Skip to main content
Toxicology Research logoLink to Toxicology Research
. 2023 Oct 19;12(6):1063–1076. doi: 10.1093/toxres/tfad097

The elderberry diet protection against intrahippocampal Aβ-induced memory dysfunction; the abrogated apoptosis and neuroinflammation

Hadiseh Jahanbakhshi 1,#, Meysam Hassani Moghaddam 2,#, Mojtaba Sani 3, Siavash Parvardeh 4, Mahdi Eskandarian Boroujeni 5, Kimia Vakili 6, Mobina Fathi 7, Helia Azimi 8, Maryam Mehranpour 9, Mohammad-Amin Abdollahifar 10, Shiva Ghafghazi 11, Maryam Sadidi 12, Abbas Aliaghaei 13,14,✉, Amir-Hossein Bayat 15, Ali Asghar Peyvandi 16
PMCID: PMC10734613  PMID: 38145093

Abstract

This study evaluates whether elderberry (EB) effectively decreases the inflammation and oxidative stress in the brain cells to reduce Aβ toxicity. In the Aβ + EB group, EB powder was added to rats’ routine diet for eight consecutive weeks. Then, spatial memory, working memory, and long-term memory, were measured using the Morris water maze, T-maze, and passive avoidance test. Also, in this investigation immunohistopathology, distribution of hippocampal cells, and gene expression was carried out. Voronoi tessellation method was used to estimate the spatial distribution of the cells in the hippocampus. In addition to improving the memory functions of rats with Aβ toxicity, a reduction in astrogliosis and astrocytes process length and the number of branches and intersections distal to the soma was observed in their hippocampus compared to the control group. Further analysis indicated that the EB diet decreased the caspase-3 expression in the hippocampus of rats with Aβ toxicity. Also, EB protected hippocampal pyramidal neurons against Aβ toxicity and improved the spatial distribution of the hippocampal neurons. Moreover, EB decreased the expression of inflammatory and apoptotic genes. Overall, our study suggest that EB can be considered a potent modifier of astrocytes’ reactivation and inflammatory responses.

Keywords: apoptosis, oxidative stress, pyramidal neurons, hippocampus, astrocyte, inflammation

Introduction

Research on bioactive substances found in food has grown significantly in these recent years. Numerous compounds that impact how well the human body functions can be found in plants.1 Elderberry (EB), also known as Sambucus L., is one of the lesser-known sources of bioactive chemicals that can be used as a treatment or preventative substance for a variety of illnesses. Elderberry composition is influenced by many variables, including variety, degree of ripeness, and environmental and climatic circumstances.2 Globally, the genus Sambucus L. has 20–25 species, however in Iran, just one species, Sambucus ebulus, has been identified. It is located in three northern provinces near the Caspian Sea (Golestan, Guillan, and Mazandaran province).3 Elderberry has 2.4% protein in the blossoms, 2.9% in the fruits, and 3.3% in the leaves, making it a high source of protein. Fruits, leaves, and flowers contain free or conjugated amino acids. The protein in elderberries is a considered to be complex; of the sixteen amino acids that exist in fruits, seven are exogenous (the human body cannot produce them, so they must be supplied with a daily diet) and the other type, relative exogenous (can be produced by the body from other amino acids); nine amino acids are found in the flowers and leaves. The nutritional protein value of elderberries4,5 has been measured by chemical score of a protein (CS) to be 0.9, taking into account the amino acid composition of elderberries.6

There is substantial evidence that eating berry fruits can positively affect health.7–9 Sambucus species, also known as elderberries, are widely farmed in North America, Europe, North Africa, and Asia. The berries and blossoms have long been employed in traditional folk medicine.10,11 The berries include a wide range of flavonoids, anthocyanins (ANT), and other polyphenols; these bioactive substances may be involved in stress signaling pathways and/or upregulate endogenous defense mechanisms.11–13

It has been suggested that anthocyanins may reduce the symptoms of a number of neurodegenerative diseases. By modifying the permeability of blood–brain barrier (BBB) and permitting the passage of pro-inflammatory mediators and peripheral immune cells, neuroinflammation can predispose the subjects to Alzheimer’s disease.14 Anthocyanins are thought to affect the production of pro-inflammatory cytokines and chemokines, as well as inflammatory signaling cascades.15 Release of these pro-inflammatory cytokines causes neuroinflammation, while neurotoxic substances stimulate glia and cause neurodegeneration. Neuroinflammation is exacerbated by damaged and dying neurons, which also lead to an increase in cytokine production.16 Additionally, a compromised mitochondrial redox chain produces high levels of reactive oxygen species (ROS) at the level of complex I (NADH: ubiquinone oxidoreductase), leading to oxidative stress and changes in cell signaling, finally exacerbating the neuroinflammation.17 It also disrupts the typical pattern of fluctuations in mitochondrial membrane potential (ΔΨm), which has an effect on calcium homeostasis, cell death mechanisms, and ATP synthesis.18 Thus, we have highlighted elderberry’s (the Iranian native species: S. ebulus) neuroprotective capabilities and its further impact on memory by evaluating its anti-inflammatory and anti-apoptotic properties.

Materials and methods

Materials

Amyloid beta (1–42) (Aβ1-42) (171,596) was purchased from Sigma Aldrich (St. Louis, Mo, USA). Antibodies against the glial fibrillary acidic protein (GFAP) (ab7260, 1:500), caspase-3 (EPR18297, 1:300) mouse, rabbit-specific HRP/DAB kit (ab64264), and secondary antibody conjugated FITC (ab6717) were obtained from ABCAM (Cambridge, Massachusetts).

Injection of β-amyloid and treatment

In this study, 36 adult male rats (Sprague-Dawley, 200–220 g) were obtained from the Laboratory Animal Center of our university. The University Ethics Committee approved this animal experiment. Four rats were housed per cage at 22 °C, under a 12 h light/dark cycle with ad libitum access to water and food. The Sprague-Dawley rats were anesthetized using ketamine and xylazine (100 and 2.5 mg/kg, respectively), and their skull was fixed in a stereotaxic device. A longitudinal incision was made along the sagittal line on the scalp. Aβ1–42 was prepared freshly and administered with a Hamilton microsyringe. Two micrograms of the Aβ1–42 solution in 4 μl PBS were administered over 2 min into the dorsal hippocampus bilaterally at coordinates 3.6 mm posterior and ± 2 mm lateral to bregma, and 3.2 mm ventral to the skull surface.19 The needle remained in position for an additional 2 min after injection. The needle was then slowly removed from the brain, and the scalp was sutured. The animals were returned to their cages to recover.20

Treatment by EB diet

The EB fruits were harvested from west of the country and frozen in zippered plastic freezer bags. The berries were then de-stemmed and cleaned, lyophilized, and ground into a fine powder before adding to diets. In this study, rats were divided into three experimental groups: (a) control group with a control diet (n = 12), (b) Aβ group with a control diet (n = 12), (c) Aβ + EB group with an oral diet containing 2% EB for 8 consecutive weeks (n = 12).

Morris water maze test

In order to evaluate the reference memory through a spatial search strategy, the Morris water maze test was performed seven weeks after the administration of the EB diet. The Morris water maze consisted of a round tank of water, 120 cm thick and 60 cm high, filled with water (25 ± 0.5 °C) to a depth of 40 cm. The tank was divided into four equal imaginary quadrants and four positions for starting (N: north, W: west, S: south, E: east). A circular platform (diameter: 12 cm) was installed into the water tank in the center of the NW quadrant (target quadrant), 1.5 cm below the water surface. Non-fat dry milk was used to make the water opaque. The rats were given four training trials each day for three consecutive days. In each trial, the rats were randomly placed into the water maze at one of starting positions of N, S, E, or W, facing the wall of the tank.

Once the rats reached the platform, the training trial was over. Otherwise, the animals were allowed to swim/search for the platform for a maximum of 60 s. The rats were gently guided to the platform if they failed to reach the platform within 60 s. In either case, the experimenter allowed the rats to stay on the platform for 30 s. The inter-trial interval was at least 10–15 min. After completing four trials for three consecutive days, they were given one probe trial on the fourth day, in which the platform was removed from the tank. The swimming paths of the rats were monitored by an infrared camera linked to a tracking system. The swimming time to find the platform (escape latency) was recorded for each training trial. For the probe trial, time spent in the target quadrant, distance traveled in the target quadrant, the number of crossings over the platform location, average proximity to the platform location, and average speed were recorded and analyzed. In addition, the average speeds of animals each day were compared between different groups. Also, a trial-by-trial comparison of escape latency was carried out on Day 1. At the end of the trials, the animals were dried using a clean towel and placed under a heating lamp in a holding cage before they were returned to their home cages.21

Passive avoidance apparatus

A system consisting of a two-compartment box was used for passive avoidance training (Shuttle box) to evaluate long-term memory. The irradiated chamber (35 × 20 × 15 cm3) made of transparent plastic was linked using an 8 × 8 cm2 guillotine. Baseline evaluations were made for rats on day 0. Initially, all groups were habituated to the system. The rat was located in the irradiated zone, and the guillotine door was raised after 5 s. The rat was taken from the dark zone into the home cage as soon as entering the dark zone. After 30 min, the habituation test was repeated and proceeded with the same interval by the acquisition test in the closed-door guillotine and applying a 50 Hz, 1.2 mA constant current shock for 1.5 s immediately following the animal’s entrance to the dark zone. The rat was removed from the dark zone and located in the home cage 20 s later. The rats got a foot shock and entered the dark zone another time. The training was stopped when the rat remained in the light zone. Twenty-four hours following training, a retention test was conducted to evaluate long-term memory. Each animal was located in the illuminated chamber for 10 s, the door was opened, and the latency of entering the dark zone (step-through latency (STLa)) and the time spent in the dark compartment/zone (TDC) were recorded, representing the retention performance. The maximum score was 300 s, and no electric shock was applied within these sessions.

Staining with thioflavin T (Th T)

Tissues were incubated for 5 min with ThT solution (0.5% in 0.1 N HCl) after being washed and were observed under fluorescent microscopy (Olympus, IX 71, Japan, blue light filter, objective lens 4×).

Immunohistochemistry

During the first step of the IHC process, rats were deeply anesthetized by 100 mg/kg ketamine and 10 mg/kg xylazine. The rats were then transcardially perfused with chilled saline and fixed by a fixator containing 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS). The brain was then extracted and placed in formalin before being prepared and placed on the slides. Formalin-fixed tissues were embedded in paraffin wax. Three samples were randomly selected in each group. The paraffin-embedded tissue section was normally sliced by a rotary microtome (Thermo Fisher Scientific, Waltham, MA, USA) with a thickness of 6 μm. 8–10 coronal sections were randomly selected in each sample, and five fields were randomly captured at high magnification. The slide was immersed in xylene to remove the paraffin and transferred through a series of diluted alcohols (100%, 95%, 70%, and 50%) to water before staining. Afterwards, antigen retrieval was carried out before immunohistochemistry (0.01 M citrate buffer solution (pH 6.0), 0.01 M PBS buffer (pH 7.0), 0.05 M EDTA (pH 8.0), 0.05 M Tris-EDTA (pH 9.0), and 0.05 M Tris–HCl). Slides were then blocked in 10% normal serum and 1% BSA in TBS for 1 h at room temperature. The primary antibodies were anti-GFAP antibody and anti-caspase-3 diluted in the PBS solution containing 0.3% Triton X-100 and 1% bovine serum albumin (BSA). The sections were incubated in the primary antibodies overnight at 4 °C. The sections were washed 3 times with PBS. They were consequently incubated with secondary antibodies of an avidin-biotin complex substrate in 0.05 M Tris buffer (pH 7.6) containing 0.05% 3,3-diaminobenzidine tetrahydrochloride and 0.03% hydrogen peroxide or secondary fluorescent FITC-conjugated antibody. After the immunohistochemical reaction, the sections were washed 3 times with PBS and were mounted by Mounting Medium for IHC (Abcam. Cambridge, UK), and fluorescence microphotographs were captured by fluorescent microscopy (E200, Nikon, Japan, blue light filter, objective lens 4×). All the steps were performed by a researcher blinded to experimental conditions.

Astrocyte morphology and distribution

Astrocyte cells were stained specifically with GFAP antibody (specific astrocyte marker). Thirty individual GFAP+ cells were selected and captured by the 40× objective lens for reconstruction.22 The figure was imported to ImageJ (Java. NIH, USA). The nucleus of each microglia and astrocyte were marked as the center. Sholl analysis was performed to quantify the total process length based on previous instructions.23,24 To measure the soma size, each image was imported to ImageJ. After setting the image scale with the Wand tools, the border of each soma was selected to determine the nearest neighbor distance (NND). The script for Fiji (ImageJ) developed by Y. Mao25 was used as described in previous studies.26,27 The regularity index (RI) was calculated as follows:

graphic file with name DmEquation1.gif

where Inline graphicis the average NND of a population and Inline graphic is the standard deviation of that population.27,28 To calculate the arbor area, a polygon was drawn manually by connecting the endpoints of the appendages using the ImageJ Polygon tools.26,27

Investigating the spatial distribution of hippocampal neurons

After tissue processing, the 5-μm thick serial coronal sections were prepared and stained with hematoxylin and eosin (H&E). The spatial distribution of neurons in the pyramidal layer of CA1 was investigated using the Voronoi tessellation method. Each polygon represents the space that a cell occupies.29 The neurons were mapped by the ImageJ Voronoi Plugin (Java. NIH, USA). Each polygon was drawn around the cell body of neurons. The brain section images were captured by a 40× objective lens (Nikon Eclipse E-200). Each image was imported to ImageJ after being set to scale by the Voronoi plugin. The polygons were drawn by clicking on the nuclei. The area of the polygon by running analyze → measure was calculated.30,31 The area variation of the polygons was analyzed by calculating the variance. To determine the spatial distribution of neurons, the percentage coefficient of variation (CV) was calculated (standard deviation of the polygon areas/mean × 100). CV of 33%–64% is associated with a random distribution of the neurons; CVs less than 33% have a regular pattern, and those more than 64% are considered as a clustered distribution.32,33

RNA extraction and complementary DNA synthesis

Total RNA was extracted by the High Pure RNA Isolation Kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). Then, 1 μg of total RNA was transcribed to cDNA using murine leukemia virus (MuLV) reverse transcriptase (Fermentas, Lithuania) with random hexamers and RNase inhibitor.

Quantitative real-time PCR

Quantitative real-time PCR (qPCR) was carried out using specific primers for TNFα, IL-1β and caspase-3 genes. GAPDH was also used as the reference gene (Table 1). All PCR reactions were made using SYBR® Premix Ex Taq™ II (Takara Bio, Inc.) on a Rotor- Gene™ 6,000 real-time PCR cycler (Corbett Research, Qiagen, Germany). Initial denaturation was performed at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 5 s under primer-specific conditions and an extension at 60 °C for 20 s. Comparative qPCR quantitation was performed between candidate groups using the Relative Expression Software Tool (REST) 2009 (Qiagen).

Table 1.

PCR primer sequences for the real-time qPCR analysis of selected genes; IL1-β, TNF-α, Caspase-3. GAPDH was used as housekeeping gene.

Primer Name Sequence Annealing Accession Number
IL1-β F:5’GGGAACTGTGCAGACTCAAACTC3’
R: 5’ AAAGAAGAAGATGGAAAAGCGGTT 3’
60 °C × 25 s NM_031512.2
TNF-α F: 5’ ACCACGCTCTTCTGTCTACTG 3′
R: 5’ CTTGGTGGTTTGCTACGAC 3
60 °C × 25 s NM_012675.3
Caspase-3 F: 5’ GGTATTGAGACAGACAGTGG 3′
R: 5’ CATGGGATCTGTTTCTTTGC 3’
55 °C × 25 s NM_012922.2
GAPDH F: 5’ GCCAGTGAGCTTCCCGTTCA 3′
R: 5’ GAACATCATCCCTGCATCCA 3’
60 °C × 25 s NM_017008.4

Data analysis

Results were analyzed using the Graph Pad Prism 8 software (Graph Pad Software Inc., La Jolla, CA, USA). All data are represented as the mean ± SD. Comparison between groups was made by one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test to analyze the difference. The statistical significance was achieved at P < 0.05.

Results

The EB diet improves learning and memory in Aβ1-42 injected rats

The Morris water maze test was performed to examine whether the EB diet improved spatial memory following the injection of Aβ1-42 (Fig. 1a). The animals in the Aβ1-42 group showed a significantly longer escape latency (the mean latency time to find the hidden platform) compared to the control group. However, the administration of the EB diet significantly improved spatial learning during training trials (F(2/567, 69/31) = 6/918, P = 0.0007) (Fig. 1b). Statistical analysis showed that total distance increased in the Aβ1-42 group compared to the control group. However, the total distance decreased in the Aβ + EB group compared to the control group (F(2, 27) = 93/33, P < 0.0001) (Fig. 1c). Our results also showed no significant difference in the swim speed between groups during four days (Fig. 1d). Moreover, the number of crossing over the platform location significantly reduced in the Aβ injected group compared to the control group (F(2, 24) = 3/394, P = 0.0009). There was no significant difference between the numbers of the crossing during four days between the Aβ and Aβ + EB groups (Fig. 1e). In the probe trial on the fourth day, statistical analysis showed no significant difference regarding time spent in the target quadrant between groups (Fig. 1f). We used the T-maze and passive avoidance (shuttle box) tests to measure short-term spatial and long-term memory, respectively. Following the Aβ1-42 injection, the alternation rate decreased compared to the control (F(2, 21) = 17/41, P < 0.0001) (Fig. 2a and b). However, the EB diet increased the alteration rate in Aβ + EB compared to the Aβ group (F(2, 21) = 17/41, P = 0/0011). Moreover, latency increased in the Aβ group compared to the control group (F(2, 21) = 285/0, P < 0.0001). The administration of the EB diet reduced latency in the Aβ + EB group compared to the Aβ group (F(2, 21) = 285/0 P < 0.0001) (Fig. 2c). Two months after the injection of Aβ1-42 into the rat brains, there was a significant difference in time spent in the dark compartment between Aβ-injected rats and the Aβ + EB rats (F(2, 21) = 93/50, P < 0.0001) (Fig. 3a). Moreover, the STLa of the control group was more than the Aβ group (F(2, 21) = 93/50, P < 0.0001) (Fig. 3b). Besides, according to results related to the time spent in the dark compartment and STLa, the difference between the Aβ1-42 group and Aβ + EB group was statistically significant (F(2, 21) = 93/50, P < 0.0001).

Fig. 1.

Fig. 1

Morris water-maze test performances during the spatial exploration task. a) Representative movement traces from all 3 groups on the day of exploration. b) Effect of EB diet on escape latency in Morris water maze test in rats subjected to Aβ toxicity. Administration of EB diet significantly decreased escape latency during training trials. c) Effect of EB diet on total distance travelled in the target quadrant in Morris water maze test in rats subjected to Aβ toxicity. Administration of EB significantly decreased distance moved by rats in target quadrant in probe trial. d) Administration of EB diet did not make any change to the swimming speed of rats in probe trial. e) Administration of EB did not make any change the number of crossings between Aβ + EB group and Aβ group over the platform location in probe trial. f) Effect of EB on time spent in target quadrant in Morris water maze test in rats subjected to Aβ toxicity. (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values are expressed as means (± SD; n = 12).

Fig. 2.

Fig. 2

EB diet improved memory function. T-maze test was performed to evaluate short term spatial memory. Alternation rat a) and latency b). (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values are expressed as means (± SD; n = 12).

Fig. 3.

Fig. 3

Passive avoidance test. a) Administration of EB decreased time spent in dark compartment in Aβ + EB compared to the Aβ group; b) Although STLa decreased in Aβ group compared to the control group, EB reversed it to the control level ((* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values are expressed as means (± SD; n = 12).

EB diet reduces astrogliosis in the hippocampus of Aβ injected rats

Following the injection of Aβ1–42 into the brains, staining with ThT revealed Aβ masses in the hippocampus after two months (Fig. 4). Following the Aβ1-42 injection, IHC was applied to measure the astrocyte marker–GFAP (Fig. 5a). Results showed a surge in the number of GFAP-positive cells in the hippocampus of Aβ group compared to the control group. However, the EB diet reduced the number of GFAP-positive cells in Aβ + EB as opposed to the Aβ group (F(2, 12) = 53/92, P < 0.0001) (Fig. 5b). Moreover, our results showed that NND and regularity index decreased in the Aβ group compared to the control group (F(2, 12) = 6/59, P < 0.0001), while NND and regularity index increased in the Aβ + EB in contrast to the Aβ group (F(2, 12) = 18/20, P < 0.001) (Fig. 5c and d).

Fig. 4.

Fig. 4

Fluorescent image of ThT staining for detection of injected Aβ1–42 in rat hippocampus. Tissues were incubated with 0.5% of ThT solution. Aggregation of Aβ1–42 showed by white triangles.

Fig. 5.

Fig. 5

Specific staining was used to show and analysis astrocytes and any astrogliosis in subjects’ hippocampus. a) Immunohistochemical staining for astrocyte marker (GFAP). b) GFAP positive cells counting were done to compare the groups. c) EB diet increased the NND. d) Regularity index increased in Aβ + EB. (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values were expressed as means ± SD.

EB diet prevented astrocyte reactivity in the hippocampus of Aβ injected rats

The Sholl analysis showed that injection of Aβ significantly reduced the complexity of astrocytes compared to the control group. However, the EB diet increased the complexity of astrocytes in Aβ + EB compared to the Aβ group (P < 0.001) (Fig. 6a). Moreover, the EB diet reduced the soma size of astrocytes in Aβ + EB compared to the Aβ group (F(2, 87) = 140/4, P < 0.001) (Fig. 6b). Our results showed that the total astrocyte process length (F(2, 87) = 199/8, P < 0.0001), astrocyte arbors area (F(2, 87) = 115/9, P < 0.0001), and the total number of branches (F(2, 87) = 44/68, P < 0.0001) were reduced in the Aβ group compared to the control group (Fig. 6c–e). The EB diet increased the total astrocyte process length (F(2, 87) = 199/8, P < 0.0001), astrocyte arbors area (F(2, 87) = 115/9, P < 0.0001), and the total number of branches (F(2, 87) = 44/68, P < 0.0001) in Aβ + EB compared to the Aβ group. However, the percentage of the primary branch of astrocytes in the control group, Aβ group, and Aβ + EB group were 60.6%, 72.9%, and 46.4%, respectively. The percentage of the secondary branch of astrocytes in the control, Aβ, and Aβ + EB groups were 32.7%, 24%, and 35.2%, respectively. The tertiary arbores of astrocytes in the control, Aβ, and Aβ + EB groups were 6.7%, 3.1%, and 18.4%, respectively (Fig. 6f).

Fig. 6.

Fig. 6

Sholl analysis findings. a) The injection of Aβ reduced the complexity of astrocyte processes while the EB diet prevented it. b) Astrocyte soma size reduced in Aβ + EB group compared to the Aβ one. c) EB diet increased the total astrocyte process length compared to the Aβ group. d) Administration of EB diet increased astrocyte arbors area. e) Total number of branches was increased in Aβ + EB. f) Percentage of primary, secondary and tertiary arbors of astrocyte in subjects. ((* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values were expressed as means ± SD.

The administration of the EB diet reduces apoptosis in the hippocampus of Aβ injected rats

Following Aβ injection, IHC was applied to measure the apoptosis factor of caspase-3 (Fig. 7a). Results showed a surge in the expression of caspase-3 in the Aβ injected group in comparison to the control group (F(2, 87) = 44/68, P < 0.0001). However, the EB diet reduced the expression of caspase-3 in the Aβ + EB group as opposed to the Aβ group (F(2, 87) = 44/68, P < 0.0001) (Fig. 7b).

Fig. 7.

Fig. 7

Immunohistochemistry against caspase-3 was carried out in various groups. b) The analysis showed that the administration of EB in the Aβ injected rats decreased the expression of casapase-3 in the hippocampus. (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001*P < 0.05; **P < 0.01; ***P < 0.001). The values are expressed as mean ± SD (n = 5).

EB diet protected hippocampal neurons against Aβ toxicity

Stereological analysis showed that the number of pyramidal hippocampus neurons decreased significantly in the Aβ group compared to the control group (F(2, 21) = 35/89, P < 0.0001). Our results demonstrated that the number of pyramidal neurons was protected in the Aβ + EB as opposed to the Aβ group (F(2, 21) = 35/89, P < 0.0001) (Fig. 8a and b). In this study, we showed that the mean number of dark neurons increased in the hippocampus of Aβ injected group compared to the control group (F(2, 21) = 84/93, P < 0.0001). Administration of the EB diet decreased the mean number of dark neurons in the Aβ + EB group compared to the Aβ group (F(2, 21) = 84/93, P < 0.0001) (Fig. 8c).

Fig. 8.

Fig. 8

The estimation of the number of hippocampal neurons. b) The effects of the EB diet on the number of the neurons c) and dark neurons. As shown in the graphs, although EB diet significantly improved the number of the neurons and it was failed to increase the number of dark neurons. (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values were expressed as means ± SD.

EB diet improved the spatial distribution of hippocampal neurons in the Aβ injected rats

Voronoi tessellation of the CA1 neurons (pyramidal layer) in the control and Aβ groups were performed (Fig. 9a). Examination of the pyramidal layer in the control group showed that 67.65% of polygon areas of the neurons were in the range of 110–150 μm2 while in the Aβ group, 20.33% of polygon areas of the neurons were in the 350–390 μm2 range. Finally, in the Aβ + EB group, 20.18% of polygon areas of the neurons were in the range of 110–150 μm2 (Fig. 9b). Based on the (CV) classification, the mean CV of polygon areas in all groups ranged from 33% to 64%. This is while it significantly increased in the Aβ group, indicating the more regular distribution of neurons in the pyramidal layer in this group than in other groups (F (2, 21) = 52/21, P < 0.001) (Fig. 9c).

Fig. 9.

Fig. 9

Voronoi analysis. a) A micrograph of cells and schematic of Voronoi tessellation in the hippocampus of study groups. b) Mean ± standard deviation of Voronoi polygon area (%) and c) coefficient of variation (CV) within the pyramidal layer of hippocampus. (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P < 0.01; ***P < 0.001). The values were expressed as means ± SD.

EB diet diminished the expression of inflammatory cytokines and apoptosis genes in the Aβ injected rats

The expression levels of genes related to inflammatory cytokines (TNF-α, IL-1β) and apoptotic markers (caspase-3) were determined in the hippocampus. The real-time qPCR results displayed that the upregulation of TNF-α (F(2, 12) = 56/97, P < 0.001), IL-1β (F(2, 12) = 68/49, P < 0.001) and caspase-3 (F(2, 12) = 172/7, P < 0.001) in the hippocampus was higher in the Aβ group in comparison to the control (P < 0.001) (Fig. 10). However, the expression level of TNF-α (F(2, 12) = 56/97, P < 0.001), IL-1β (F(2, 12) = 68/49, P < 0.001) and caspase-3 (F(2, 12) = 172/7, P < 0.001) dropped noticeably in the Aβ + EB group compared to the Aβ group (Fig. 10).

Fig. 10.

Fig. 10

Real-time qPCR data showed that the expression level of inflammatory cytokines including TNF-α and IL-1β was significantly increased in Aβ injected group. However, EB diet was decreased the expression of these genes. Furthermore, EB diet substantial decreased mRNA expression of apoptotic marker caspase-3. (* indicates significant difference between control and Aβ groups or Aβ and Aβ + EB groups; *P < 0.05; **P<0.01; ***P<0.001). The values are expressed as means (± SD; n = 3).

Discussion

The abundance of flavonoids and anthocyanins in EB, which have anti-inflammatory and anti-apoptotic qualities, can explain the therapeutic effects of EB. Numerous scientific studies6,34–36 have shown EB’s anti-inflammatory and potential benefits.24 Berries include many anthocyanins, with multiple potential health benefits,37,38 particularly for anti-carcinogenic and cardiovascular functions, owing to their antiviral and anti-inflammatory properties. Berry anthocyanins have been demonstrated in animal models to enhance neuronal and cognitive functions and inhibit age-related increases in oxidative stress.39,40 Studies on this subject41–43 indicate that cyanidin 3-O-glucoside can reduce amyloid-beta-induced memory deficits and protect against ethanol-induced neurodegeneration and cerebral ischemia damage. The Morris Water Maze, which mainly evaluates learning and spatial memory, is a commonly used model for assessing memory and learning behavior in mice.44–46

Our spatial memory analysis, with the help of the Morris Water Maze test, showed that spatial memory decreased in the rats group receiving amyloid beta. After prescribing a diet containing elderberry, the amount of spatial memory improved (Fig. 1). As a short-term spatial memory test and a shuttle box test for assessing long-term memory, the T-maze test showed improvement in the group receiving the elderberry diet (Figs 2 and 3).

Anthocyanins can directly convey their biological effects by passing through the blood-brain barrier (BBB) and entering the central nervous system (CNS). Like in food, they are considered bioavailable in their whole glycosylated form. Early investigations discovered radio-labeled epigallocatechin gallate in the brain, and subsequent research discovered the flavonoids naringenin and hesperetin in the brain after intravenous injection.47,48

It has been offered that anthocyanins from food can be detected in the brain regions linked to cognition, suggesting that these flavonoids could be indirectly beneficial due to their anti-inflammatory properties.49 In the present study, the immunohistochemical analysis of hippocampal tissue demonstrated a decrease in astrogliosis in the group treated with the EB diet (Fig. 5). Even though numerous routes have been hypothesized to underlie the development of AD, still no specific mechanism was identified. Astrocytes are crucial to the CNS’s inflammatory and immunological response. Gonzalez-Reyes et al.50 described alterations in how astrocytes function during AD, identifying astrocytes and Amyloid beta1-42 as responsible for the disruption of gliotransmission, calcium signaling, and neurotransmitter uptake in astrocytes. Astrogliosis occurs as AD progresses because astrocytes are also associated with the expression of apolipoprotein E and the removal and breakdown of amyloid beta1-42.50 NF-kappa B signaling, NADPH oxidase (NOX), intracellular calcium levels, excitatory glutamate absorption, and mitochondrial activity are all impacted by oxidative damage to astrocytes, which results in the production of amyloid beta.50

The components of natural polyphenolic ANT have received considerable attention. Numerous researchers have shown that berries high in cyanidin and their glycoside, ANTs, have been shown to suppress the production of amyloid filaments.51,52 Finding effective, strong antioxidants that can shield brain tissue and astrocytes from oxidative damage is crucial. Dietary fiber, antioxidant ANTs, and phenolic acids, including ferulic acid, caffeic acid, and protocatechuic acid, are all abundant in date-palm fruit. Rats with AD and significant anxiety behaviors displayed a drop in Amyloid-beta after being fed date fruits, reducing AD incidence.53 Numerous berries are abundant in powerful polyphenolic ANTs, which may protect AD via various mechanisms.54–56 For instance, ANTs found in green tea and red raspberries help reverse AD.57,58 In a different investigation, bilberry-fed transgenic AD mice had a significantly lower level of soluble Amyloid beta 40 and Amyloid beta 42 in comparison to transgenic AD mice who were fed blackcurrant.59,60

In our experiment, the Sholl analysis on astrocyte cells showed that in the amyloid beta group, the morphology of astrocyte cells changed, and astrocyte cells were more active (Fig. 6). Since EB contains anthocyanin components, we hypothesize that the changes in the morphology of astrocytes may be reduced in rats given an EB diet and lead them not to alter to active astrocytes. The dynamic plasticity of astrocytes allows their distal processes to appropriately respond to extracellular changes.61 According to our observations, the number of secondary and tertiary arbors of astrocytes seem to decrease in response to Aβ accumulation. However, in group of subjects receiving EB containing diet it increased and became more similar to the control group. This observation, also confirms our prior speculation about the restoration of astrocytic morphology following EB prescription.

Adverse events, including brain damage, ischemia, and exposure to hazardous substances like amyloid plaques or viruses, frequently produce reactive astrocytes under pathological conditions, which have been identified by morphological hypertrophy. Vimentin and glial fibrillary acidic protein (GFAP), two intermediate filament proteins in astrocytes, are increasingly produced in reactive astrocytes.62–64 Reactive astrocytes have been shown to switch on aberrant GABA production to strongly tonic block nearby neurons in the hippocampal dentate gyrus (DG) in animal models of AD, in addition to structural alterations.65,66 In the Amyloid beta overproducing AD model of APP/PS1 mice, monoamine oxidase-b (MAOB), which is mostly expressed in astrocytes, was found to regulate the degradation of putrescine, which is known as a polyamine byproduct of the breakdown of amyloid beta toxin, and the manufacture of GABA.65,67

Our results also revealed that the elderberry diet prevents the death of neurons in the hippocampus, since we detected a significant reduction in the number of dark neurons.

The formation of dark neurons includes unprogrammed prevention of a phase transition between structures—possibly the transition of hyaloplasm from a sol to a gel—and may be reversible (in some physiological states) or irreversible, resulting in cell death via a mechanism other than necrosis and apoptosis.68–70

In this study, the EB diet has been shown to improve spatial arrangement in the rats group receiving EB (Figs 8 and 9). This improvement in the spatial arrangement of neurons can enhance the neuronal spatial arrangement in the brain.

Prior point pattern investigations of the spatial distribution of astrocytes described their repellent distribution based on the determination of the closest distance distribution function.71,72 According to these investigations, contact space exists because neighboring somata are attracted to one another when astrocyte processes are in close proximity.73 Recent investigations showed astrocytes create domains using this cue as a guide.74–77 The variation in the spatial arrangement of neurons in various parts of the brain and neuronal density and volume have developmental, functional, and connectional relevance. This reflects how the neurons were positioned to assemble the brain and create its connectivity.78,79 According to recent research, many illnesses or conditions that affect development may change the spatial distribution of the cells as well as their density.32,80 For instance, cerebral ischemia altered the spatial arrangement of CA1 hippocampal pyramidal neurons, turning it into a random pattern.81

As is well known, the connection and functions of the neurons are influenced by the spatial layout of the neurons.82 Unfortunately, very few studies provide details on how neurons’ density and spatial organization alter following AD.83

Since these alterations could be seen in AD, we hypothesize that EB diet consumption can ameliorate AD symptoms in AD models receiving EB diet. Furthermore, our immunohistochemical staining against the apoptotic marker caspase-3 shows that the amount of apoptosis is reduced in the group treated with the elderberry diet (Fig. 7).

According to the molecular data, an EB diet significantly reduced a 3-NP-induced growth in TNF- α and caspase-3 concentration (Fig. 10). Inhibiting lipopolysaccharides (LPS) or interferon-gamma (IFN γ) allows the EB fruit to reduce inflammation and oxidative stress while reducing the generation of pro-inflammatory mediators, including ROS and nitric oxide (NO).84–86 Due to our real-time analysis results, EB has reduced IL-1β, TNF-α, and caspase-3. It is well known that inflammatory cells can generate different reactive species, leading to oxidative stress.87 Furthermore, some reactive and nitrogen species ROS trigger intracellular signaling cascade, followed by enhanced pro-inflammatory genes.88 Although oxidative stress and inflammation do not have a close relationship, one can result in the other.89 Some studies have demonstrated that EB can promote potential properties by preventing microglial activation, causing a reduction in neuronal cell death.90,91 Altogether, EB can alleviate pro-inflammatory genes and oxidative stress, suppressing the inflammation process.24

The results proved the protective effects of dietary EB against neuronal cell death, spatial arrangement, microglial activation, astrocyte morphology, and memory and learning. This diet can reduce apoptosis, and inflammation in amyloid-beta-induced rat AD models. As a result, this herb may help treat AD symptoms and lower the number of those suffering from these symptoms. Additional studies are required to fully explore EB’s positive effects and molecular processes in individuals with AD and other neurodegenerative illnesses.

Contributor Information

Hadiseh Jahanbakhshi, Hearing Disorders Research Center, Loghman Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Meysam Hassani Moghaddam, Department of Anatomical Sciences, Faculty of Medicine, AJA University of Medical Sciences, Tehran, Iran.

Mojtaba Sani, Department of Educational Neuroscience, Aras International Campus, University of Tabriz, Tabriz, Iran.

Siavash Parvardeh, Department of Pharmacology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Mahdi Eskandarian Boroujeni, Laboratory of Human Molecular Genetics, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznan, Poland.

Kimia Vakili, Student Research Committee, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Mobina Fathi, Student Research Committee, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Helia Azimi, Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Maryam Mehranpour, Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Mohammad-Amin Abdollahifar, Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Shiva Ghafghazi, Department of Pharmacology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Maryam Sadidi, Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Abbas Aliaghaei, Hearing Disorders Research Center, Loghman Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran; Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Amir-Hossein Bayat, Department of Neuroscience, School of Sciences and Advanced Technology in Medicine, Hamadan University of Medical Sciences, Hamadan, Iran.

Ali Asghar Peyvandi, Hearing Disorders Research Center, Loghman Hakim Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

Author contributions

AA and AAP designed and conceived the study, analyzed and interpreted the data, and revised the manuscript for intellectual contents; MS, SP, MEB, MF and KV wrote the manuscript; HA and MM revised the manuscript; MAA, SG, MS and AHB performed the experiments; HJ and MHM had a crucial role in data collection and revised the manuscript and drafted the manuscript for the intellectual content.

 

Conflict of interest statement. The authors have no conflict of interest to declare.

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  • 1. Costa AGV, Garcia-Diaz DF, Jimenez P, Silva PI. Bioactive compounds and health benefits of exotic tropical red–black berries. J Funct Foods. 2013:5(2):539–549. [Google Scholar]
  • 2.Kader A, Barrett D. Classification, composition of fruits, and postharvest maintenance of quality (2nd Edition). Processing Fruits. United Kingdom; 2005, 2p. [Google Scholar]
  • 3. Ebadi AG, Hisoriev H. Review on distribution of Sambucus ebulus L. in the North of Iran. Am Euras J Agric Environ Sci. 2011:10(3):351–353. [Google Scholar]
  • 4. Akbulut M, Ercisli S, Tosun M. Physico-chemical characteristics of some wild grown European elderberry (Sambucus nigra L.) genotypes. Pharmacogn Mag. 2009:5(20):320. [Google Scholar]
  • 5. Kislichenko VS, Vel’ma VV. Amino-acid composition of flowers, leaves, and extract of Sambucus nigra flowers. Chem Nat Compd. 2006:42(1):125–126. [Google Scholar]
  • 6. Sidor A, Gramza-Michałowska A. Advanced research on the antioxidant and health benefit of elderberry (Sambucus nigra) in food–a review. J Funct Foods. 2015:18:941–958. [Google Scholar]
  • 7. Joseph JA, Shukitt-Hale B, Willis LM. Grape juice, berries, and walnuts affect brain aging and behavior. J Nutr. 2009:139(9):1813S–1817S. [DOI] [PubMed] [Google Scholar]
  • 8. Poulose SM, Carey AN, Shukitt-Hale B. Improving brain signaling in aging: could berries be the answer? Expert Rev Neurother. 2012:12(8):887–889. [DOI] [PubMed] [Google Scholar]
  • 9. Seeram NP. Emerging research supporting the positive effects of berries on human health and disease prevention. United States: ACS Publications; 2012. pp. 5685–5686. [DOI] [PubMed] [Google Scholar]
  • 10. Moerman DE. Native american ethnobotany. United States: Timber press; 1998. [Google Scholar]
  • 11. Lee J, Finn CE. Anthocyanins and other polyphenolics in American elderberry (Sambucus canadensis) and European elderberry (S. nigra) cultivars. J Sci Food Agric. 2007:87(14):2665–2675. [DOI] [PubMed] [Google Scholar]
  • 12. Wu X, Gu L, Prior RL, McKay S. Characterization of anthocyanins and proanthocyanidins in some cultivars of Ribes, Aronia, and Sambucus and their antioxidant capacity. J Agric Food Chem. 2004:52(26):7846–7856. [DOI] [PubMed] [Google Scholar]
  • 13. Son TG, Camandola S, Mattson MP. Hormetic dietary phytochemicals. NeuroMolecular Med. 2008:10(4):236–246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Heneka MT, Carson MJ, Khoury JE, Landreth GE, Brosseron F, Feinstein DL, Jacobs AH, Wyss-Coray T, Vitorica J, Ransohoff RM, et al. Neuroinflammation in Alzheimer's disease. Lancet Neurol. 2015:14(4):388–405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Wang W-Y, Tan M-S, Yu J-T, Tan L. Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease. Ann Transl Med. 2015:3(10):136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Banji OJ, Banji D, Makeen HA, Alqahtani SS, Alshahrani S. Neuroinflammation: the role of anthocyanins as neuroprotectants. Curr Neuropharmacol. 2022:20(11):2156–2174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Albensi BC. Dysfunction of mitochondria: implications for Alzheimer's disease. Int Rev Neurobiol. 2019:145:13–27. [DOI] [PubMed] [Google Scholar]
  • 18. Duchen MR. Mitochondria in health and disease: perspectives on a new mitochondrial biology. Mol Asp Med. 2004:25(4):365–451. [DOI] [PubMed] [Google Scholar]
  • 19. Paxinos G, Watson C. The rat brain in stereotaxic coordinates. 6th ed. Amsterdam, Netherlands: Elsevier; 2006. [Google Scholar]
  • 20. Aliaghaei A, Digaleh H, Khodagholi F, Ahmadiani A. Encapsulated choroid plexus epithelial cells actively protect against intrahippocampal aβ-induced long-term memory dysfunction; upregulation of effective neurogenesis with the abrogated apoptosis and neuroinflammation. J Mol Neurosci. 2015:56(3):708–721. [DOI] [PubMed] [Google Scholar]
  • 21. Hosseinzadeh H, Asl MN, Parvardeh S, Tagi Mansouri SM. The effects of carbenoxolone on spatial learning in the Morris water maze task in rats. Med Sci Monit. 2005:11(3):BR88–BR94. [PubMed] [Google Scholar]
  • 22. Langhammer CG, Previtera ML, Sweet ES, Sran SS, Chen M, Firestein BL. Automated Sholl analysis of digitized neuronal morphology at multiple scales: whole cell Sholl analysis versus Sholl analysis of arbor subregions. Cytometry A. 2010:77(12):1160–1168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Boroujeni ME, Simani L, Bluyssen HAR, Samadikhah HR, Zamanlui Benisi S, Hassani S, Akbari Dilmaghani N, Fathi M, Vakili K, Mahmoudiasl GR, et al. Inflammatory response leads to neuronal death in human post-mortem cerebral cortex in patients with COVID-19. ACS Chem Neurosci. 2021:12(12):2143–2150. [DOI] [PubMed] [Google Scholar]
  • 24. Moghaddam MH, Bayat AH, Eskandari N, Abdollahifar MA, Fotouhi F, Forouzannia A, Rafiei R, Hatari S, Seraj A, Shahidi AMEJ, et al. Elderberry diet ameliorates motor function and prevents oxidative stress-induced cell death in rat models of Huntington disease. Brain Res. 2021:1762:147444. [DOI] [PubMed] [Google Scholar]
  • 25. Mao Y. Nearest neighbor distances calculation with ImageJ. 2016.
  • 26. Davis BM, Salinas-Navarro M, Cordeiro MF, Moons L, de Groef L. Characterizing microglia activation: a spatial statistics approach to maximize information extraction. Sci Rep. 2017:7(1):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Davis BM, Salinas-Navarro M, Cordeiro MF, Moons L, De Groef. Characterizing microglia activation: a spatial statistics approach to maximize information extraction. Sci Rep. 2017:7(1):1576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Wäussle H, Grüunert U, Röhrenbeck J. Immunocytochemical staining of AII-amacrine cells in the rat retina with antibodies against parvalbumin. J Comp Neurol. 1993:332(4):407–420. [DOI] [PubMed] [Google Scholar]
  • 29. Torquato S, Haslach H Jr. Random heterogeneous materials: microstructure and macroscopic properties. Appl Mech Rev. 2002:55(4):B62–B63. [Google Scholar]
  • 30. Safaeian N, David T. A computational model of oxygen transport in the cerebrocapillary levels for normal and pathologic brain function. J Cereb Blood Flow Metab. 2013:33(10):1633–1641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Horssen P, van den Wijngaard JPHM, Brandt MJ, Hoefer IE, Spaan JAE, Siebes M. Perfusion territories subtended by penetrating coronary arteries increase in size and decrease in number toward the subendocardium. Am J Physiol Heart Circ Physiol. 2014:306(4):H496–H504. [DOI] [PubMed] [Google Scholar]
  • 32. Duyckaerts C, Godefroy G. Voronoi tessellation to study the numerical density and the spatial distribution of neurones. J Chem Neuroanat. 2000:20(1):83–92. [DOI] [PubMed] [Google Scholar]
  • 33. Bayat A-H, Azimi H, Hassani Moghaddam M, Ebrahimi V, Fathi M, Vakili K, Mahmoudiasl G-R, Forouzesh M, Boroujeni ME, Nariman Z, et al. COVID-19 causes neuronal degeneration and reduces neurogenesis in human hippocampus. Apoptosis. 2022:27(11-12):852–868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Olejnik A, Kowalska K, Olkowicz M, Rychlik J, Juzwa W, Myszka K, Dembczyński R, Białas W. Anti-inflammatory effects of gastrointestinal digested Sambucus nigra L. fruit extract analysed in co-cultured intestinal epithelial cells and lipopolysaccharide-stimulated macrophages. J Funct Foods. 2015:19:649–660. [Google Scholar]
  • 35. Olejnik A, Olkowicz M, Kowalska K, Rychlik J, Dembczyński R, Myszka K, Juzwa W, Białas W, Moyer MP. Gastrointestinal digested Sambucus nigra L. fruit extract protects in vitro cultured human colon cells against oxidative stress. Food Chem. 2016:197:648–657. [DOI] [PubMed] [Google Scholar]
  • 36. Neves D, Valentão P, Bernardo J, Oliveira MC, Ferreira JMG, Pereira DM, Andrade PB, Videira RA. A new insight on elderberry anthocyanins bioactivity: modulation of mitochondrial redox chain functionality and cell redox state. J Funct Foods. 2019:56:145–155. [Google Scholar]
  • 37. Kolb B, Cioe J. Recovery from early cortical damage in rats, VIII. Earlier may be worse: behavioural dysfunction and abnormal cerebral morphogenesis following perinatal frontal cortical lesions in the rat. Neuropharmacology. 2000:39(5):756–764. [DOI] [PubMed] [Google Scholar]
  • 38. Vorhees CV, Williams MT. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Protoc. 2006:1(2):848–858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Provost TL, de Ku, Zender C, Meserve LA. Dose- and age-dependent alterations in choline acetyltransferase (ChAT) activity, learning and memory, and thyroid hormones in 15- and 30-day old rats exposed to 1.25 or 12.5 ppm polychlorinated biphenyl (PCB) beginning at conception. Prog Neuro-Psychopharmacol Biol Psychiatry. 1999:23(5):915–928. [DOI] [PubMed] [Google Scholar]
  • 40. Sala C, Futai K, Yamamoto K, Worley PF, Hayashi Y, Sheng M. Inhibition of dendritic spine morphogenesis and synaptic transmission by activity-inducible protein Homer1a. J Neurosci. 2003:23(15):6327–6337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Yang D, Kim KH, Phimister A, Bachstetter AD, Ward TR, Stackman RW, Mervis RF, Wisniewski AB, Klein SL, Kodavanti PRS, et al. Developmental exposure to polychlorinated biphenyls interferes with experience-dependent dendritic plasticity and ryanodine receptor expression in weanling rats. Environ Health Perspect. 2009:117(3):426–435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Feng J, Yan Z, Ferreira A, Tomizawa K, Liauw JA, Zhuo M, Allen PB, Ouimet CC, Greengard P. Spinophilin regulates the formation and function of dendritic spines. Proc Natl Acad Sci. 2000:97(16):9287–9292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. McNamara RK, Skelton RW. The neuropharmacological and neurochemical basis of place learning in the Morris water maze. Brain Res Rev. 1993:18(1):33–49. [DOI] [PubMed] [Google Scholar]
  • 44. Crawley JN. Behavioral phenotyping strategies for mutant mice. Neuron. 2008:57(6):809–818. [DOI] [PubMed] [Google Scholar]
  • 45. D’Hooge R, De Deyn. Applications of the Morris water maze in the study of learning and memory. Brain Res Rev. 2001:36(1):60–90. [DOI] [PubMed] [Google Scholar]
  • 46. Barnhart CD, Yang D, Lein PJ. Using the Morris water maze to assess spatial learning and memory in weanling mice. PLoS One. 2015:10(4):e0124521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Zhong H, Xu J, Yang M, Hussain M, Liu X, Feng F, Guan R. Protective effect of anthocyanins against neurodegenerative diseases through the microbial-intestinal-brain axis: a critical review. Nutrients. 2023:15(3):496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Hribar U, Ulrih N. The metabolism of anthocyanins. Curr Drug Metab. 2014:15(1):3–13. [DOI] [PubMed] [Google Scholar]
  • 49. Manolescu BN, Oprea E, Mititelu M, Ruta LL, Farcasanu IC. Dietary anthocyanins and stroke: a review of pharmacokinetic and pharmacodynamic studies. Nutrients. 2019:11(7):1479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. González-Barrio R, Borges G, Mullen W, Crozier A. Bioavailability of anthocyanins and ellagitannins following consumption of raspberries by healthy humans and subjects with an ileostomy. J Agric Food Chem. 2010:58(7):3933–3939. [DOI] [PubMed] [Google Scholar]
  • 51. Vepsäläinen S, Koivisto H, Pekkarinen E, Mäkinen P, Dobson G, McDougall GJ, Stewart D, Haapasalo A, Karjalainen RO, Tanila H, et al. Anthocyanin-enriched bilberry and blackcurrant extracts modulate amyloid precursor protein processing and alleviate behavioral abnormalities in the APP/PS1 mouse model of Alzheimer's disease. J Nutr Biochem. 2013:24(1):360–370. [DOI] [PubMed] [Google Scholar]
  • 52. Yamakawa MY, Uchino K, Watanabe Y, Adachi T, Nakanishi M, Ichino H, Hongo K, Mizobata T, Kobayashi S, Nakashima K, et al. Anthocyanin suppresses the toxicity of Aβ deposits through diversion of molecular forms in in vitro and in vivo models of Alzheimer's disease. Nutr Neurosci. 2016:19(1):32–42. [DOI] [PubMed] [Google Scholar]
  • 53. Subash S, Essa MM, Braidy N, Awlad-Thani K, Vaishnav R, al-Adawi S, al-Asmi A, Guillemin GJ. Diet rich in date palm fruits improves memory, learning and reduces beta amyloid in transgenic mouse model of Alzheimer's disease. J Ayurveda Integr Med. 2015:6(2):111–120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Jing P. Purple corn anthocyanins: chemical structure, chemoprotective sctivity and structure/function relationships. United States: The Ohio State University; 2006. [Google Scholar]
  • 55. Ames BN, Shigenaga MK, Hagen TM. Oxidants, antioxidants, and the degenerative diseases of aging. Proc Natl Acad Sci. 1993:90(17):7915–7922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Nikkhah E, Khayami M, Heydari R. In vitro screening for antioxidant activity and cancer suppressive effect of blackberry (Morus nigra). 2008:1(4):167–172. [Google Scholar]
  • 57. Burton-Freeman BM, Sandhu AK, Edirisinghe I. Red raspberries and their bioactive polyphenols: cardiometabolic and neuronal health links. Adv Nutr. 2016:7(1):44–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Fernando W, Somaratne G, Goozee KG, Williams S, Singh H, Martins RN. Diabetes and Alzheimer’s disease: can tea phytochemicals play a role in prevention? J Alzheimers Dis. 2017:59(2):481–501. [DOI] [PubMed] [Google Scholar]
  • 59. Vitaglione P, Donnarumma G, Napolitano A, Galvano F, Gallo A, Scalfi L, Fogliano V. Protocatechuic acid is the major human metabolite of cyanidin-glucosides. J Nutr. 2007:137(9):2043–2048. [DOI] [PubMed] [Google Scholar]
  • 60. Afzal M, Redha A, AlHasan R. Anthocyanins potentially contribute to defense against Alzheimer’s disease. Molecules. 2019:24(23):4255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Lee KM, Chiu KB, Renner NA, Sansing HA, Didier PJ, MacLean AG. Form follows function: astrocyte morphology and immune dysfunction in SIV neuroAIDS. J Neuro-Oncol. 2014:20(5):474–484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Ben Haim L, Carrillo-de Sauvage M-A, Ceyzériat K, Escartin C. Elusive roles for reactive astrocytes in neurodegenerative diseases. Front Cell Neurosci. 2015:9:278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Dahl D, Bignami A. Immunogenic properties of the glial fibrillary acidic protein. Brain Res. 1976:116(1):150–157. [DOI] [PubMed] [Google Scholar]
  • 64. Schiffer D, Giordana MT, Migheli A, Giaccone G, Pezzotta S, Mauro A. Glial fibrillary acidic protein and vimentin in the experimental glial reaction of the rat brain. Brain Res. 1986:374(1):110–118. [DOI] [PubMed] [Google Scholar]
  • 65. Jo S, Yarishkin O, Hwang YJ, Chun YE, Park M, Woo DH, Bae JY, Kim T, Lee J, Chun H, et al. GABA from reactive astrocytes impairs memory in mouse models of Alzheimer's disease. Nat Med. 2014:20(8):886–896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66. Wu Z, Guo Z, Gearing M, Chen G. Tonic inhibition in dentate gyrus impairs long-term potentiation and memory in an Alzheimer’s disease model. Nat Commun. 2014:5(1):1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Chun H, An H, Lim J, Woo J, Lee J, Ryu H, Lee CJ. Astrocytic proBDNF and tonic GABA distinguish active versus reactive astrocytes in hippocampus. Exp Neurobiol. 2018:27(3):155–170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Gallyas F. Novel cell-biological ideas deducible from morphological observations on “dark” neurons revisited. Ideggyogy Sz. 2007:60(5-6):212–222. [PubMed] [Google Scholar]
  • 69. Gallyas F, Gasz B, Szigeti A, Mázló M. Pathological circumstances impair the ability of “dark” neurons to undergo spontaneous recovery. Brain Res. 2006:1110(1):211–220. [DOI] [PubMed] [Google Scholar]
  • 70. Zimatkin SM, Bon’ EI. Dark neurons of the brain. Neurosci Behav Physiol. 2018:48:908–912. [Google Scholar]
  • 71. Distler C, Dreher Z, Stone J. Contact spacing among astrocytes in the central nervous system: an hypothesis of their structural role. Glia. 1991:4(5):484–494. [DOI] [PubMed] [Google Scholar]
  • 72. Distler C, Weigel H, Hoffmann KP. Glia cells of the monkey retina. I. Astrocytes. J Comp Neurol. 1993:333(1):134–147. [DOI] [PubMed] [Google Scholar]
  • 73. Chan-Ling T, Stone J. Factors determining the migration of astrocytes into the developing retina: migration does not depend on intact axons or patent vessels. J Comp Neurol. 1991:303(3):375–386. [DOI] [PubMed] [Google Scholar]
  • 74. Bushong EA, Martone ME, Jones YZ, Ellisman MH. Protoplasmic astrocytes in CA1 stratum radiatum occupy separate anatomical domains. J Neurosci. 2002:22(1):183–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Ogata K, Kosaka T. Structural and quantitative analysis of astrocytes in the mouse hippocampus. Neuroscience. 2002:113(1):221–233. [DOI] [PubMed] [Google Scholar]
  • 76. Wilhelmsson U, Bushong EA, Price DL, Smarr BL, Phung V, Terada M, Ellisman MH, Pekny M. Redefining the concept of reactive astrocytes as cells that remain within their unique domains upon reaction to injury. Proc Natl Acad Sci. 2006:103(46):17513–17518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Jinno S, Fleischer F, Eckel S, Schmidt V, Kosaka T. Spatial arrangement of microglia in the mouse hippocampus: a stereological study in comparison with astrocytes. Glia. 2007:55(13):1334–1347. [DOI] [PubMed] [Google Scholar]
  • 78. Linker RA, Lee DH, Ryan S, van Dam AM, Conrad R, Bista P, Zeng W, Hronowsky X, Buko A, Chollate S, et al. Fumaric acid esters exert neuroprotective effects in neuroinflammation via activation of the Nrf2 antioxidant pathway. Brain. 2011:134(3):678–692. [DOI] [PubMed] [Google Scholar]
  • 79. Keeley PW, Eglen SJ, Reese BE. From random to regular: variation in the patterning of retinal mosaics. J Comp Neurol. 2020:528(13):2135–2160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Thom M, Eriksson S, Martinian L, Caboclo LO, McEvoy AW, Duncan JS, Sisodiya SM. Temporal lobe sclerosis associated with hippocampal sclerosis in temporal lobe epilepsy: neuropathological features. J Neuropathol Exp Neurol. 2009:68(8):928–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Sarkala HB, Jahanshahi M, Dolatabadi LK, Namavar MR. Effect of G-CSF on the spatial arrangement of CA1 hippocampal pyramidal neurons after brain ischemia in the male rats. J Chem Neuroanat. 2019:98:80–86. [DOI] [PubMed] [Google Scholar]
  • 82. Tibau E, Ludl AA, Rudiger S, Orlandi JG, Soriano J. Neuronal spatial arrangement shapes effective connectivity traits of in vitro cortical networks. IEEE Trans Network Sci Eng. 2018:7(1):435–448. [Google Scholar]
  • 83. Owjfard M, Bigdeli MR, Safari A, Haghani M, Namavar MR. Effect of dimethyl fumarate on the motor function and spatial arrangement of primary motor cortical neurons in the sub-acute phase of stroke in a rat model. J Stroke Cerebrovasc Dis. 2021:30(4):105630. [DOI] [PubMed] [Google Scholar]
  • 84. Dubey P, Jayasooriya AP, Cheema SK. Fish oil induced hyperlipidemia and oxidative stress in BioF1B hamsters is attenuated by elderberry extract. Appl Physiol Nutr Metab. 2012:37(3):472–479. [DOI] [PubMed] [Google Scholar]
  • 85.Jiang JM, Zong Y, Chuang DY, Lei W, Lu C-H, et al. Effects of elderberry juice from different genotypes on oxidative and inflammatory responses in microglial cells. Acta Hortic. 2015:12:281–288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86. Zielińska-Wasielica J, Olejnik A, Kowalska K, Olkowicz M, Dembczyński R. Elderberry (Sambucus nigra L.) fruit extract alleviates oxidative stress, insulin resistance, and inflammation in hypertrophied 3T3-L1 adipocytes and activated RAW 264.7 macrophages. Foods. 2019:8(8):326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87. Kreilaus F, Spiro AS, Hannan AJ, Garner B, Jenner AM. Therapeutic effects of anthocyanins and environmental enrichment in R6/1 Huntington’s disease mice. J Huntingtons Dis. 2016:5(3):285–296. [DOI] [PubMed] [Google Scholar]
  • 88. Anderson MT, Staal FJ, Gitler C, Herzenberg LA, Herzenberg LA. Separation of oxidant-initiated and redox-regulated steps in the NF-kappa B signal transduction pathway. Proc Natl Acad Sci. 1994:91(24):11527–11531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89. Hussain T, Tan B, Yin Y, Blachier F, Tossou MCB, Rahu N. Oxidative stress and inflammation: what polyphenols can do for us? Oxidative Med Cell Longev. 2016:2016:7432797–7432799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Chuang DY, Cui J, Simonyi A, Engel VA, Chen S, Fritsche KL, Thomas AL, Applequist WL, Folk WR, Lubahn DB, et al. Dietary Sutherlandia and elderberry mitigate cerebral ischemia-induced neuronal damage and attenuate p47phox and phospho-ERK1/2 expression in microglial cells. ASN Neuro. 2014:6(6):175909141455494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91. Fathi H, Ebrahimzadeh MA, Ziar A, Mohammadi H. Oxidative damage induced by retching; antiemetic and neuroprotective role of Sambucus ebulus L. Cell Biol Toxicol. 2015:31(4-5):231–239. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES