDV replication through selective autophagy. This study introduces novel KPNA2-mediated viral restriction mechanisms, providing a basis for the development of strategies to control PEDV infections.

MATERIALS AND METHODS

Antibodies and reagents

Antibodies against hemagglutinin (HA) tag (ab9110), FLAG tag (14793S), KPNA2 (Cat#14372S), and LC3 (Cat#3868S) were obtained from Cell Signaling Technology. Antibodies against p62 (Cat#66184-1-Ig), ATG5 (Cat#10181-2-AP), and GAPDH (Cat#60004-1-Ig) were purchased from Proteintech. MG132 (S2619) and CQ (S6999) were purchased from Selleck. Goat anti-rabbit IgG-HRP (Cat#BA1055) and goat anti-mouse IgG-HRP (Cat#BA1051) secondary antibodies were purchased from Boster. Additionally, an anti-PEDV N protein monoclonal antibody (mAb) was acquired from Ye Yu (Jiang Xi Agricultural University, Jiangxi, China).

Viruses and plasmids

In this study, the cDNAs of S, N, M, and E were amplified from the PEDV strain GDS01 (GenBank ID: KM089829.1) isolated in 2012 in Guangdong province and then subcoded into pcDNA-based vectors which expressed N-terminal HA tag-conjugated proteins.

Cells

Vero, intestinal epithelial (IEC), and HEK293T cells were preserved in our laboratory and then cultured in Dulbecco’s modified Eagle’s medium (HyClone, SH30022.01B) supplemented with 10% fetal bovine serum (Gibco) and 1% streptomycin and penicillin (TBD, PS2004HY) at 37°C and 5% CO₂. To generate Vero-KPNA2 cells, Vero cells were transfected with a vector encoding the KPNA2 gene or a control vector using TubroFect (Thermo Scientific, R0531). For transient knockdown, Vero and IEC cells were transfected with either small interfering RNA (siRNA) or control siRNA. In all PEDV-infected experiments, the cells were washed thrice with phosphate buffered saline (PBS) prior to being infected with PEDV at a multiplicity of infection (MOI) of approximately 0.1. After 1 h of absorption, the cells were washed thrice with PBS before harvesting.

Western blotting

Cells were subjected to 30-min incubations using radioimmunoprecipitation assay (Beyotime, P0013B) lysis buffer containing a protease/phosphatase inhibitor cocktail (Beyotime, ST506) on ice. Thereafter, we denatured the supernatant of the lysates with 5× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer (Solarbio, P1015). Proteins were separated using 10% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. After blocking with 5% bovine serum albumin (BSA; Biofroxx; 4240GR025), the membranes were incubated overnight at 4°C with primary antibodies and then with HRP-labeled secondary antibodies at room temperature for 1 h. Proteins were visualized using enhanced chemiluminescence.

Quantitative reverse transcriptase PCR

The mRNA levels of N, E, and KPNA2 (see Table 1 for primer and probe sequences) were detected using real-time quantitative reverse transcriptase polymerase chain reaction (RT-qPCR). Total RNA was extracted using an RNA Rapid Extraction Kit (Bioteke, RP1201) in accordance with the manufacturer’s instructions. Subsequently, RT-qPCR was conducted using the SYBR Green Real-time PCR Master Mix (Toyobo, QPK-201). GAPDH served as an internal reference.

TABLE 1.

Primer and probe sequences used in this study for real-time PCR

Primer sets	Sequences (5´–3´)	bp
PEDV N	F: GAATTCCCAAGGGCGAAAAT R: TTTTCGACAAATTCCGCATCT	88
PEDV N Probe	FAM-CGTAGCAGCTTGCTTCGGACCCA-BHQ1
KPNA2	F: GGCAGAACTGATTGTAGTCCCATT R: GAGATGAACGCTGGGATGGC	122
GAPDH	F: AGCGAGCATCCCCCAAAGTT R: GGGCACGAAGGCTCATCATT	285

Co-immunoprecipitation (co-IP) assay

For the co-IP assay, Vero cells in six-well plates were transfected with vectors encoding tagged proteins, followed by cell lysis buffer containing a protease inhibitor cocktail (YEASEN, 20124ES03) and phosphatase inhibitor cocktail (YEASEN, 20109ES05). Lysates were collected and then incubated with Dynabeads Protein G coupled to an anti-HA antibody. The Dynabeads were washed with 0.02% PBS-Tween 20 and then re-suspended in 50 mM glycine elution buffer (pH 2.8). Immunoblotting using specific antibodies was conducted for protein analysis.

Confocal microscopy

The cells were fixed in 4% paraformaldehyde and then blocked with 5% BSA (BioFRoxx, EZ2811A175) for 1 h. The cells were incubated with an anti-KPNA2 antibody overnight, rinsed, and then incubated with a Cy3-labeled secondary antibody (Servicebio, GB21403) in the dark. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) (Servicebio, G1012) for 5 min. Fluorescence images were observed under a laser scanning confocal immunofluorescence microscope (ZEISS, LSM800).

Mass spectrometry (MS) and data analysis

After reduction with 10 mM DL-dithiothreitol (DTT) at 56°C for 1 h and alkylation with 50 mM iodoacetamide at room temperature in the dark for 40 min, the protein solution was added with trypsin and then incubated at 37°C overnight. Salt was removed from the samples using home-made C18 tips. The extracted peptides were lyophilized to near dryness. All samples were analyzed using nanoflow UPLC (Ultimate 3000 system, ThermoFisher Scientific). Briefly, all samples were reconstituted in 5–10 μL of the mobile phase (0.1% formic acid). A nanocolumn was packed with reversed-phase ReproSil-Pur C18-AQ resin (1.9 µm, 100 Å, Dr. Maisch GmbH, Germany). After equilibrating the column, each sample was loaded onto the column via a sampler. A gradient was formed, and the peptides were eluted with increasing concentrations of solvent B (80% acetonitrile and 0.1% formic acid).

The raw MS files were analyzed and searched against the target protein database based on the sample species using MaxQuant (1.6.2.10). Additionally, the detected peptides and proteins were subjected to protein–protein interaction scoring with mass spectrometry interaction statistics (MiST). Protein interactions with MiST scores ≥0.7 and average spectral counts ≥3 were selected for further analyses. A PEDV-host protein interaction network was generated using Cytoscape (www.cytoscape.org). The binding partners of PEDV viral proteins were analyzed using STRING (http://string-db.org), with a confidence score of 0.4. Gene Ontology analysis was performed using DAVID 6.8 Beta (http://david-d.ncifcrf.org).

Statistical analysis

SPSS software (SPSS 21.0) was used for statistical analyses. Data are expressed as the mean ± standard error. The significance level was set to P < 0.05.

RESULTS

PEDV-host interactome identified KPNA2 as a restriction factor for PEDV

To fully understand the roles of viral structural proteins during the PEDV life cycle, we overexpressed each structural protein carrying the N-terminal 3 × HA epitope in Vero cells (Fig. 1A), purified each structural protein complex via co-IP, and analyzed the co-purified cellular proteins using MS in three independent biological repeats (Fig. 1B). We identified 87 host targets using the MiST algorithm (27, 28) and used them to generate an interactome map with Cytoscape software. Notably, cell type-specific PEDV viral protein targets exist in Vero (25) and IPEC-J2 (26) cell lines. Similarly, our PEDV-host interactome shares only two (EIF3L and DECR1) and one (SRSF1) common binding partners with two reports, respectively. Firstly, host proteins interacting with PEDV structural proteins S, M, N, and E were analyzed by cluster heat map and network interaction map (Fig. 1C through J). The host proteins interacting with viral proteins were enriched by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway; the host cellular pathways that are likely affected by PEDV are the spliceosome, RNA transport, RNA degradation, DNA replication, cell cycle, and nonhomologous end joining (Fig. 1K through N).

Fig 1.

PEDV-host interactome network identified KPNA2 as a restrictor factor for PEDV in Vero cells. (A) Western blotting of HA tag demonstrates the expression of each bait in input samples, as indicated by red arrowhead. (B) A flowchart to illustrate the whole IP-MS process. (C–F) Clustering heat map analysis of PEDV proteins and interacting host proteins. (G–J) Overview of PEDV-host interactome. Viral structural proteins (baits) are shown in pink, and candidate interacting proteins are shown in yellow. The node sizes are determined by peptide numbers from mass spectrometry. (K–N) The main pathways of candidate host proteins interacting with PEDV S, N, M, and E proteins.

Validation of interaction between E protein and KPNA2

Using the PEDV-host interactome, we found that KPNA2 was enriched in Vero cells during PEDV infection, covering more than 19.7% of the KPNA2 amino acid sequence (Table S1). We transfected the HA-tagged E protein from PEDV with a plasmid encoding Flag-KPNA2 into HEK293T cells and then performed a co-IP analysis. Results showed that the E protein efficiently coimmunoprecipitated with KPNA2 via a mAb directed against the HA protein (Fig. 2A through F). Interestingly, E protein expression was downregulated in the KPNA2 overexpression group. But other control viral proteins, such as N protein, are not degraded by KPNA2. We then investigated the colocalization of the KPNA2 and PEDV E proteins using confocal microscopy. Vero and IEC cells were co-transfected with plasmids encoding enhanced green fluorescent protein E and Flag-KPNA2. Confocal immunofluorescence assay results showed that the KPNA2 and E proteins were colocalized in the cytoplasm (Fig. 2G and H). HA-E and KPNA2 plasmids were transfected into PEDV-infected cells for protein overexpression, and the localization of E and KPNA2 proteins was detected by confocal microscopy. After PEDV was infected with IEC cells, endogenous N and KPNA2 antibodies were used to detect the expression locations of these two proteins (Fig. 2I). The results show that after infection with PEDV, endogenous KPNA2 in the nucleus passes from the nucleus to the cytoplasm and colocalizes with E protein. In summary, these data demonstrated that KPNA2 coimmunoprecipitated with the PEDV E protein and promoted its degradation.

Fig 2.

Interaction of E protein and KPNA2. Co-immunoprecipitation of HA-E and Flag-KPNA2 in Vero (A, B) and IEC (D, E) cells. (C, F) Vero and IEC cells were transfected with plasmids encoding HA-N and Flag-KPNA2. (G, H) Vero and IEC cells were transfected with plasmids encoding HA-N and Flag-KPNA2 for 48 h. (I) Endogenous antibodies of N and KPNA2 were used to detect their location in PEDV-infected IEC cells. Cell nuclei were labeled with DAPI, and the fluorescent signals were observed with confocal immunofluorescence microscopy. Experiments were performed in triplicate.

KPNA2 inhibits PEDV replication

Additionally, Vero and IEC cells were infected with PEDV. Western blotting and RT-qPCR results showed that the protein and mRNA levels of KPNA2 were upregulated in the Vero and IEC cells compared with the uninfected cells (Fig. 3A through D). These results indicate that KPNA2 expression was upregulated by PEDV infection. The degradation of KPNA2 is induced by Zika virus through autophagy (19). In the present study, protein-protein interactions were further validated to confirm the molecular mechanisms underlying KPNA2 and PEDV replication. First, we examined the activity of cells overexpressing KPNA2, the transfected cells were investigated using CCK8 cell activity assay kit, and the results showed that overexpression of KPNA2 had no significant effect on Vero and IEC cells activity (Fig. 3E). To investigate whether KPNA2 inhibits PEDV replication, KPNA2 was overexpressed in Vero and IEC cells (Fig. 3 F through I) and inoculated with PEDV at an MOI of 0.1. As shown in Fig. 3J and L, KPNA2 overexpression inhibited PEDV replication compared with the control vector, which was proven by the levels of viral N protein in the PEDV-infected Vero and IEC cells. Furthermore, 50% tissue culture infectious dose (TCID50) assay results demonstrated that the viral titers were significantly lower in the Vero and IEC cells transfected with KPNA2 than in the cells transfected with the control vector (Fig. 3K and M). Overall, these results indicated that KPNA2 participated in the inhibition of PEDV replication.

Fig 3.

KPNA2 inhibits PEDV replication. Infection of Vero (A, B) and IEC (C, D) cells with incremental PEDV inoculum upregulates KPNA2 in a dose-dependent manner. (E) Determination of cell viability. Vero (F, G) and IEC (H, I) cells transfected with vector and KPNA2, cells lysates were harvested and subjected to Western blotting and RT-qPCR analyses. KPNA2 and vector plasmids were transfected into Vero (J, K) and IEC (L, M) cells. Following this, cells were infected with PEDV (MOI of 0.1) at 24 h post-transfection. PEDV replication was studied based on Western blotting and virus titers. Each datum represents the results of three independent experiments (mean ± SD, n = 3). The data were compared using Student’s t-tests, with **P < 0.01, ***P < 0.001, and ****P < 0.0001 indicating statistically significant differences.

Knockdown of endogenous KPNA2 enhances PEDV replication

To further investigate the role of KPNA2 in PEDV replication, we knocked down endogenous KPNA2 by transfecting Vero and IEC cells with three synthesized KPNA2-specific siRNA duplexes (siRNAs #1–#3) for 48 h. Results showed that the KPNA2 mRNA and protein levels were significantly downregulated in the Vero and IEC cells transfected with siRNA #2 compared with the cells transfected with small interfering RNA negative control (siNC) (Fig. 4A, B, F, and G). Therefore, siRNA #2 was selected for interference experiments. The cells transfected with siRNA #2 were infected with PEDV, and viral replication was detected using various methods. As shown in Fig. 4C, D, H, and I, the PEDV N protein and mRNA levels were higher in the KPNA2 knockdown group than in the siNC group. Moreover, TCID50 assay results demonstrated that the titers of progeny virus increased following KPNA2 knockdown (Fig. 4E and J). Collectively, these data demonstrate that KPNA2 knockdown promoted PEDV replication in Vero and IEC cells.

Fig 4.

Inhibition of KPNA2 promotes PEDV replication. Vero (A, B) and IEC (F, G) cells were transfected with siNC and siKPNA2, cells lysates were harvested and subjected to Western blotting and RT-qPCR analyses to determine the protein and mRNA levels of KPNA2, respectively. siNC and siKPNA2 were transfected into Vero (C–E) and IEC (H–J) cells. Following this, cells were infected with PEDV (MOI of 0.1) at 24 h post-transfection; (C and H) levels of PEDV genomic RNA (PEDV gRNA) were determined by RT-qPCR. (D and I) PEDV replication was studied using Western blotting. (E and J) Virus titers in the culture supernatants were determined and expressed in the unit of log TCID₅₀/mL. Each datum represents the results of three independent experiments (mean ± SD, n = 3). The data were compared using Student’s t-tests, with ****P < 0.0001 indicating statistically significant differences.

KPNA2 promotes autophagy induced by PEDV infection

Intracellular protein degradation is mediated by the ubiquitin-proteasome system and autolysosome pathways in eukaryotes. To explore whether autophagy was induced by PEDV infection, we co-transfected plasmids encoding Flag-KPNA2 and HA-E found that the co-expression of KPNA2 and E proteins in Vero cells increased the conversion of LC3-I to LC3-II and the formation of autophagic vacuoles. Meanwhile, we measured the levels of Bclin1, P62, and LC3 (microtubule-associated protein 1 light chain 3), all of which are hallmarks of autophagy, in the PEDV-infected cells. Results showed that the expression of the LC3-II protein was significantly higher in the PEDV-infected Vero cells, and the ratio of LC3-II to LC3-I increased in the PEDV-infected cells with KPNA2 overexpression (Fig. 5A). The opposite effect on viral replication was observed in the PEDV-infected Vero and IEC cells with KPNA2 knockdown (Fig. 5B and C). This result indicated that KPNA2 increased the levels of autophagy in cells expressing E protein. Therefore, to identify the system that predominantly mediates the KPNA2-induced degradation of the PEDV E protein, we analyzed whether the degradation of E protein was mediated by the ubiquitin-proteasome system. The results showed that the degradation of E protein was not mediated by the ubiquitin-proteasome system (Fig. 5D). After KPNA2 plasmid was transfected into PEDV-infected cells and the protein was overexpressed, the formation of autophagy vacuoles in infected cells was increased by transmission electron microscopy and confocal microscopy (Fig. 5E through G). Together, these results indicate that KPNA2 degrades the PEDV E protein via autophagy.

Fig 5.

KPNA2 promotes autophagy induced by PEDV infection.Vero (A, B) and IEC (C) cells were transfected, and cell lysates were harvested and subjected to western blotting to determine the protein levels of Bclin1, LC3, P62, EIF2A, and pEIF2A. (D) E protein ubiquitination was analyzed in Vero cells transfected with KPNA2 or vector. (E) Electron microscopy shows the ultrastructures of autophagosome and autolysosome vesicles in Vero and IEC cells. (F) RFP-GFP-LC3 distribution in Vero cells transfected with RFP-GFP-LC3 and KPNA2 or vector was analyzed via confocal microscopy. (G) After infecting IEC cells with PEDV, the effect of KPNA2 overexpression on the formation of autophagy vesicles was examined. Each datum represents the results of three independent experiments (mean ± SD, n = 3). The data were compared using Student’s t-tests, with ***P < 0.001 indicating statistically significant differences.

KPNA2 promotes PEDV E protein degradation by autophagy

HA-E and KPNA2 plasmids were co-transfected into Vero and IEC cells, and the expression and mRNA levels of HA-E, KPNA2, and PEDV N proteins were detected by Western blot and RT-qPCR. The result shows that the protein expression and mRNA levels of E were down-regulated after KPNA2 overexpression, while the protein expression and mRNA levels of PEDV N were unchanged after KPNA2 overexpression (Fig. 6A through D). After the cells co-transfected with HA-E and KPNA2 were treated with autophagy activator MG132 and autophagy inhibitors CQ, respectively, the expression levels of HA-E, KPNA2, and PEDV N proteins were detected by Western blot. The results showed that the expression level of E protein in MG132 treatment group was decreased, the expression level of E protein in CQ treatment groups was restored, and the expression level of N protein in PEDV was not significantly changed (Fig. 6E). At the same time, KPNA2 overexpression can increase the expression level of ATG5 autophagy marker protein (Fig. 6F). The degradation of E protein by KPNA2 was reversed by interfering ATG5 with siRNA (Fig. 6G through I). Moreover, the replication level of PEDV can be increased (Fig. 6J).

Fig 6.

KPNA2 promotes the autophagic degradation of PEDV E protein. Vero (A and B) and IEC (C and D) cells were transfected, and cell lysates were harvested and subjected to Western blotting to determine the protein levels of KPNA2, E, and N. (E) IEC cells transfected with Flag-KPNA2 and HA-E were treated with MG132 and CQ, respectively, to detect protein expression levels. (F) The protein expression level of ATG5 in PEDV-infected IEC cells transfected with Flag-KPNA2 was detected. (G–J) The expression level of E protein and virus titer were detected after siRNA interference with ATG5 in PEDV-infected IEC cells. Each datum represents the results of three independent experiments (mean ± SD, n = 3). The data were compared using Student’s t-tests, with **P < 0.01, ***P < 0.001, and ****P < 0.0001 indicating statistically significant differences.

DISCUSSION

Viruses depend on host cell components for efficient replication; thus, some host factors can inhibit this process. Over the years of co-evolution between viruses and their respective hosts, various strategies that promote viral replication or antagonize host antiviral responses have been demonstrated (29–31). These strategies include the induction of cell cycle arrest at the S phase through PEDV N protein and P53 interaction (32), negative regulation of innate immunity (33, 34), induction of autophagy by PEDV nsp6 (35), and promotion of viral replication. The PEDV E protein acts as an interferon (IFN)-β antagonist to inhibit RIG-I-mediated signaling (36), and miR-129a-3p targets the ectodysplasin A (EDA)-induced NF-kappa pathway to inhibit viral replication (37). By analyzing PEDV E protein mass spectrum data in Vero cells, it was found that most of the host proteins interacting with E protein had antiviral effects, among which RPL11 inhibited the replication of Zika virus (ZIKV), HIV, and hepatitis B virus (HBV) (38–40), PDIA4 inhibited the replication of HIV (41), influenza A and B viruses, and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (42, 43), ALYREF inhibited the replication of herpesvirus (44), TPM1 inhibited the replication of dengue virus (45), PDIA6 inhibited the replication of encephalitis virus (46), SRSF1 inhibited the replication of HIV (47), C1QBP inhibited the replication of porcine circovirus (48), DCTN1 inhibited the replication of HIV (49), PRPF8 can induce apoptosis, necroptosis, and the induction of the interferon response pathway (50). In the present study, we investigated the roles of KPNA2 overexpression and knockdown in the PEDV-infected cells in vitro. KPNA2 upregulation inhibited PEDV replication and promoted PEDV E protein degradation through autophagy. This study presents novel KPNA2-mediated viral restriction mechanisms, suggesting that KPNA2 may serve as a target in developing strategies to control PEDV infection.

KPNA2 is an adverse prognostic biomarker in various cancers, including breast (51), hepatocellular (52), colorectal (53), and ovarian (54) carcinomas (52). In addition, it is an important nucleocytoplasmic transporter that activates the antiviral response to regulate the transport of innate immune regulatory cargo to the nucleus in multiple types of virus-infected cells. For example, African swine fever virus dysregulates type I interferon by interrupting the interaction between importin α and NK-kapa B (10) and Japanese encephalitis virus ns5 dysregulates type I interferon to block the nuclear translocation of IFN regulatory factor 3 and NF-kappa B (55), triggering an antiviral response. Importin KPNA2 interacts with the capsid protein to confer the nuclear import of the HIV-1 pre-integration complex, which is a potential target for HIV-1 infection (56). KPNA2 is upregulated by the inhibition of mir302c in enterovirus 71-infected cells (57). In the present study, KPNA2 was significantly upregulated by PEDV infection in Vero cells, which consequently inhibited viral replication (Fig. 3). By contrast, KPNA2 knockdown promoted viral replication (Fig. 4).

Autophagy plays an important role in the maintenance of intracellular homeostasis by degrading damaged organelles and misfolded or long-lived proteins. Previous studies indicated that autophagy exerts different effects on virus-infected cells (21). On the one hand, autophagy activation induced by PEDV infection promotes virus replication in cells. On the other hand, viral infection can activate autophagy, which consequently suppresses viral replication. For example, PEDV infection upregulates BST2 expression and then promotes the recruitment of E3 ubiquitin ligase membrane-associated ring-CH-type finger 8 to catalyze the ubiquitination of the PEDV N protein, causing calcium binding and coiled-coil domain 2 to transport the N protein to the autophagosome pathway (23). Downregulation of Asp-Glu-Ala-Asp (DEAD)-box polypeptide 6 expression mediates autophagy and inhibits ER stress in cells during PEDV infection (58). Recent studies have reported that KPNA2 contributes to autophagy in various cell types. For example, Lin et al. demonstrated that downregulation of KPNA2 expression suppresses p53 nuclear translocation and inhibits autophagy (59). Moreover, MIR517C downregulates KPNA2 expression, leading to decreased autophagy owing to the disruption of TP53 nuclear translocation (60). Consistent with these findings, KPNA2 overexpression significantly promoted autophagy (Fig. 5).

In conclusion, our results demonstrate that PEDV infection upregulates KPNA2 expression. Mechanistically, KPNA2 binds to and degrades the PEDV E protein via autophagy to suppress PEDV replication. These results suggest that KPNA2 plays an antiviral role against PEDV. Our data provides novel KPNA2-mediated viral restriction mechanisms in which KPNA2 suppresses PEDV replication by targeting and degrading the viral E protein through autophagy, suggesting KPNA2 may serve as a target in developing strategies to control PEDV infection.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/jvi.00115-23.

Table S1. jvi.00115-23-s0001.docx.

Mass spectrometry data and PEDV-host protein interactomes in Vero cells.

Dataset S1. jvi.00115-23-s0002.xls.

Complete mass spectrometry data.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.