Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 1998 Sep;180(18):4879–4885. doi: 10.1128/jb.180.18.4879-4885.1998

Spore Photoproduct Lyase from Bacillus subtilis Spores Is a Novel Iron-Sulfur DNA Repair Enzyme Which Shares Features with Proteins such as Class III Anaerobic Ribonucleotide Reductases and Pyruvate-Formate Lyases

Roberto Rebeil 1, Yubo Sun 2,, Lilian Chooback 2,, Mario Pedraza-Reyes 3, Cynthia Kinsland 4, Tadhg P Begley 4, Wayne L Nicholson 1,*
PMCID: PMC107513  PMID: 9733691

Abstract

The major photoproduct in UV-irradiated spore DNA is the unique thymine dimer 5-thyminyl-5,6-dihydrothymine, commonly referred to as spore photoproduct (SP). An important determinant of the high UV resistance of Bacillus subtilis spores is the accurate in situ reversal of SP during spore germination by the DNA repair enzyme SP lyase. To study the molecular aspects of SP lyase-mediated SP repair, the cloned B. subtilis splB gene was engineered to encode SP lyase with a molecular tag of six histidine residues at its amino terminus. The engineered six-His-tagged SP lyase expressed from the amyE locus restored UV resistance to spores of a UV-sensitive mutant B. subtilis strain carrying a deletion-insertion mutation which removed the entire splAB operon at its natural locus and was shown to repair SP in vivo during spore germination. The engineered SP lyase was purified both from dormant B. subtilis spores and from an Escherichia coli overexpression system by nickel-nitrilotriacetic acid (NTA) agarose affinity chromatography and was shown by Western blotting, UV-visible spectroscopy, and iron and acid-labile sulfide analysis to be a 41-kDa iron-sulfur (Fe-S) protein, consistent with its amino acid sequence homology to the 4Fe-4S clusters in anaerobic ribonucleotide reductases and pyruvate-formate lyases. SP lyase was capable of reversing SP from purified SP-containing DNA in an in vitro reaction either when present in a cell-free extract prepared from dormant spores or after purification on nickel-NTA agarose. SP lyase activity was dependent upon reducing conditions and addition of S-adenosylmethionine as a cofactor.


Bacterial spores are significantly more resistant to 254-nm UV than are the vegetative forms of the same species (38, 44). Our current understanding is that this high level of UV resistance is due mainly to two interlocking mechanisms. (i) Binding of spore DNA by small, acid-soluble spore proteins of the α/β class results in an alteration of the helical conformation, and hence the UV photochemistry, of dormant spore DNA to favor production of the unique spore photoproduct (SP) 5-thyminyl-5,6-dihydrothymine (reviewed in references 3842). (ii) SP formed during exposure of dormant spores to UV is repaired during spore germination by two distinct DNA repair pathways, nucleotide excision repair (NER) and direct reversal of SP to thymine in DNA by an SP-specific enzyme called SP lyase (2123; reviewed in references 14, 25, and 49).

NER in Bacillus subtilis closely resembles the analogous system which has been well characterized in Escherichia coli (18). NER is a general system capable of detecting and removing a variety of bulky (i.e., helix-distorting) lesions from DNA, including both SP and cyclobutane-type pyrimidine dimers (reviewed in references 14 and 49). SP lyase, in contrast, is specifically dedicated to the in situ monomerization of SP during spore germination (22, 23, 48), but to date little is known of the molecular mechanism of SP repair mediated by SP lyase. SP lyase is encoded by the splB cistron of the splAB operon (13). The splA cistron encodes a small, 9-kDa protein which is not needed for SP lyase activity and which apparently functions in the regulation of splAB operon expression (13, 24).

The results of early indirect experiments suggested that SP lyase was synthesized during either vegetative growth or sporulation and was packaged within the dormant spore (22, 23). Subsequent studies with lacZ fusions to the cloned B. subtilis SP lyase gene splB supported this conclusion; SP lyase is expressed exclusively in the developing forespore compartment during morphological stage III of sporulation as part of the sigma-G regulon of forespore-specific genes (31, 32). Early indirect experiments also indicated that SP disappeared from spore DNA during germination but did not appear in trichloroacetic acid-soluble material, suggesting that SP was not excised from high-molecular-weight DNA but was reversed directly to two thymines in situ (11, 23, 48). The direct reversal of SP by SP lyase is reminiscent of the action of DNA photolyases upon cyclobutane pyrimidine dimers (35), with the exception that SP lyase-mediated repair is light independent (23). Analysis of the deduced amino acid sequence of SP lyase genes cloned from B. subtilis (13) and Bacillus amyloliquefaciens (25) revealed that the two SP lyases indeed share a short stretch of amino acid sequence with members of the DNA photolyase-6-4 photolyase-blue light photoreceptor protein family of enzymes (8, 13, 47), but the potential significance, if any, of this homology is currently unknown.

Inspection of the amino acid sequences of the two cloned SP lyases also revealed that they each contain a total of four cysteine residues, three of which are clustered in an arrangement similar to that seen in certain iron-sulfur (Fe-S) proteins. A search of the protein sequence database with the region of B. subtilis SP lyase encompassing amino acids 80 through 115 indeed revealed substantial homology to Fe-S proteins such as the activating subunits of the anaerobic ribonucleotide reductases (RNR) and pyruvate-formate lyases (PFL) from E. coli, phage T4, Haemophilus influenzae, and Clostridium pasteurianum (24). Iron does appear to be associated with SP lyase activity, as the UV sensitivity of spores of a B. subtilis strain which relies only upon SP lyase for DNA repair is enhanced when this strain is germinated on solid medium lacking iron (24).

The above observations suggest that SP lyase may be an Fe-S protein, and further that class III anaerobic enzymes such as RNR, PFL, or lysine 2,3-aminomutase from C. pasteurianum (reviewed in reference 33) could serve as experimental paradigms for elucidating the molecular mechanism of SP lyase action. An important step towards this goal is the purification and physical characterization of SP lyase and an assay of its activity in vitro. To these ends, the present report describes the engineering of SP lyase containing an amino (N)-terminal histidine tag, its expression in and purification from B. subtilis spores or from an E. coli overexpression system, and preliminary characterization of its properties in vitro.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions.

B. subtilis and E. coli strains used in this study are listed in Table 1. Plasmids and cloned fragments are described in Table 2. Media used were Difco sporulation medium (DSM) (37) and Luria-Bertani medium (19). For strains carrying the thyA1 thyB1 markers, thymidine was routinely added to media to a final concentration of 100 μg/ml. When appropriate, antibiotics were added to media at the following final concentrations: chloramphenicol, 3 μg/ml; ampicillin, 50 or 125 μg/ml; tetracycline, 15 μg/ml; erythromycin, 1 μg/ml; lincomycin, 25 μg/ml (the combination of erythromycin and lincomycin is hereafter referred to as MLS). Labelling of spore DNA by growth and sporulation of B. subtilis cultures in medium containing [methyl-3H]thymidine was performed as described previously (45). All liquid cultures were incubated at 37°C with vigorous aeration, and optical density was monitored with a Klett-Summerson colorimeter fitted with a no. 66 (red) filter. Spore production, purification, and germination conditions have all been described previously (27), as have methods for assaying spore UV resistance (12, 13, 27).

TABLE 1.

Bacterial strains used in this study

Strain (original code) Genotype, phenotype, or characteristic Source or reference
B. subtilis
 WN356 metC14 sul thyA1 thyB1 trpC2 Δ(splAB)::ermC 24
 WN385 Like WN356, but with pDG368 at amyE 24
 WN390 Like WN356, but with pWN378 at amyE This study
 WN417 Like WN356, but with pWN413 at amyE This study
E. coli
 WN159 (JM109) endA1 recA1 gyrA96 thi hsdR17 (rK mK+) relA1 supE44 λ Δ(lac-proAB) [F′ traD36 proA+B+ lacIqZΔM15] Laboratory stock
 WN285 (TB-1) araΔ(lac-proAB) rpsL hsdR φ80lacZΔM15 Laboratory stock
 WN434 (AD494[DE3]) Overexpression strain carrying pCLK201 C. Kinsland

TABLE 2.

Plasmids used in this study

Plasmid Description Source or referencea
pALTER-1 In vitro mutagenesis vector Promega
pBGSC-6 Integrational plasmid derived from pUC19 and pC194 BGSC
pCLK201 10×His-tagged SP lyase overexpression plasmid derived from pET11b C. Kinsland
pDG368 amyE integration vector BGSC, 9
pWN41 pBGSC-6 with 2.3-kb EcoRI-HindIII fragment of the ptsI-splAB region 13
pWN68 pBGSC-6 with 1.36-kb EcoRI-SphI fragment of splAB 13
pWN160 pALTER-1 with a 1.75-kb EcoRI-HindIII fragment of splAB 12
pWN375 pBGSC-6 with 1.08-kb XbaI-SalI PCR product of splB with C-terminal 6×His tag This study
pWN376 pALTER-1 with 1.47-kb EcoRI-HindIII fragment containing splAB with splB C-terminal 6×His tag This study
pWN378 pDG368 with 1.47-kb EcoRI-HindIII splAB fragment from pWN376 This study
pWN406 pALTER-1 with 1.75-kb EcoRI-HindIII fragment containing splAB with splB N-terminal 6×His tag This study
pWN413 pDG368 with 1.75-kb EcoRI-HindIII splAB fragment from pWN406 This study
a

BGSC, Bacillus Genetic Stock Center Columbus, Ohio. 

Genetic and molecular biology techniques.

Preparation of competent E. coli or B. subtilis cells and their transformation with DNA were performed as previously described (6, 34). Large- and small-scale extractions of chromosomal DNA from B. subtilis (9) and plasmid DNA from E. coli (5, 34) were accomplished by standard techniques. Extraction of SP-containing methyl-3H-labelled DNA from spores was previously described (45). Standard techniques were used throughout for enzymatic manipulations and agarose gel electrophoresis of DNA (34), for in vitro mutagenesis (12), and for nucleotide sequencing (13, 36).

Construction of N- and C-terminal SP lyases.

SP lyase carrying a C-terminal tag of 6 histidine residues (6×His) was constructed by PCR amplification of the splB gene from plasmid pWN41 (Table 2) with a pair of oligonucleotide primers, 5′-GGTCTAGAGGAAAAGGATGTGGC-3′ and 5′-CCGTCGACTTAGTGATGGTGATGGTGATGAGTGAAATATTCAATTTTTGC G-3′, followed by a series of cloning steps resulting in plasmid pWN376 (Table 2). SP lyase carrying an N-terminal histidine tag was constructed with a commercial kit (Altered Sites; Promega) by in vitro site-directed mutagenesis of the wild-type splAB operon cloned in plasmid pALTER-1 (plasmid pWN160; Table 2) with the mutagenic oligonucleotide 5′-GGATGTGGCATCATGCACCATCACCATCACCATCAGAACCCATTTGTTCCG-3′, resulting in plasmid pWN406. The modified splAB operons were inserted into the amyE locus of B. subtilis by their removal from plasmids pWN376 and pWN406 and ligation into EcoRI-HindIII-cleaved plasmid pDG364, resulting in plasmids pWN378 and pWN413, respectively (Table 2). All final plasmid constructions were confirmed by nucleotide sequencing (36).

SP lyase purification and protein techniques.

B. subtilis WN417 (1L) was sporulated for 48 h in DSM containing 3 μg of chloramphenicol and 100 μg of thymidine per ml. Spores were harvested, purified as described previously (27), heat shocked at 80°C for 10 min, and stored at 4°C in water until use. The spore coat layer was removed from purified spores by SDS-urea-dithiothreitol (DTT) treatment as described previously (27), and washed decoated spores were lysed by incubation in sonication buffer (50 mM sodium phosphate buffer [pH, 8.0], 300 mM NaCl, and 10 mM imidazole) containing lysozyme (1 mg/ml final concentration) at 37°C for 30 min. Thereafter, the sample was kept on ice or at 4°C. The lysate was sonicated six times for 10-s intervals to lyse cells and shear DNA and centrifuged (12,100 × g, 20 min), and the cell-free extract was loaded onto a nickel-nitrilotriacetic acid (NTA) agarose column (Superflow, Qiagen Inc.) equilibrated in sonication buffer. The column was routinely washed with sonication buffer containing 20 mM imidazole, and the bound protein was eluted with sonication buffer with 250 mM imidazole, and 0.5-ml fractions were collected. The concentration of protein in each fraction was determined by the Bradford assay (7) (Sigma).

Immunologic techniques.

SP lyase containing an N-terminal 10×histidine tag was overproduced in an E. coli expression plasmid system (generously provided by C. Kinsland and T. Begley) and purified by nickel-NTA agarose chromatography as described above. Polyclonal goat antiserum was prepared by the following procedure (4). An adult male goat was immunized with 0.5 mg of SP lyase in Ribi Adjuvant System (Ribi ImmunoChem Research Inc.) administered intramuscularly in the hind leg at two sites. A similar booster immunization of 0.5 mg of SP lyase in Ribi Adjuvant was administered 28 days later. Blood was collected on day 42, and antiserum was harvested from the clotted blood. Preimmune serum collected in a similar manner prior to immunization did not demonstrate any reactivity to SP lyase (data not shown). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting were performed essentially as described by Ausubel et al. (1). Immunostaining of Western blots was performed with rabbit anti-goat immunoglobulin G-peroxidase conjugate (Kirkegaard & Perry Laboratories, Inc.) as the secondary antibody.

Physicochemical techniques.

UV-visible spectroscopy of purified SP lyase from the E. coli overexpression system (0.8 mg of protein/ml in 50 mM Tris-HCl [pH 8.0], 300 mM NaCl, 250 mM imidazole) was performed with a Hewlett-Packard Model 8453 spectrophotometer by using the same buffer without protein as a blank.

Chemical determination of iron, acid-labile sulfide, and flavin content of purified SP lyase from the E. coli overexpression strain was performed as described by Nielsen et al. (28). For iron analysis, aliquots of enzyme (800 μl containing various amounts of protein in 5 mM sodium phosphate [pH 6]) were mixed with 100 μl of 8 M HCl, incubated for 10 min at 0°C, precipitated with 100 μl of 80% trichloroacetic acid (TCA) for 10 min, and clarified by centrifugation. The pH of 800 μl of the supernatant was adjusted to 4.5 by addition of 200 μl of 75% ammonium acetate followed by addition of 80 μl of 10% hydroxylamine hydrochloride and 80 μl of 4 mM tripyridyl-s-triazine and incubation for 10 min. Iron was quantitated by measuring absorption at 593 nm. For determination of acid-labile sulfide, aliquots of enzyme (320 μl containing various amounts of protein) were treated with 2.6% Zn(CH3COO)2 and 0.75% NaOH for 2 h; 100 μl of 0.1% N,N-dimethyl-p-phenylenediamine dissolved in 5 M HCl and 40 μl of 11.5 mM FeCl3 in 0.6 M HCl were added, and the solution was mixed by shaking for 1 min. Next, 320 μl of water was added, the sample was clarified by centrifugation, and acid-labile sulfide was determined by measuring A670. For determination of flavin content, aliquots of enzyme were treated with 4% ammonium sulfate in 75% methanol. After pelleting the protein by centrifugation, the absorption spectrum of the supernatant was determined and compared with those of purified flavin mononucleotide and flavin adenine dinucleotide (28).

SP lyase assays.

SP lyase assays from crude spore extracts were performed by a modification of the protocol described for RNR by Ollagnier et al. (30). Stock solutions (prepared in 30 mM Tris-HCl [pH 8.0]) of dithionite (100 mM), DTT (50 mM), AdoMet (32 mM), and NADPH (10 mM) were purged of oxygen by bubbling a mixture of 80% N2–10% H2–10% CO2 through them for 20 min. Spores of strain WN417 were decoated and lysed as described above in 30 mM Tris-HCl (pH 8.0), followed by deoxygenation of the cell-free extract on ice for 20 min. Reaction mixtures (200 μl total volume) were assembled on ice in the following order: to cell-free extract (120 μl, containing approximately 200 μg of total protein) were added (final concentration) dithionite (1 mM), DTT (5 mM), NADPH (1 mM), AdoMet (1 mM), and 50,000 cpm of SP-containing spore DNA labelled with [methyl-3H]thymidine. Reaction mixtures were incubated in a 37°C water bath overnight. Samples were precipitated by addition of ice-cold TCA to 10% final concentration and incubation on ice for 30 min. The TCA precipitates were centrifuged, and the pellet was used for SP quantitation as described below.

Assay of SP lyase activity with enzyme purified on nickel-NTA agarose was performed by a slight modification of the procedure developed by Ollagnier et al. (30) for the E. coli anaerobic RNR. All solutions were deoxygenated prior to use with 52% H2–48% CO2. Six-His-tagged SP lyase was purified from spores by nickel-NTA chromatography as described above and treated with 4 mM DTT and 52% H2–48% CO2. To deoxygenated enzyme (0.5 or 1.0 μg of protein) and buffer the following were added (final concentration): sodium dithionite (3 mM), KCl (30 mM), sodium formate (5 mM), S-adenosylmethionine (2 mM; AdoMet), and 50,000 cpm of [methyl-3H]thymidine-labelled, SP-containing DNA. A separate and identical set of reaction mixtures lacking AdoMet was also prepared. After overnight incubation at 37°C, samples were subjected to TCA precipitation and SP quantitation as described below.

SP quantitation.

Germination samples and in vitro reaction mixtures were precipitated on ice for 30 min with 10% TCA and centrifuged. The pellets were resuspended in 0.5 ml trifluoroacetic acid (TFA), sealed under vacuum in 2.0-ml glass ampules, and hydrolyzed at 155°C for 60 min. TFA was evaporated, and the dried contents in each ampule were resuspended in 100 μl of water and subjected to descending chromatography on Whatman no. 1 paper with 80:12:30 (vol/vol/vol) n-butanol–acetic acid–water. The resulting chromatograms were cut into 1-cm fractions, and SP (Rf, 0.45) and thymine (Rf, 0.6) were quantitated by scintillation counting as described in detail previously (10, 26, 45).

RESULTS

UV resistance of spores carrying engineered SP lyases expressed at amyE.

Construction and characterization of B. subtilis WN356, which lacks NER and in which the splAB operon has been deleted and replaced with an MLS resistance cassette, have been described in detail elsewhere (24). Plasmids pWN378 (encoding SP lyase with a C-terminal histidine tag) and pWN413 (encoding SP lyase with an N-terminal histidine tag) (Table 2) were inserted into the amyE locus by transformation into competent cells of strain WN356, resulting in strains WN390 and WN417, respectively (Table 1). The ability of the two engineered SP lyases to restore UV resistance to spores of strain WN356 was then tested (Fig. 1). It was observed that SP lyase with a C-terminal histidine tag expressed from amyE (strain WN390) conferred only slightly more UV resistance to spores than did insertion of the vector alone into the amyE locus of strain WN356 (Fig. 1). In contrast, strain WN417, which from the amyE locus expressed SP lyase with the N-terminal histidine tag, produced spores whose UV resistance was virtually indistinguishable from that of spores of strain WN386, a strain which carries the wild-type splAB operon at amyE (24) (Fig. 1). This in vivo experiment indicated that SP lyase biological activity was nearly abolished by addition of six histidines at its C-terminus, but was not significantly affected by addition of six histidines at its N-terminus. Therefore, strain WN417 was used in subsequent experiments.

FIG. 1.

FIG. 1

Spore UV resistance of B. subtilis strains carrying various engineered alleles of SP lyase expressed from the amyE locus. Strains used were WN385 (vector only; open circles), WN386 (wild-type SP lyase; open triangles), WN390 (C-terminal histidine-tagged SP lyase; closed circles), and WN417 (N-terminal histidine-tagged SP lyase; closed triangles).

Repair of SP during spore germination by histidine-tagged SP lyase.

To confirm that the enhanced UV resistance observed in spores of strain WN417 (Fig. 1) was indeed due to DNA repair by SP lyase carrying the N-terminal histidine tag, SP repair was assayed during germination of UV-irradiated spores of strain WN417 and its parent strain WN356 (Fig. 2). The DNA in spores of strain WN417 and its parent strain WN356 was labelled by growth and sporulation in DSM supplemented with [methyl-3H]thymidine, spores were irradiated with UV to produce SP, and the kinetics of SP repair during germination was monitored (Fig. 2). It was observed that strain WN356, lacking NER and SP lyase, was unable to remove SP from germinating spore DNA, whereas strain WN417, carrying the N-terminal histidine-tagged SP lyase expressed from amyE, removed approximately 65% of SP from DNA during the first 90 min of germination (Fig. 2). Therefore, it appeared that SP repair during germination, and hence UV resistance, of strain WN417 were due to the activity of N-terminal histidine-tagged SP lyase.

FIG. 2.

FIG. 2

Kinetics of SP repair during germination of spores of B. subtilis WN356 (open circles) and WN417 (closed circles) in DSM containing 10 mM l-alanine. Before germination, spores were irradiated with UV to obtain the following amounts of SP (expressed as percentage of total thymine): WN356, 1.1% and WN417, 2.1%. Results shown are the averages ± standard deviations of two (WN356) or three (WN417) independent experiments.

Purification of histidine-tagged SP lyase.

Dormant spores of strain WN417 were disrupted, the cell debris was removed by centrifugation, and the cell-free extract was passed through a nickel-NTA agarose column. Because SP lyase is present at very low quantities in dormant spores, SP lyase was visualized during purification by Western blot analysis with polyclonal antiserum raised against purified SP lyase from an E. coli overexpression system. Decoated, lysed spores of strain WN417 exhibited a 41-kDa protein which reacted with anti-SP lyase antiserum (Fig. 3, lane 2) and whose mass corresponded very closely to the calculated molecular mass of N-terminal histidine-tagged SP lyase (40,847 Da). The 41-kDa protein was absent from decoated, lysed spores of the parental strain WN356 (Fig. 3, lane 1). The 41-kDa protein band persisted in the cell-free extract after the spore lysate of strain WN417 was clarified by high-speed centrifugation (Fig. 3, lane 3), and the protein bound to a nickel-NTA agarose column, as it was absent from the flow-through fraction at 20 mM imidazole (Fig. 3, lane 4) but was present in the 250 mM imidazole eluate from the column (Fig. 3, lane 5). The 10×His-tagged SP lyase overexpressed in E. coli and isolated by the same procedure was essentially pure, demonstrating a single 43-kDa band on Coomassie blue-stained SDS-PAGE gel which (i) reacted with anti-SP lyase antibody on a Western blot and (ii) when subjected to automated N-terminal sequencing was found to have a sequence that perfectly matched the predicted amino acid sequence of the engineered 10×His-tagged SP lyase (data not shown).

FIG. 3.

FIG. 3

SDS–10% PAGE-Western blot analysis of SP lyase purification. The 43- and 30-kDa protein molecular mass markers were visualized by staining with Ponceau S. Lane 1, lysed spores of strain WN356; lane 2, lysed spores of strain WN417; lane 3, cell-free extract of strain WN417 after clarification by high-speed centrifugation; lane 4, flow-through from nickel-NTA column; lane 5, eluate from nickel-NTA column with 250 mM imidazole.

Purified SP lyase contains iron and sulfur.

During purification of the 10×His-tagged SP lyase overexpressed in E. coli, it was noted that as the cell-free extract was allowed to flow through the nickel-NTA agarose column a reddish-brown band appeared at the top of the column, which remained after washing the column with sonication buffer containing 20 mM imidazole (reference 2 and our unpublished results). Upon application of a linear 25 to 500 mM imidazole gradient, the colored band eluted at approximately 120 mM imidazole, along with SP lyase (data not shown). This observation, along with the characteristic smell of sulfide upon treatment of the purified SP lyase with acid, was consistent with SP lyase containing an Fe-S cluster. As we were unable to purify sufficient quantities of SP lyase from dormant B. subtilis spores to perform chemical analyses, we assayed the purified 10×His-tagged SP lyase obtained from the E. coli overexpression system for iron, acid-labile sulfide, and flavin content (28) (Table 3). The SP lyase purified from E. coli was found to contain 1.03 ± 0.26 mol of iron and 1.55 ± 0.04 mol of acid-labile sulfide per mol of protein (Table 3). As no special care had been taken to exclude oxygen from these enzyme preparations, the above values are probably underestimates of the in vivo stoichiometry of Fe and S. No flavin cofactors were detected by chemical assay of the SP lyase overexpressed from E. coli (data not shown).

TABLE 3.

Determination of iron and sulfur content of purified His-tagged SP lyase

Sample no. Protein content (nmol)a A593 A670 Fe content (nmol)b S content (nmol)c Iron/protein or sulfur/ pro- tein ratiod
Iron
 1 8.26 0.155 8.0 0.97
 2 5.29 0.080 3.7 0.70
 3 3.40 0.082 3.8 1.12
 4 1.89 0.059 2.5 1.32
Sulfur
 1 4.96 0.247 7.72 1.56
 2 2.48 0.129 4.03 1.63
a

Determined by Bradford assay of protein concentration and the deduced molecular mass of the 10×His-tagged SP lyase from the E. coli overexpression system (42,353 Da). 

b

A593 of 1 nmol of Fe = 0.033. 

c

A670 of 1 nmol of S2− = 0.032 (28). 

d

Averages ± SDs: iron/protein ratio, 1.03 ± 0.26; sulfur/protein ratio, 1.60 ± 0.05. 

UV-visible absorption spectrum of SP lyase.

UV-visible absorption spectroscopy was performed on the 10×His-tagged SP lyase purified from E. coli in order to gain information regarding unusual structural features or the potential presence of UV-absorbing cofactors. The reddish-brown form of SP lyase obtained directly from the nickel-NTA agarose column exhibited a spectrum characteristic of an Fe-S protein (11a, 17, 45a), with peaks centered at 340, 400, and 472 nm (Fig. 4). Absorption peaks characteristic of potential chromophores, such as flavins, expected to be visualized at 377 and 452 nm (28) were not detected (Fig. 4). Upon addition of 1 mM (final concentration) dithionite to the purified SP lyase, the reddish-brown color immediately disappeared and the UV-visible absorption spectrum of the dithionite-treated SP lyase (30 min on ice) exhibited a dramatic shift (Fig. 4; see Discussion).

FIG. 4.

FIG. 4

UV-visible absorption spectrum of 10×His-tagged SP lyase (0.8 mg/ml) purified from the E. coli overexpression system before (thick line) and after (thin line) treatment with 1 mM dithionite (0°C, 30 min).

In vitro assay of SP lyase activity.

Numerous previous attempts to detect SP lyase activity in vitro have been unsuccessful; however, the homology observed between SP lyase and the anaerobic RNR and PFL enzymes (24), coupled with the spectroscopic data indicating that the Fe-S cluster in SP lyase was partially oxidized upon purification (Fig. 4), presented the possibility that SP lyase would require at least reducing, if not anoxic, conditions for its activity. To assay SP lyase in vitro, we therefore modified conditions which were previously used to achieve in vitro activity of the anaerobic RNR of E. coli (29, 30). SP lyase activity was detected in vitro with cell-free spore extracts from strain WN417, encoding the N-terminal 6×His-tagged SP lyase (Fig. 5), but not from the parental strain WN356 treated in an identical manner (data not shown). When cell-free extracts prepared from strain WN417 were incubated under reducing conditions with SP-containing DNA, a paradoxical increase in SP was observed (Fig. 5), apparently due to enhanced TCA precipitation of small SP-containing DNA fragments bound by SP lyase (data not shown). Addition of either AdoMet or NADPH to the reaction mixture enabled the WN417 cell-free extract to correct approximately 20 and 25% of the SP present in the substrate DNA, respectively (Fig. 5). The two cofactors added in combination also stimulated SP repair activity in vitro, but not as effectively as either added alone (Fig. 5).

FIG. 5.

FIG. 5

In vitro assay of SP lyase activity from cell-free extracts of strain WN417 spores. Assays were performed as described in Materials and Methods, and results are reported as averages ± standard errors of the means (n = 4). Differences in SP level in reaction mixtures to which cofactors were added compared to the control reaction mixture with extract added alone were significant at P = 0.05 (∗), P = 0.01 (∗∗), or P = 0.001 (∗∗∗) as determined by analysis of variance.

As was observed with the E. coli anaerobic RNR (30), in the cell-free extract SP lyase could apparently be activated by reduction with NADPH. However, it was previously demonstrated that reductive activation of purified RNR could be accomplished by a number of different chemical routes (30). The 6×His-tagged SP lyase purified from B. subtilis spores by nickel-NTA chromatography and activated by treatment with DTT and dithionite in a reducing atmosphere (30; see Materials and Methods) was able to cleave SP in vitro (Fig. 6). A direct linear relationship was obtained between the amount of SP lyase added and the degree of SP repair, and activity of the purified enzyme was absolutely dependent on AdoMet (Fig. 6). Under identical pretreatment and assay conditions, the 10×His-tagged SP lyase purified from the E. coli overexpression system showed no activity (data not shown).

FIG. 6.

FIG. 6

In vitro repair of SP by 6×His-tagged SP lyase purified from B. subtilis spores as a function of enzyme added in the absence (open circles) or presence (closed circles) of 2 mM AdoMet. Data are reported as averages ± standard errors of the means (n = 2).

DISCUSSION

Repair of UV-induced DNA damage by SP lyase during spore germination is an important determinant of bacterial spore UV resistance (reviewed in references 14, 25, 42, and 49). We have shown in this report that SP lyase from B. subtilis is an Fe-S protein which requires reducing conditions and AdoMet for its activity, in a fashion similar to enzymes such as class III anaerobic RNR and to PFL.

The 6×His-tagged SP lyase was expressed in B. subtilis from the amyE locus by using its native transcriptional and translational signals; therefore, its level in the dormant spore is probably similar to that of native SP lyase. Calculation of the yield of the purified 6×His-tagged SP lyase from spores (approximately 1 μg of protein per 1.25 × 1011 spores) corresponds to approximately 100 to 200 subunit copies per spore. Because SP lyase is present at such a low concentration in spores, some of the physicochemical data reported here were derived from the splB gene product overexpressed in E. coli. Chemical extraction of flavin and spectral analysis (28) of the 10×His-tagged SP lyase purified from E. coli failed to detect flavin-containing compounds, consistent with the absence of absorption peaks characteristic of flavins in its UV-visible spectrum (Fig. 4). Chemical analysis of iron and acid-labile sulfide content (28) of the 10×His-tagged SP lyase purified from the E. coli overexpression system indicated 1.03 mol of iron and 1.60 mol of sulfide per mol of SP lyase subunit (Table 3), strongly suggesting that SP lyase contains an Fe-S center. The observed iron and sulfur stoichiometry of the purified 10×His-tagged SP lyase overexpressed in E. coli is probably an underestimate of the in vivo stoichiometry, as the protein was isolated under nonreducing conditions. The UV-visible spectrum of the 10×His-tagged SP lyase from E. coli (Fig. 4) is also characteristic of a protein containing an Fe-S cluster; the presence of absorption peaks in the SP lyase spectrum at 340, 400, and 472 nm are reminiscent of 2Fe-2S proteins such as biotin synthase (11a) and ferredoxin (45a). The dramatic shift in UV-visible spectrum of SP lyase upon reduction with dithionite is similar to that seen in 2Fe-2S to 4Fe-4S cluster conversion upon dithionite reduction of biotin synthase (11a). While definitive determination of which type of Fe-S cluster is contained by SP lyase awaits further characterization, the spectroscopic and chemical analysis data are consistent with the previous observation that the amino acid sequence of SP lyase contains a constellation of cysteine residues arranged in a manner highly homologous to the regions of the anaerobic RNR and PFL proteins which participate in 4Fe-4S cluster formation (24).

By using a modification of conditions used for assaying RNR activity (29; see Materials and Methods), SP lyase activity was detected in a cell-free extract prepared from dormant spores of strain WN417 (Fig. 5). This represents the first in vitro demonstration of SP lyase enzymatic activity, a significant first step toward characterizing the enzymatic mechanism of SP lyase in detail. Deoxygenated cell-free extract from strain WN417 dormant spores could not by itself repair SP in vitro, but activity was obtained by addition of either AdoMet or NADPH (Fig. 5). That AdoMet stimulated SP lyase activity seems reasonable, based upon the analogy with RNR and PFL, both of which require AdoMet for activity (29). Stimulation of SP lyase activity by NADPH addition to the cell-free extract from strain WN417 dormant spores may indicate that the reduced form of NADPH could be involved in a redox system used in vivo for regeneration of active-site cysteines, as seen in other RNRs (33). Interestingly, although dormant spores contain amounts of pyridine nucleotides comparable to vegetative cells, almost none is in the reduced form (43).

Chemical reduction of the 6×His-tagged SP lyase purified from B. subtilis spores with formate resulted in activation of the enzyme such that it required only AdoMet for activity (Fig. 6). However, we were unable to detect activity from the 10×His-tagged SP lyase purified from the E. coli overexpression system pretreated identically. This result suggests either that the loss or inactivation of some essential factor(s) occurred during purification of the E. coli enzyme or that the cloned splB locus by itself expressed in E. coli does not encode the entire SP lyase holoenzyme. By analogy to RNR or PFL, what we call SP lyase encoded by splB would correspond only to the β2 activating subunit of an α2β2 tetrameric holoenzyme. In anaerobic RNR and in PFL, the activating subunits are homodimers which associate through a 4Fe-4S cluster (30); separate genetic evidence suggests that SP lyase may also be active as a homodimer (24). The possibility therefore presents itself that while the B. subtilis WN417 spore contains the putative SP lyase holoenzyme, the E. coli system expresses only the splB-encoded activating subunit. Experiments are currently under way to identify the putative second subunit.

Fe-S clusters have been shown to be ubiquitous and important determinants of protein structure and enzymatic activity (reviewed in reference 3) and have been shown to operate by such diverse mechanisms as stabilization of the DNA binding site, as in the endonuclease III of E. coli (46); behaving as a sensor of oxidative stress by changes in oxidation state, as in the SoxR protein of E. coli (15, 16); or regulation of DNA binding through oxidative assembly-disassembly of an Fe-S cluster holding together two identical subunits, as in the E. coli anaerobic transcriptional activator FNR (3, 17). Because SP lyase was found by an amino acid sequence homology search to resemble the activating subunits of anaerobic RNR and PFL (24), these enzymes are being used as models for probing in vitro SP lyase activity. The enzymology of RNR and PFL is rather complex. Both enzymes are active as α2β2 tetramers (29). Enzymatic activity is dependent upon generation of an oxygen-labile glycyl free radical in the larger α2 catalytic subunit. The smaller β2 activating subunit dimerizes through an oxygen-labile 4Fe-4S cluster which in its reduced form participates in splitting AdoMet into methionine and a 5′-deoxyadenosyl radical which then generates the glycyl radical in the α2 catalytic subunit by abstracting a hydrogen atom from the α-carbon of glycine. AdoMet is thus required for activity (20). In AdoMet-requiring enzymes which cleave C—H or C⩵C bonds, such as PFL, anaerobic RNR, lysine 2,3-aminomutase, biotin synthase, and lipoic acid synthase, a common theme appears to be oxidative degradation of subunit-bridging 4Fe-4S clusters during purification to 2Fe-2S clusters (11a). The 4Fe-4S cluster in the β2 subunit of RNR can be reduced in vitro by treatment with either (i) flavodoxin, flavodoxin reductase, and NADPH; (ii) photochemically reduced 5-deazaflavin; or (iii) dithionite (29). By analogy to these enzymes, the Fe-S cluster in SP lyase also appears to share these properties (Fig. 4). The results reported above with SP lyase are important steps towards determination of the physical organization and reaction mechanism of this unique DNA repair enzyme.

ACKNOWLEDGMENTS

We thank the following: Glenn Songer and Veronica Enriquez for assistance in antiserum preparation; Robert Switzer for helpful discussions; and the two anonymous reviewers for their insightful comments and suggestions.

This work was supported by grants from the National Institutes of Health (GM47461) and the American Cancer Society (JFRA-410) to W.L.N. and by an NIH Supplemental Grant for Underrepresented Minorities to R.R.

REFERENCES

  • 1.Ausubel F M, Brent R, Kingston R E, Moore D D, Seidman J G, Smith J A, Struhl K, editors. Current protocols in molecular biology. New York, N.Y: John Wiley and Sons, Inc.; 1994. [Google Scholar]
  • 2.Begley, T. Personal communication.
  • 3.Beinert H, Holm R H, Münck E. Iron-sulfur clusters: nature’s modular, multipurpose structures. Science. 1997;277:653–659. doi: 10.1126/science.277.5326.653. [DOI] [PubMed] [Google Scholar]
  • 4.Billington S J, Jost B H, Cuevas W A, Bright K R, Songer J G. The Arcanobacterium (Actinomyces) pyogenes hemolysin, pyolysin, is a novel member of the thiol-activated cytolysin family. J Bacteriol. 1997;179:6100–6106. doi: 10.1128/jb.179.19.6100-6106.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Birnboim H C, Doly J. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979;7:1513–1523. doi: 10.1093/nar/7.6.1513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Boylan R J, Mendelson N H, Brooks D, Young F E. Regulation of the bacterial cell wall: analysis of a mutant of Bacillus subtilis defective in biosynthesis of teichoic acid. J Bacteriol. 1972;110:281–290. doi: 10.1128/jb.110.1.281-290.1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bradford M M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 8.Brennan R G, Matthews B W. The helix-turn-helix DNA binding motif. J Biol Chem. 1989;264:1903–1906. [PubMed] [Google Scholar]
  • 9.Cutting S M, Vander Horn P B. Genetic analysis. In: Harwood C R, Cutting S M, editors. Molecular biological methods for Bacillus. Sussex, England: John Wiley and Sons; 1990. pp. 27–74. [Google Scholar]
  • 10.Donnellan J E, Jr, Setlow R B. Thymine photoproducts but not thymine dimers are found in ultraviolet irradiated bacterial spores. Science. 1965;149:308–310. doi: 10.1126/science.149.3681.308. [DOI] [PubMed] [Google Scholar]
  • 11.Donnellan J E, Jr, Stafford R S. The ultraviolet photochemistry and photobiology of vegetative cells and spores of Bacillus megaterium. Biophys J. 1968;8:17–28. doi: 10.1016/S0006-3495(68)86471-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11a.Duin E C, Lafferty M E, Crouse B R, Allen R M, Sanyal I, Flint D H, Johnson M K. [2Fe-2S] to [4Fe-4S] cluster conversion in Escherichia coli biotin synthase. Biochemistry. 1997;36:11811–11820. doi: 10.1021/bi9706430. [DOI] [PubMed] [Google Scholar]
  • 12.Fajardo-Cavazos P, Nicholson W L. Molecular dissection of mutations in the Bacillus subtilis spore photoproduct lyase gene which affect repair of spore DNA damage caused by UV radiation. J Bacteriol. 1995;177:4402–4409. doi: 10.1128/jb.177.15.4402-4409.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fajardo-Cavazos P, Salazar C, Nicholson W L. Molecular cloning and characterization of the Bacillus subtilis spore photoproduct lyase (spl) gene, which is involved in repair of UV radiation-induced DNA damage during spore germination. J Bacteriol. 1993;175:1735–1744. doi: 10.1128/jb.175.6.1735-1744.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Friedberg E C, Walker G C, Siede W. DNA repair and mutagenesis. Washington, D.C: American Society for Microbiology; 1995. [Google Scholar]
  • 15.Gaudu P, Weiss B. SoxR, a (2Fe-2S) transcription factor, is active only in its oxidized form. Proc Natl Acad Sci USA. 1996;93:10094–10098. doi: 10.1073/pnas.93.19.10094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hidalgo E, Bollinger J M, Jr, Bradley T M, Walsh C T, Demple B. Binuclear (2Fe-2S) clusters in the Escherichia coli SoxR protein and role of the metal centers in transcription. J Biol Chem. 1995;270:20908–20914. doi: 10.1074/jbc.270.36.20908. [DOI] [PubMed] [Google Scholar]
  • 17.Lazazzera B A, Beinert H, Khoroshilova N, Kennedy M C, Kiley P J. DNA binding and dimerization of the Fe-S-containing FNR protein from Escherichia coli are regulated by oxygen. J Biol Chem. 1996;271:2762–2768. doi: 10.1074/jbc.271.5.2762. [DOI] [PubMed] [Google Scholar]
  • 18.Lin J-J, Sancar A. Reconstitution of nucleotide excision nuclease with UvrA and UvrB proteins from Escherichia coli and UvrC protein from Bacillus subtilis. J Biol Chem. 1990;265:21337–21341. [PubMed] [Google Scholar]
  • 19.Miller J H. Experiments in molecular genetics. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1972. [Google Scholar]
  • 20.Mulliez E, Fontecave M, Gaillard J, Reichard P. An iron sulfur center and a free radical in the active anaerobic ribonucleotide reductase of Escherichia coli. J Biol Chem. 1993;268:2296–2299. [PubMed] [Google Scholar]
  • 21.Munakata N. Genetic analysis of a mutant of Bacillus subtilis producing ultraviolet-sensitive spores. Mol Gen Genet. 1969;104:258–263. doi: 10.1007/BF02539290. [DOI] [PubMed] [Google Scholar]
  • 22.Munakata N, Rupert C S. Genetically controlled removal of “spore photoproduct” from deoxyribonucleic acid of ultraviolet-irradiated Bacillus subtilis spores. J Bacteriol. 1972;111:192–198. doi: 10.1128/jb.111.1.192-198.1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Munakata N, Rupert C S. Dark repair of DNA containing “spore photoproduct” in Bacillus subtilis. Mol Gen Genet. 1974;130:239–250. doi: 10.1007/BF00268802. [DOI] [PubMed] [Google Scholar]
  • 24.Nicholson W L, Chooback L, Fajardo-Cavazos P. Analysis of spore photoproduct lyase operon (splAB) function using targeted deletion-insertion mutations spanning the Bacillus subtilis ptsHI and splAB operons. Mol Gen Genet. 1997;255:587–594. doi: 10.1007/s004380050532. [DOI] [PubMed] [Google Scholar]
  • 25.Nicholson W L, Fajardo-Cavazos P. DNA repair and the ultraviolet radiation resistance of bacterial spores: from the laboratory to the environment. In: Pandalai S, editor. Recent research developments in microbiology. Vol. 1. Trivandrum, India: Research Signpost; 1997. pp. 125–140. [Google Scholar]
  • 26.Nicholson W L, Setlow B, Setlow P. Ultraviolet irradiation of DNA complexed with α/β-type small, acid-soluble proteins from spores of Bacillus or Clostridium species makes spore photoproduct but not thymine dimers. Proc Natl Acad Sci USA. 1991;88:8288–8292. doi: 10.1073/pnas.88.19.8288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nicholson W L, Setlow P. Sporulation, germination, and outgrowth. In: Harwood C R, Cutting S M, editors. Molecular biological methods for Bacillus. Sussex, England: John Wiley and Sons; 1990. pp. 391–450. [Google Scholar]
  • 28.Nielsen F S, Andersen P S, Jensen K F. The B form of dihydroorotate dehydrogenase from Lactococcus lactis consists of two different subunits, encoded by the pyrDb and pyrK genes, and contains FMN, FAD, and [FeS] redox centers. J Biol Chem. 1996;271:29359–29365. doi: 10.1074/jbc.271.46.29359. [DOI] [PubMed] [Google Scholar]
  • 29.Ollagnier S, Mulliez E, Gaillard J, Eliasson R, Fontecave M, Reichard P. The anaerobic Escherichia coli ribonucleotide reductase: subunit structure and iron-sulfur center. J Biol Chem. 1996;271:9410–9416. doi: 10.1074/jbc.271.16.9410. [DOI] [PubMed] [Google Scholar]
  • 30.Ollagnier S, Mulliez E, Schmidt P P, Eliasson R, Gaillard J, Deronzier C, Bergman T, Gräslund A, Reichard P, Fontcave M. Activation of the anaerobic ribonucleotide reductase from Escherichia coli. The essential role of the iron-sulfur center for S-adenosylmethionine reduction. J Biol Chem. 1997;272:24216–24223. doi: 10.1074/jbc.272.39.24216. [DOI] [PubMed] [Google Scholar]
  • 31.Pedraza-Reyes M, Gutiérrez-Corona F, Nicholson W L. Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation. J Bacteriol. 1994;176:3983–3991. doi: 10.1128/jb.176.13.3983-3991.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Pedraza-Reyes M, Gutiérrez-Corona F, Nicholson W L. Spore photoproduct lyase operon (splAB) regulation during Bacillus subtilis sporulation: modulation of splB-lacZ fusion expression by P1 promoter mutations and by an in-frame deletion of splA. Curr Microbiol. 1997;34:133–137. doi: 10.1007/s002849900157. [DOI] [PubMed] [Google Scholar]
  • 33.Reichard P. The evolution of ribonucleotide reduction. Trends Biochem Sci. 1997;22:81–85. doi: 10.1016/s0968-0004(97)01003-7. [DOI] [PubMed] [Google Scholar]
  • 34.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 35.Sancar A. Structure and function of DNA photolyase. Biochemistry. 1994;33:2–9. doi: 10.1021/bi00167a001. [DOI] [PubMed] [Google Scholar]
  • 36.Sanger F, Nicklen S, Coulson A R. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74:5463–5467. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Schaeffer P, Millet J, Aubert J-P. Catabolic repression of bacterial sporulation. Proc Natl Acad Sci USA. 1965;54:704–711. doi: 10.1073/pnas.54.3.704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Setlow P. Resistance of bacterial spores to ultraviolet light. Comments Mol Cell Biophys. 1988;5:253–264. [Google Scholar]
  • 39.Setlow P. I will survive: protecting and repairing spore DNA. J Bacteriol. 1992;174:2737–2741. doi: 10.1128/jb.174.9.2737-2741.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Setlow P. DNA in dormant spores of Bacillus species is in an A-like conformation. Mol Microbiol. 1992;6:563–567. doi: 10.1111/j.1365-2958.1992.tb01501.x. [DOI] [PubMed] [Google Scholar]
  • 41.Setlow P. DNA structure, spore formation, and spore properties. In: Piggot P J, Moran C P Jr, Youngman P, editors. Regulation of bacterial differentiation. Washington, D.C: American Society for Microbiology; 1994. pp. 181–194. [Google Scholar]
  • 42.Setlow P. Mechanisms for the prevention of damage to DNA in spores of Bacillus species. Annu Rev Microbiol. 1995;49:29–54. doi: 10.1146/annurev.mi.49.100195.000333. [DOI] [PubMed] [Google Scholar]
  • 43.Setlow P, Kornberg A. Biochemical studies of bacterial sporulation and germination. XXII. Energy metabolism in early stages of germination of Bacillus megaterium spores. J Biol Chem. 1970;245:3637–3644. [PubMed] [Google Scholar]
  • 44.Stuy J H. Studies on the mechanism of radiation inactivation of microorganisms. III. Inactivation of germinating spores of Bacillus cereus. Biochim Biophys Acta. 1956;22:241–246. doi: 10.1016/0006-3002(56)90146-9. [DOI] [PubMed] [Google Scholar]
  • 45.Sun Y, Palasingam K, Nicholson W L. High-pressure liquid chromatography assay for quantitatively monitoring spore photoproduct repair mediated by spore photoproduct lyase during germination of UV-irradiated Bacillus subtilis spores. Anal Biochem. 1994;221:61–65. doi: 10.1006/abio.1994.1379. [DOI] [PubMed] [Google Scholar]
  • 45a.Tang C, Henry H L. Overexpression in Escherichia coli and affinity purification of chick kidney ferredoxin. J Biol Chem. 1993;268:5069–5076. [PubMed] [Google Scholar]
  • 46.Thayer M M, Ahern H, Xing D, Cunningham R P, Tainer J A. Novel DNA binding motifs in the DNA repair enzyme endonuclease III crystal structure. EMBO J. 1995;14:4108–4120. doi: 10.1002/j.1460-2075.1995.tb00083.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Todo T, Ryo H, Yamamoto K, Toh H, Inui T, Ayaki H, Nomura T, Ikenaga M. Similarity among the Drosophila (6-4) photolyase, a human photolyase homolog, and the DNA photolyase-blue-light photoreceptor family. Science. 1996;272:109–112. doi: 10.1126/science.272.5258.109. [DOI] [PubMed] [Google Scholar]
  • 48.Wang T-CV, Rupert C S. Evidence for the monomerization of spore photoproduct to two thymines by the light-independent “spore repair” process in Bacillus subtilis. Photochem Photobiol. 1977;25:123–127. doi: 10.1111/j.1751-1097.1977.tb07432.x. [DOI] [PubMed] [Google Scholar]
  • 49.Yasbin R E, Cheo D, Bol D. DNA repair systems. In: Sonenshein A L, Hoch J A, Losick R, editors. Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. Washington, D.C: American Society for Microbiology; 1993. pp. 529–537. [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES