Skip to main content
NCBI home page
Acta Biochimica et Biophysica Sinica logoLink to Acta Biochimica et Biophysica Sinica
. 2023 Aug 10;55(12):1864–1873. doi: 10.3724/abbs.2023104

RBM14 promotes DNA end resection during homologous recombination repair

RBM14 in HR repair

Zheng Li 1,2, Yanting Liao 2, Chen Tang 3,4, Linli Xu 1, Bin Peng 2, Xingzhi Xu 2,*
PMCID: PMC10753362  PMID: 37559455

Abstract

DNA double-strand break (DSB) repair by homologous recombination (HR) is crucial for the maintenance of genome stability and integrity. In this study, we aim to identify novel RNA binding proteins (RBPs) involved in HR repair because little is known about RBP function in HR. For this purpose, we carry out pulldown assays using a synthetic ssDNA/dsDNA structure coated with replication protein A (RPA) to mimic resected DNA, a crucial intermediate in HR-mediated DSB repair. Using this approach, we identify RNA-binding motif protein 14 (RBM14) as a potential binding partner. We further show that RBM14 interacts with an essential HR repair factor, CtIP. RBM14 is crucial for CtIP recruitment to DSB sites and for subsequent RPA coating and RAD51 replacement, facilitating efficient HR repair. Moreover, inhibition of RBM14 expression sensitizes cancer cells to X-ray irradiation. Together, our results demonstrate that RBM14 promotes DNA end resection to ensure HR repair and may serve as a potential target for cancer therapy.

Keywords: RNA binding protein, RBM14, homologous recombination repair, end resection

Introduction

DNA double-strand breaks (DSBs) are the most detrimental type of DNA damage. They are generated by various endogenous factors, including oxidative stress and replication errors, and exogenous sources, such as ionizing radiation (IR) and chemotherapeutic drugs [ 1, 2]. A single unrepaired DSB is sufficient to induce cell death, while improper repair can lead to genome instability and tumorigenesis [3]. In general, DSBs are repaired via two major pathways: (i) error-prone non-homologous end joining (NHEJ), which is active throughout the cell cycle, and (ii) error-free homologous recombination (HR), which is restricted to the S/G2 phase when a homologous DNA template is available [4]. NHEJ repair directly ligates DSB ends and thus may lead to gene deletions or additions. In contrast, HR repair is an accurate process that uses the sister chromatid as a template to repair damaged DNA [5]. During HR repair, the MRE11-RAD50-NBS1 (MRN) complex is immediately recruited to DSB sites and initiates limited end resection at DSB ends [6]. With the additional recruitment of the nuclease CtBP-interacting protein (CtIP), the DNA replication ATP-dependent helicase/nuclease DNA2, and exonuclease 1 (EXO1), extensive end resection is achieved, generating 3′ single-stranded DNA (ssDNA) overhangs [7]. The ssDNA is immediately coated with replication protein A (RPA), which is then replaced by RAD51 to form nucleoprotein filaments, which are essential for pairing the ssDNA with homologous DNA [ 8, 9].

The DNA damage response (DDR) is regulated by RNAs and proteins. In 1996, the indirect involvement of RNAs in NHEJ repair was initially reported in yeast [ 10, 11]. Specifically, complementary DNAs formed by the reverse transcription of RNAs are inserted into break sites in the absence of HR repair. Later, RNAs were demonstrated to directly regulate the DDR by serving as DNA synthesis templates for the repair of DSBs in yeast and human cells [ 12, 13]. Small non-coding RNAs produced by DICER and DROSHA, known as DNA damage response RNAs, are required for DDR foci formation at DSB sites [ 14, 15]. In addition, nascent mRNA generated during active transcription guides the recruitment of RAD52 to DSB sites, thus promoting HR repair in differentiated neurons [16]. Recently, DR-loop structures generated by RNA transcripts in conjunction with RAD51 and RAD51AP1 have been demonstrated to stimulate HR repair in human cells [17]. These RNAs may serve as guide molecules that direct chromatin remodeling and/or the recruitment of protein complexes to DSB sites to facilitate repair. Given the contribution of RNA to the DDR, it would not be unexpected for RNA binding proteins (RBPs) to play important roles in DSB repair. Indeed, approximately 40 of the > 4000 RBPs identified in human cells have been implied to directly or indirectly regulate the DDR [18]. For example, both RNA binding motif protein X (RBMX) and RNA-binding protein fused in sarcoma/translocated in liposarcoma (FUS) are recruited to DNA damage sites in a poly (ADP-ribose) polymerase 1 (PARP1)-dependent manner. RBMX promotes RAD51 foci formation via regulation of BRCA2 expression [19], while FUS promotes NBS1, KU80, and 53BP1 recruitment to damage sites to facilitate both NHEJ and HR repair [ 20, 21]. As a FUS-interacting protein, RNA-binding motif protein 45 (RBM45) is also essential for NHEJ and HR repair [22]. In addition, heterogeneous nuclear ribonucleoprotein D0 (HNRNPD) has been found to promote HR repair via DNA end resection and, together with HNRNPU, to accelerate the removal of R-loop structures to maintain genome stability [23]. Recently, Zhu et al. [24] reported that HNRNPA2B1 inhibits HR repair in a SUMOylation-dependent manner through modulating RPA availability upon DNA damage. Given these findings, we anticipate that more RBPs will be found to participate in the DDR via various mechanisms.

Increasing our understanding of HR repair will eventually advance cancer treatments. In this study, we aimed to identify new RBPs in HR repair. To achieve this, we used an RPA-coated ssDNA/dsDNA structure to mimic resected DSB ends [25] and used it to pull down potential HR proteins. We then performed mass spectrometric analysis to identify the proteins in the resulting complexes. Having identified the RBP RBM14 as a novel HR factor, we carried out an HR reporter system, laser irradiation-induced recruitment, proximity ligation assays (PLAs) and immunofluorescence (IF) to examine its mechanism of action.

Materials and Methods

Cell culture

Human HeLa, HEK293T, and DR-U2OS cells (ATCC, Manassas, USA) were cultured in DMEM (HyClone, Logan, USA) supplemented with 10% fetal bovine serum (FBS; ABW, Montevideo, Uruguay) and 1% penicillin/streptomycin (HyClone) at 37°C with 5% CO 2.

Reagent and resource

Protein A Sepharose and Protein G Sepharose were purchased from General Electric (Fairfield, USA). YF-594/647A Click-iT EdU imaging kits were purchased from Everbright Inc (Silicon Valley, USA). The HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) was purchased from Vazyme Biotech (Nanjing, China).

Immunoblotting assay

Cell lysates were mixed with 6×SDS loading buffer (62.5 mM Tris-HCl, pH 6.8, 2% sodium dodecyl sulfate, 0.05% bromophenol blue, 20% glycerol, and 5% β-mercaptoethanol) and boiled for 5 min. Samples were separated by SDS-PAGE and then transferred to PVDF membrane, followed by blocking with 3% non-fat milk in 0.1% PBST buffer. After that, the membranes were incubated with the indicated antibodies overnight at 4°C, washed three times with PBST buffer, and blotted with the corresponding secondary antibodies for 1 h at room temperature. After extensive wash, the blots on membranes were analysed with a FUJIFILM imaging system (FUJIFILM, Tokyo, Japan).

Antibodies

The following antibodies were used in this study: anti-FLAG M2 (Sigma-Aldrich, St Louis, USA), anti-RBM14 (Abclonal, Wuhan, China), anti-Actin (Sigma-Aldrich), anti-BRCA1 (Proteintech, Chicago, USA), anti-RPA70 (Abclonal), anti-GST (MBL, Tokyo, Japan), anti-His (MBL), anti-RPA32 (Bethyl, Montgomery, USA), anti-pRPA32 S33 (Bethyl), anti-ATM (Bethyl), anti-pATM S1981 (Abcam, Cambridge, UK), anti-CldU (Abcam), anti-RAD51 (Abcam), anti-MRE11 (Bethyl), anti-RAD50 (Bethyl), anti-NBS1 (Bethyl), anti-CTIP (Santa Cruz Biotech, Santa Cruz, USA), anti-gamma H2AX (CST, Danvers, USA), fluorescein (FITC)-AffiniPure anti-rabbit IgG (H+L) (Jackson ImmunoResearch, Philadelphia, USA), and Alexa Fluorescein 594-AffiniPure anti-mouse IgG (H+L) (Jackson ImmunoResearch), Peroxidase AffiniPure donkey anti-rabbit IgG (H+L) (Jackson ImmunoResearch), and Peroxidase AffiniPure goat anti-mouse lgG (H+L) (Jackson ImmunoResearch).

Plasmids, siRNAs, shRNA and transfection

A full-length cDNA clone encoding human RBM14 was amplified by PCR and subcloned into the pcDNA 3.0 3×FLAG vector and Lenti-Blast-Flag vector. Bacterially expressed GST-tagged RBM14 and His-tagged RPA32 were generated using pGEX-4T-1 and pET28a vectors. The siRNA oligonucleotides against RBM14 (siRBM14-1# target sequence: 5′-GTAACCAGCCATCCTCTTA-3′, siRBM14-2# target sequence: 5′-CCAGGCAGCTTCATATAAT-3′) and negative control (siNC target sequence: 5′-CGUACGCGGAAUACUUCGA-3′) were purchased from Guangzhou RiboBio (Guangzhou, China). The shRNA targeted the same sequence as siRBM14-1# and siNC. All transfections in this study were performed using polyethylenimine (Polysciences, Warrington, USA) for plasmids and siRNA transfection reagent (Polyplus, Strasbourg, France) for siRNA.

Immunoprecipitation assay

Cells were harvested 48 h after transfection with or without IR treatment and lysed in washing buffer (150 mM NaCl, 50 mM Tris, pH 7.5, 0.5% NP-40, and 5 mM EDTA) for 30 min on ice. After centrifugation, the lysates were subjected to immunoprecipitation with antibody at 4°C overnight. Finally, protein A/G agarose beads were added to the lysates and incubated for 1 h, and then washed three times with ice-cold lysis buffer. The beads were boiled in SDS-sample buffer for 10 min and subjected to immunoblotting analysis afterwards.

Protein purification

GST-tagged RBM14 and His-tagged RPA32 were expressed in BL21 cells, which were then sonicated. The tagged proteins were purified using Glutathione-Sepharose 4B agarose (GE Healthcare, Chicago, USA) and Ni-NTA agarose (Qiagen, Dusseldorf, Germany).

HR repair

HR repair of DSBs was detected by using DR-U2OS cells containing a DRGFP reporter gene. Briefly, cells were transfected with siRNA and plasmids and then infected with I-SceI lentivirus for 48 h before analysing the percentage of GFP-positive cells by flow cytometry.

Proximity ligation assay

Cells were fixed with 4% paraformaldehyde at room temperature for 10 min and permeabilized with 0.25% Triton X-100 for 5 min. After being blocked with 2% BSA for 30 min, cells were incubated with primary antibodies at 4°C overnight. Subsequently, PLA assays were carried out using the Duolink In Situ Red Starter kit (Sigma-Aldrich) according to the manufacturer’s instructions.

ssDNA/dsDNA pulldown assays

ssDNA/dsDNA pulldown assays were performed as previously described [26] . In brief, biotinylated DNA oligomers (sense strand: 5′-AACCTGTCGTGCCAGCTGCA-biotin-3′; anti-sense strand: 5′-TGCAGCTGGCACGACAGGTTTTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCGCAG CGAGTC-3′) were annealed to generate ssDNA/dsDNA. The ssDNA/dsDNA product was incubated with streptavidin-M280 beads, followed by washing with NETN buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10% glycerol, and 0.01% Nonidet P-40) containing 10 mg/mL BSA and then coated with bacterial-produced RPA70 and RPA32. The RPA-ssDNA/dsDNA was incubated with HEK293T cell lysates, followed by three times wash with NETN buffer. Proteins bound to beads were then subjected to mass spectrometry.

Immunofluorescence assay

HeLa cells were grown on coverslips, fixed in 4% paraformaldehyde at room temperature for 15 min, and then permeabilized with 0.25% Triton X-100 in PBS for 5 min. Then, the cells were blocked with 2% bovine serum albumin (BSA) in PBST for 30 min and incubated with primary antibodies at 4°C overnight; the next day, the cells were incubated with secondary antibodies for 50 min at 37°C and stained with DAPI for 2 min. After three times wash in PBST protected from light, the coverslips were covered with antifade and stored at –20°C. Images were captured using the DragonFly confocal imaging system (Andor, Belfast, UK).

For CldU incorporation, HeLa cells were cultured in medium containing CldU (10 μM) for 24 h and then rinsed three times with PBS. The cells were then labelled with EdU (50 μM) for 2 h, followed by 5-Gy IR treatment and recovery for 6 h. After fixation, permeabilization, and blocking, the cells were treated according to the procedure described in the YF-561A Click-iT EdU imaging Kit (Everbright Inc) and further incubated with an anti-CldU antibody at 4°C overnight. The cells were then incubated with appropriate secondary antibodies for 50 min at 37°C and stained with DAPI for 2 min. After three-time wash in PBST protected from light, the coverslips were covered with antifade and stored at –20°C before imaging analysis. Images were captured using the DragonFly confocal imaging system (Andor, Belfast, UK).

UV microirradiation

U2OS cells expressing GFP-tagged proteins were seeded in glass-bottomed confocal dishes (NEST, Shanghai, China) and irradiated with a 365 nm UV laser generated from a Micropoint System (Andor). Images were captured every 10 sec using the DragonFly confocal imaging system (Andor). Fluorescence intensity was analysed using ImageJ software.

Comet assay

After treatment, HeLa cells were harvested and resuspended in PBS at a concentration of 5×10 5 cells/mL. Then, 3000 cells were mixed with 100 μL low melting-point agarose, added onto pre-warmed slides, and incubated at 4°C for 10 min. Subsequently, the cells were lysed in lysis buffer at 4°C overnight, washed with ddH 2O, and subjected to electrophoresis for 40 min at 25 V and 300 mA. After neutralization and drying, the DNA was stained with propidium iodide (5 μg/mL) for 20 min, and images were captured with a fluorescence microscope (Olympus, Tokyo, Japan). Tail length was measured using ImageJ software.

Colony formation assay

HeLa cells were separated and grown in 6-well plates at a density of 200 cells per well. Then, the cells were exposed to 0, 1, 2, or 4 Gy IR and cultured for 10 days. The resulting colonies were stained with crystal violet and counted.

Statistical analysis

Data were expressed as the mean±SD and analysed using GraphPad Prism software. A two-tailed non-paired Student’s t test was used to determine statistical significance. P<0.05 was considered statistically significant.

Results

RBM14 promotes HR repair

To identify new HR factors, we constructed an RPA-coated ssDNA/dsDNA structure to mimic a resected DSB end ( Figure 1A). This construct was used as a bait to pull down potential binding partners from total cell lysates extracted from 293T cells. Mass spectrometric analysis of the pulldown complexes identified the HR factors RPA14, RPA32, RPA70, and the RBP RBMX, as well as several RBPs not known to play a role in HR-mediated DSB repair, including RBM14, RBM4, and RBM39 ( Figure 1B). Analysis of data obtained from The Cancer Genome Atlas ( http://gepia.cancer-pku.cn) showed that high RBM14 level is correlated with poor overall survival in patients with adrenocortical carcinoma, brain lower grade glioma, and liver hepatocellular carcinoma ( Supplementary Figure S1). These findings implicated RBM14 as a potential prognostic factor and therapeutic target for these cancer patients. Thus, we selected RBM14 for further analysis to dissect its potential function in HR-mediated DSB repair. First, we used an HR reporter system ( Figure 1C), whereby cells would be repaired by HR after I-SceI-induced DSB and presented a GFP-positive signal. We found that siRNA-mediated inhibition of RBM14 expression significantly compromised HR repair efficiency and caused a decrease in pRPA32(S33) protein level upon I-SceI expression ( Supplementary Figure S2A,B). This reduction in HR repair efficiency was rescued by co-expression of an siRNA-resistant form of FLAG-RBM14 ( Figures 1D,E), indicating that RBM14 is indeed an HR factor.

Figure 1 .

Figure 1

Open in a new tab

RBM14 promotes HR repair

(A) Screening strategy for potential factors binding to the end-resected DNA structure. Annealed ssDNA/dsDNA was coated with RPA protein and served as a bait to pull down targets from cell lysates. (B) Representative proteins enriched from HEK293T cell lysates by RPA-coated ssDNA/dsDNA. (C) Schematic representation of the homologous recombination (HR) repair system in DR-U2OS cells. The GFP-positive cells were recorded by flow cytometry at 48 h after I-SceI transfection. (D) RBM14 depletion decreases HR repair efficiency. DR-U2OS cells were transfected with an siRNA oligo targeting RBM14 (siRBM14-1#), a non-targeting control (siNC), or an siRNA-resistant plasmid (FLAG-RBM14)+siRBM14 for 24 h. Then, the cells were infected with I-SceI lentivirus for 48 h before analysis of GFP-positive cells by flow cytometry. Three independent experiments were performed, and the data were analysed using GraphPad. **P<0.01, ***P<0.001. (E) Immunoblotting of RBM14 protein levels in DR-U2OS cells derived from the cells used in (D). (F) Representative image of FLAG/BRCA1 proximity ligation assay (PLA) foci. FLAG-VEC- or FLAG-RBM14-transfected HeLa cells were treated with or without X-ray irradiation (5 Gy), fixed, and then incubated with anti-FLAG antibody and anti-BRCA1 antibody. PLA foci are in red. Scale bar, 5 μm. (G) Quantification of average PLA foci numbers per cell in (F). **P<0.01. (H) Representative image of FLAG/RPA32 PLA foci. FLAG-VEC- or FLAG-RBM14-transfected HeLa cells were treated with or without X-ray irradiation (5 Gy), fixed, and then incubated with anti-FLAG antibody and anti-RPA32 antibody. PLA foci are in red. Scale bar, 5 μm. (I) Quantification of average PLA foci numbers per cell in (H). **P<0.01. (J) RBM14 interacts with the BRCA1-C complex. HEK293T cells were transfected with FLAG-tagged RBM14 for 48 h and harvested. The cell lysates were subjected to immunoprecipitation with anti-FLAG antibody, followed by immunoblotting with the indicated antibodies. (K) RBM14 interacts with HR proteins. HEK293T cells were treated with or without X-ray irradiation (5 Gy) and harvested. The cell lysates were subjected to immunoprecipitation with anti-IgG or anti-RBM14, followed by immunoblotting with the indicated antibodies.

Next, to determine whether RBM14 interacts with HR factors in situ, we carried out proximity ligation assays (PLAs). These assays revealed that the levels of both FLAG-RBM14/BRCA1 PLA foci ( Figure 1F,G) and FLAG-RBM14/RPA32 PLA foci ( Figure 1H,I) were significantly increased in HeLa cells expressing FLAG-RBM14 6 h after 5-Gy irradiation. These findings indicated that RBM14 interacts with BRCA1 and RPA32 in situ. Using co-immunoprecipitation assays, we further showed that the endogenous nucleases for end resection, i.e., the MRE11/NBS1/RAD50 complex and CtIP, were present within the FLAG-RBM14 immunocomplexes ( Figure 1J). Moreover, the levels of endogenous BRCA1/2 and RPA32/70 in the RBM14 immunocomplexes were markedly increased in 293T cells at 6 h after 10-Gy irradiation ( Figure 1K). Taken together, these results demonstrated that RBM14 promotes HR-mediated DSB repair, likely by ensuring proper end resection.

RBM14 promotes CtIP recruitment to DNA damage sites

DSB end resection is initiated by the MRE11-RAD50-NBS1/CtIP/BRCA1 complex (BRCA1-C) and extended with the additional recruitment of EXO1 and DNA2 nucleases. We thus asked whether RBM14 plays a role in the recruitment of these nucleases to DNA damage sites. By carrying out co-immunoprecipitation assays in 293T cells and using antibodies against endogenous proteins, we confirmed a physical interaction between RBM14 and CtIP that was induced by IR treatment ( Figure 2A). In addition, inhibition of RBM14 expression in HeLa cells by shRNA targeting its CDS impaired the recruitment of GFP-CtIP to UV laser-induced damage stripes; this recruitment defect was corrected by re-expression of the shRNA-resistant form of FLAG-RBM14 ( Figure 2B). In contrast, inhibition of RBM14 expression did not significantly affect the recruitment of GFP-MRE11 ( Supplementary Figure S3A). Using FLAG-RBM14 for further co-immunoprecipitation assays, we showed that the interaction with endogenous CtIP was increased 1 h and 3 h after 5-Gy irradiation ( Figure 2C). As expected, we also observed that the recruitment of EXO1 nuclease (which is involved in extended resection) was decreased in RBM14-depleted cells ( Supplementary Figure S3B). NBS1 is important for recruiting CtIP to DSB sites, and the interaction between BRCA1 and CtIP stimulates efficient end resection [ 27, 28]. Thus, we wanted to determine whether RBM14 regulates the interaction of CtIP with other components of the BRCA1-C complex. Co-immunoprecipitation assays showed that inhibition of RBM14 expression by siRNA decreased the interaction of CtIP with NBS1, BRCA1, and RPA32 ( Figure 2D). Collectively, these results showed that RBM14 plays an essential role in CtIP recruitment to damage sites by promoting the interaction of CtIP with NBS1 and BRCA1.

Figure 2 .

Figure 2

Open in a new tab

RBM14 promotes DNA end resection

(A) Endogenous interaction between CTIP and RBM14. HEK293T cells were lysed 30 min after IR treatment (5 Gy) and immunoprecipitated with CTIP antibody, followed by immunoblotting with the indicated antibodies. (B) CTIP recruitment to DNA damage sites is RBM14-dependent. HeLa cells transfected with GFP-CTIP were exposed to UV laser irradiation, and recruitment to the DNA damage sites was captured every 10 s. Quantification of GFP intensity is shown on the right. Scale bar, 5 μm. (C) IR treatment increases the interaction between RBM14 and CTIP. FLAG-VEC- or FLAG-RBM14-transfected HEK293T cells were treated with or without X-ray irradiation (5 Gy). After 20 min, cells were harvested and lysed in 150 mM NaCl-containing lysis buffer. Cell lysates were incubated with CTIP antibody and then subjected to immunoblotting with the indicated antibodies. (D) RBM14 depletion compromises the interaction of CTIP with NBS1, BRCA1, and RPA32 proteins. RBM14-depleted HEK293T cells were harvested and subjected to immunoprecipitation with anti-CTIP antibody, followed by immunoblotting with the indicated antibodies.

RBM14 promotes RPA32 loading onto resected DSB ends

Resected and subsequently exposed ssDNA at DSB ends requires immediate protection by RPA protein loading [29]. Given that we had shown an interaction between endogenous RBM14 and RPA32 in vivo ( Figure 1K), we went on to use bacterially synthesized recombinant GST-RBM14 protein to pull down bacterially produced recombinant His-tagged RPA32 ( Figure 3A). The results indicated a direct interaction between RBM14 and RPA32. We then knocked down RBM14 in HeLa cells using shRNA and found that, compared with mock-depleted cells, RBM14-knockdown cells expressed markedly lower levels of phosphorylated RPA32 (S33) protein following IR treatment (5 Gy) for 6 h; this reduction was rescued by the co-transfection of an shRNA-resistant form of RBM14 ( Figure 3B). Next, we analysed ssDNA formation generated by DNA end resection after DNA damage. First, we incubated HeLa cells in medium containing 10 μM CldU for 24 h to ensure that the whole genome was labelled before IR treatment. Then, immunofluorescence staining revealed that 6 h after 5-Gy IR, there were significantly fewer CldU foci in gamma-H2AX-positive RBM14-depleted cells than in mock-depleted cells. Moreover, this reduction was restored by co-transfection with shRNA-resistant form of FLAG-RBM14 ( Figure 3C). These results indicated that RBM14 promotes DNA end resection after DNA damage.

Figure 3 .

Figure 3

Open in a new tab

RBM14 interacts with CTIP and promotes CTIP recruitment to DSB sites

(A) RBM14 directly interacts with RPA32. Bacterially produced GST-tagged RBM14 protein was incubated with His-tagged RPA32 protein at 4°C overnight, pulled down using GST beads, and subjected to immunoblotting with the indicated antibodies. (B) RBM14 depletion decreases RPA32 phosphorylation without affecting ATM activation. HeLa cells were transfected with a non-targeting control (shNC), shRNA targeting RBM14 (shRBM14), or shRNA-resistant plasmid (FLAG-RBM14)+ shRBM14 cells (shRBM14-res). Total cell lysates were harvested at different time points after X-ray irradiation treatment and subjected to immunoblotting with the indicated antibodies. (C) Knockdown of RBM14 inhibits ssDNA formation after IR treatment. shNC, shRBM14, or shRBM14-res cells were incubated with CldU for 24 h and then exposed to X-ray irradiation. After 6 h, the cells were fixed and labelled with the indicated antibodies. Quantification of the CldU foci in gamma-H2AX-positive cells is shown in the panel on the right. ****P<0.001. Scale bar, 5 μm. (D) RBM14 depletion reduces IR-induced RPA32 foci. shNC, shRBM14, or shRBM14-res cells were incubated with EdU for 2 h to label S phase cells and then exposed to X-ray irradiation. After 6 h, the cells were fixed and incubated with the indicated antibodies. Quantification of RPA32 foci in EdU-positive cells is shown in the panel on the right. ****P<0.001. Scale bar, 2 μm. (E) RBM14 depletion decreases IR-induced RAD51 foci. Cells were treated as described in (D); quantification of RAD51 foci in EdU-positive cells is shown in the panel on the right. ****P<0.001. Scale bar, 5 μm.

Following the initial coating of the resected DNA ends, the RPA complex is subsequently replaced by RAD51 protein to form RAD51 filaments. As HR repair is restricted to the S/G2 phase, HeLa cells were incubated in medium containing 5-ethynyl-2′-deoxyuridine (EdU) for 2 h. Immunofluorescence staining (without DNA hydrolysis and before cell fixation) revealed that 6 h after 5-Gy IR, the numbers of both RPA32 foci and RAD51 foci were significantly lower in EdU-positive RBM14-depleted cells than in EdU-positive mock-depleted cells. Again, this reduction was restored by the transfection with the shRNA-resistant form of FLAG-RBM14 ( Figure 3D,E). Thus, these results demonstrated that RBM14 promotes DNA end resection and subsequent loading of RPA, thereby facilitating HR repair.

RBM14 promotes DNA repair and cell survival

Efficient HR repair is important for maintaining genome stability and integrity. To examine whether damage is repaired, we analysed the level of gamma-H2AX, a marker for DSBs, in IR-treated cells. In mock-depleted cells, gamma-H2AX level was increased at 1 h after 5-Gy IR, reduced at 6 h, and imperceptible at 12 h. In contrast, in RBM14-depleted cells, gamma-H2AX level remained high at 12 h after IR treatment, while the original pattern was almost fully restored by the co-transfection with shRNA-resistant form of FLAG-RBM14 ( Figure 4A). Next, using comet assays to analyse broken DNA, we showed that 4 h after 5-Gy IR, the tail moment was significantly increased in RBM14-depleted cells compared with that in mock-depleted cells; this increase was fully rescued by the co-transfection with the shRNA-resistant form of FLAG-RBM14 ( Figure 4B). These results demonstrated that inhibition of RBM14 expression impairs the efficient repair of damaged DNA. Finally, clonogenic assays showed that RBM14-depleted cells displayed a dose-dependent sensitivity to X-ray irradiation that was almost fully corrected by the co-transfection with shRNA-resistant form of FLAG-RBM14 ( Figure 4C,D). In conclusion, these results demonstrated that RBM14 promotes efficient DNA repair and cell survival.

Figure 4 .

Figure 4

Open in a new tab

RBM14 promotes DNA repair and cell survival

(A) Knockdown of RBM14 inhibits the recovery of gamma-H2AX level following IR-induced DNA damage. shNC, shRBM14, or shRBM14-res cells were exposed to X-ray irradiation treatment (5 Gy) for the indicated lengths of time. Total cell lysates were subjected to immunoblotting with the indicated antibodies. (B) Representative images of comet assays conducted on shNC, shRBM14, and shRBM14-res cells 4 h after X-ray irradiation (5 Gy). Genomic DNA was stained with propidium iodide. Quantification of tail length is shown on the right. Scale bar, 30 μm. (C) Representative images of colony formation in shNC, shRBM14, and shRBM14-res cells following the indicated doses of X-ray irradiation. (D) Quantification of the colony numbers in (C).

Discussion

RBM14 was originally identified as a splicing factor that regulates transcription and alternative splicing [ 30– 33]. Subsequently, it has been shown to be a multifunctional RBP involved in a variety of cellular processes, including stem cell differentiation [ 34– 36], viral gene expression [ 37, 38], immune response [ 39, 40], and mitotic spindle morphology [ 41 , 42]. In addition, previous studies have shown that RBM14 plays a role in NHEJ repair [ 43, 44]. Here, we carried out a series of in vivo assays to demonstrate that RBM14 also contributes to DNA repair mediated by HR.

RBM14 was previously reported to be recruited to DSB sites in a KU80-, RNA pol II-, and PARP-dependent manner and to facilitate NHEJ repair by promoting DNA-PKcs autophosphorylation and chromatin loading of X-ray repair cross complementing 4 (XRCC4) and XRCC4-like factor (XLF) [ 43, 44]. In this study, we demonstrated that RBM14 was recruited to DSB sites in an MRN-dependent manner and promoted the interaction of CtIP with the MRN complex, initiating 5′ end resection. In addition, we showed that RBM14 recruited the nuclease EXO1 to the damage site and facilitated subsequent RPA loading and RAD51 replacement. Therefore, RBM14 is a new component of the BRCA1 C complex, promoting HR-mediated DSB repair ( Figure 5).

Figure 5 .

Figure 5

Open in a new tab

Working model of RBM14 in promoting homologous recombination repair

Left: wild-type cell. Upon ionizing radiation-induced DNA damage, the MRN complex is recruited to double-strand break (DSB) sites. Subsequently, CtIP is recruited via RBM14 to facilitate end resection. Efficient HR repair then promotes genomic stability. Right: RBM14-depleted cells. After DNA damage, although the MRN complex is still recruited to DSB sites, CtIP is not recruited. Without CtIP, DNA end resection is limited, and HR repair is deficient, leading to genomic instability.

Unlike FUS and RBM45 which function in both HR and NHEJ repair, RBM14 only promotes HR repair. This may be due to the different complexes formed by those RBPs and other DDR factors.

RBM14 has been defined as an oncogene [ 34, 45, 46]. It is highly expressed in various cancers, including cholangiocarcinoma, esophageal carcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, acute myeloid leukemia, stomach adenocarcinoma, thymoma, and pancreatic adenocarcinoma (from the GEPIA database, http://gepia.cancer-pku.cn). Our analyses showed that high RBM14 expression level is correlated with poor survival in liver hepatocellular carcinoma, adrenocortical carcinoma, and brain lower grade glioma. Consistent with our findings, previous studies have also shown its correlation with poor survival in liver hepatocellular carcinoma and pancreatic adenocarcinoma [ 47, 48]. This association with poor survival could be explained by the fact that RBM14 promotes both HR and NHEJ repair, which may confer resistance to radiotherapy and DNA damage-based chemotherapy on cancer cells. Given that we also showed that inhibition of RBM14 expression sensitized cancer cells to IR, RBM14 may also serve as a potential anti-cancer therapeutic target.

However, many questions remain to be answered. Do RNA binding capacity and/or specific species of RNAs support RBM14 function in HR repair? Does RBM14 participate in DNA replication? In this study, we found a direct interaction between RBM14 and RPA32 in vitro, and the PLA signal between RBM14 and RPA32 existed under unperturbed conditions. Does RBM14-mediated HR repair correlate with R-loops? It has been established that RBM14 is enriched in the R-loop structure and that CtIP binds to RNA pol II at damage sites [ 49– 51]. Does RBM14 interact with other RBPs in DNA repair? We will focus on these aspects in the future to obtain a better understanding of RBM14 function in DNA repair and tumorigenesis.

In conclusion, this study has expanded our understanding of the role of RBM14 in DNA repair and highlighted its potential as a possible prognostic factor and therapeutic target in cancer treatment.

Supporting information

Supplementary
Supplementary.pdf (306.7KB, pdf)

Acknowledgments

The authors would like to thank all members of the Xu laboratory for their help and useful discussions.

Supplementary Data

Supplementary data is available at Acta Biochimica et Biophysica Sinica online.

COMPETING INTERESTS

The authors declare that they have no conflict of interest.

Funding Statement

This work was supported by the grants from the National Natural Science Foundation of China (Nos. 32090031, 31761133012 and 31530016), Shenzhen Science and Technology Innovation Commission Projects (Nos. JCYJ20220818095616035 and JCYJ201805073000163), and the startup fund for the sgh-dhhCPM from Dehua Hospital.

References

  • 1.Tubbs A, Nussenzweig A. Endogenous DNA damage as a source of genomic instability in cancer. Cell. . 2017;168:644–656. doi: 10.1016/j.cell.2017.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Carusillo A, Mussolino C. DNA damage: from threat to treatment. Cells. . 2020;9:1665. doi: 10.3390/cells9071665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ciccia A, Elledge SJ. The DNA damage response: making it safe to play with knives. Mol Cell. . 2010;40:179–204. doi: 10.1016/j.molcel.2010.09.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Scully R, Panday A, Elango R, Willis NA. DNA double-strand break repair-pathway choice in somatic mammalian cells. Nat Rev Mol Cell Biol. . 2019;20:698–714. doi: 10.1038/s41580-019-0152-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Oh JM, Myung K. Crosstalk between different DNA repair pathways for DNA double strand break repairs. Mutat Res Genet Toxicol Environ Mutagenesis. . 2022;873:503438. doi: 10.1016/j.mrgentox.2021.503438. [DOI] [PubMed] [Google Scholar]
  • 6.Li N, Chen H, Wang J. DNA damage and repair in the hematopoietic system. Acta Biochim Biophys Sin. . 2022;54:847–857. doi: 10.3724/abbs.2022053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wright WD, Shah SS, Heyer WD. Homologous recombination and the repair of DNA double-strand breaks. J Biol Chem. . 2018;293:10524–10535. doi: 10.1074/jbc.TM118.000372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Daley JM, Gaines WA, Kwon Y, Sung P. Regulation of DNA pairing in homologous recombination. Cold Spring Harb Perspect Biol. . 2014;6:a017954. doi: 10.1101/cshperspect.a017954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhang H, Chen Y, Jiang Y, Mao Z. DNA double-strand break repair and nucleic acid-related immunity. Acta Biochim Biophys Sin. . 2022;54:828–835. doi: 10.3724/abbs.2022061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Moore JK, Haber JE. Capture of retrotransposon DNA at the sites of chromosomal double-strand breaks. Nature. . 1996;383:644–646. doi: 10.1038/383644a0. [DOI] [PubMed] [Google Scholar]
  • 11.Teng SC, Kim B, Gabriel A. Retrotransposon reverse-transcriptase-mediated repair of chromosomal breaks. Nature. . 1996;383:641–644. doi: 10.1038/383641a0. [DOI] [PubMed] [Google Scholar]
  • 12.Storici F, Bebenek K, Kunkel TA, Gordenin DA, Resnick MA. RNA-templated DNA repair. Nature. . 2007;447:338–341. doi: 10.1038/nature05720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Shen Y, Nandi P, Taylor MB, Stuckey S, Bhadsavle HP, Weiss B, Storici F. RNA-driven genetic changes in bacteria and in human cells. Mutat Res. . 2011;717:91–98. doi: 10.1016/j.mrfmmm.2011.03.016. [DOI] [PubMed] [Google Scholar]
  • 14.Francia S, Michelini F, Saxena A, Tang D, de Hoon M, Anelli V, Mione M, et al. Site-specific DICER and DROSHA RNA products control the DNA-damage response. Nature. . 2012;488:231–235. doi: 10.1038/nature11179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wei W, Ba Z, Gao M, Wu Y, Ma Y, Amiard S, White CI, et al. A role for small RNAs in DNA double-strand break repair. Cell. . 2012;149:101–112. doi: 10.1016/j.cell.2012.03.002. [DOI] [PubMed] [Google Scholar]
  • 16.Welty S, Teng Y, Liang Z, Zhao W, Sanders LH, Greenamyre JT, Rubio ME, et al. RAD52 is required for RNA-templated recombination repair in post-mitotic neurons. J Biol Chem. . 2018;293:1353–1362. doi: 10.1074/jbc.M117.808402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ouyang J, Yadav T, Zhang JM, Yang H, Rheinbay E, Guo H, Haber DA, et al. RNA transcripts stimulate homologous recombination by forming DR-loops. Nature. . 2021;594:283–288. doi: 10.1038/s41586-021-03538-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Klaric JA, Wüst S, Panier S. New faces of old friends: emerging new roles of RNA-binding proteins in the DNA double-strand break response. Front Mol Biosci. . 2021;8:668821. doi: 10.3389/fmolb.2021.668821. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Adamson B, Smogorzewska A, Sigoillot FD, King RW, Elledge SJ. A genome-wide homologous recombination screen identifies the RNA-binding protein RBMX as a component of the DNA-damage response. Nat Cell Biol. . 2012;14:318–328. doi: 10.1038/ncb2426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mastrocola AS, Kim SH, Trinh AT, Rodenkirch LA, Tibbetts RS. The RNA-binding protein fused in sarcoma (FUS) functions downstream of poly(ADP-ribose) polymerase (PARP) in response to DNA damage. J Biol Chem. . 2013;288:24731–24741. doi: 10.1074/jbc.M113.497974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Levone BR, Lenzken SC, Antonaci M, Maiser A, Rapp A, Conte F, Reber S, et al. FUS-dependent liquid–liquid phase separation is important for DNA repair initiation. J Cell Biol. . 2021;220 doi: 10.1083/jcb.202008030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gong J, Huang M, Wang F, Ma X, Liu H, Tu Y, Xing L, et al. RBM45 competes with HDAC1 for binding to FUS in response to DNA damage. Nucleic Acids Res. . 2017;45:12862–12876. doi: 10.1093/nar/gkx1102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Alfano L, Caporaso A, Altieri A, Dell’Aquila M, Landi C, Bini L, Pentimalli F, et al. Depletion of the RNA binding protein HNRNPD impairs homologous recombination by inhibiting DNA-end resection and inducing R-loop accumulation. Nucleic Acids Res. . 2019;47:4068–4085. doi: 10.1093/nar/gkz076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhu S, Hou J, Gao H, Hu Q, Kloeber JA, Huang J, Zhao F, et al. SUMOylation of HNRNPA2B1 modulates RPA dynamics during unperturbed replication and genotoxic stress responses. Mol Cell. . 2023;83:539–555.e7. doi: 10.1016/j.molcel.2023.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Maréchal A, Li JM, Ji XY, Wu CS, Yazinski SA, Nguyen HD, Liu S, et al. PRP19 transforms into a sensor of RPA-ssDNA after DNA damage and drives ATR activation via a ubiquitin-mediated circuitry. Mol Cell. . 2014;53:235–246. doi: 10.1016/j.molcel.2013.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wu X, Xu S, Wang P, Wang ZQ, Chen H, Xu X, Peng B. ASPM promotes ATR-CHK1 activation and stabilizes stalled replication forks in response to replication stress. Proc Natl Acad Sci USA. . 2022;119:e2203783119. doi: 10.1073/pnas.2203783119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Cruz-García A, López-Saavedra A, Huertas P. BRCA1 accelerates CtIP-mediated DNA-end resection. Cell Rep. . 2014;9:451–459. doi: 10.1016/j.celrep.2014.08.076. [DOI] [PubMed] [Google Scholar]
  • 28.Anand R, Jasrotia A, Bundschuh D, Howard SM, Ranjha L, Stucki M, Cejka P. NBS1 promotes the endonuclease activity of the MRE11-RAD50 complex by sensing CtIP phosphorylation. EMBO J. . 2019;38:e101005. doi: 10.15252/embj.2018101005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Huertas P. DNA resection in eukaryotes: deciding how to fix the break. Nat Struct Mol Biol. . 2010;17:11–16. doi: 10.1038/nsmb.1710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Li J, Wang C, Feng G, Zhang L, Chen G, Sun H, Wang J, et al. Rbm14 maintains the integrity of genomic DNA during early mouse embryogenesis via mediating alternative splicing . Cell Proliferation. . 2020;53:e12724. doi: 10.1111/cpr.12724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Auboeuf D, Hönig A, Berget SM, O′Malley BW. Coordinate regulation of transcription and splicing by steroid receptor coregulators. Science. . 2002;298:416–419. doi: 10.1126/science.1073734. [DOI] [PubMed] [Google Scholar]
  • 32.Auboeuf D, Dowhan DH, Li X, Larkin K, Ko L, Berget SM, O′Malley BW. CoAA, a nuclear receptor coactivator protein at the interface of transcriptional coactivation and RNA splicing. Mol Cell Biol. . 2004;24:442–453. doi: 10.1128/MCB.24.1.442-453.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhou LT, Ye SH, Yang HX, Zhou YT, Zhao QH, Sun WW, Gao MM, et al. A novel role of fragile X mental retardation protein in pre-mRNA alternative splicing through RNA-binding protein 14. Neuroscience. . 2017;349:64–75. doi: 10.1016/j.neuroscience.2017.02.044. [DOI] [PubMed] [Google Scholar]
  • 34.Yang Z, Sui Y, Xiong S, Liour SS, Phillips AC, Ko L. Switched alternative splicing of oncogene CoAA during embryonal carcinoma stem cell differentiation. Nucleic Acids Res. . 2007;35:1919–1932. doi: 10.1093/nar/gkl1092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Brooks YS, Wang G, Yang Z, Smith KK, Bieberich E, Ko L. Functional pre- mRNA trans-splicing of coactivator CoAA and corepressor RBM4 during stem/progenitor cell differentiation. J Biol Chem. . 2009;284:18033–18046. doi: 10.1074/jbc.M109.006999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chen G, Zhang D, Zhang L, Feng G, Zhang B, Wu Y, Li W, et al. RBM14 is indispensable for pluripotency maintenance and mesoderm development of mouse embryonic stem cells. Biochem Biophys Res Commun. . 2018;501:259–265. doi: 10.1016/j.bbrc.2018.04.231. [DOI] [PubMed] [Google Scholar]
  • 37.Budhiraja S, Liu H, Couturier J, Malovannaya A, Qin J, Lewis DE, Rice AP. Mining the human complexome database identifies RBM14 as an XPO1-associated protein involved in HIV-1 Rev function. J Virol. 2015, 89: 3557–3567 . [DOI] [PMC free article] [PubMed]
  • 38.Lee N, Yario TA, Gao JS, Steitz JA. EBV noncoding RNA EBER2 interacts with host RNA-binding proteins to regulate viral gene expression. Proc Natl Acad Sci USA. . 2016;113:3221–3226. doi: 10.1073/pnas.1601773113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Morchikh M, Cribier A, Raffel R, Amraoui S, Cau J, Severac D, Dubois E, et al. HEXIM1 and NEAT1 long non-coding RNA form a multi-subunit complex that regulates DNA-mediated innate immune response. Mol Cell. . 2017;67:387–399.e5. doi: 10.1016/j.molcel.2017.06.020. [DOI] [PubMed] [Google Scholar]
  • 40.Narabayashi H, Koma C, Nakata K, Ikegami M, Nakanishi Y, Ogihara J, Tsuda M, et al. Gut microbiota-dependent adaptor molecule recruits DNA methyltransferase to the TLR4 gene in colonic epithelial cells to suppress inflammatory reactions. Front Mol Biosci. . 2022;9:1005136. doi: 10.3389/fmolb.2022.1005136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Qin H, Qu Y, Yuan YF, Li YY, Qiao J. RBM14 modulates tubulin acetylation and regulates spindle morphology during meiotic maturation in mouse oocytes. Front Cell Dev Biol. . 2021;9:635728. doi: 10.3389/fcell.2021.635728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Shiratsuchi G, Takaoka K, Ashikawa T, Hamada H, Kitagawa D. RBM14 prevents assembly of centriolar protein complexes and maintains mitotic spindle integrity. EMBO J. . 2015;34:97–114. doi: 10.15252/embj.201488979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Simon NE, Yuan M, Kai M. RNA-binding protein RBM14 regulates dissociation and association of non-homologous end joining proteins. Cell Cycle. . 2017;16:1175–1180. doi: 10.1080/15384101.2017.1317419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jang Y, Elsayed Z, Eki R, He S, Du KP, Abbas T, Kai M. Intrinsically disordered protein RBM14 plays a role in generation of RNA:DNA hybrids at double-strand break sites. Proc Natl Acad Sci USA. . 2020;117:5329–5338. doi: 10.1073/pnas.1913280117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sui Y, Yang Z, Xiong S, Zhang L, Blanchard KL, Peiper SC, Dynan WS, et al. Gene amplification and associated loss of 5′ regulatory sequences of CoAA in human cancers. Oncogene. . 2007;26:822–835. doi: 10.1038/sj.onc.1209847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hu Y, Mu H, Deng Z. RBM14 as a novel epigenetic-activated tumor oncogene is implicated in the reprogramming of glycolysis in lung cancer. World J Surg Onc. . 2023;21:132. doi: 10.1186/s12957-023-02928-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kessler SM, Hosseini K, HusseinUK, Kim KM, List M, Schultheiss CS, Schulz MH, et al. Hepatocellular carcinoma and nuclear paraspeckles: induction in chemoresistance and prediction for poor survival. Cell Physiol Biochem. 2019, 52: 787–801 . [DOI] [PubMed]
  • 48.Xu D, Qin R, Li M, Shen J, Mao Y, Tang K, Zhang A, et al. Identification of a novel cell cycle-related risk signature predicting prognosis in patients with pancreatic adenocarcinoma. Medicine. . 2022;101:e29683. doi: 10.1097/MD.0000000000029683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Cristini A, Groh M, Kristiansen MS, Gromak N. RNA/DNA hybrid interactome identifies DXH9 as a molecular player in transcriptional termination and R-Loop-associated DNA damage. Cell Rep. . 2018;23:1891–1905. doi: 10.1016/j.celrep.2018.04.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Gómez-Cabello D, Pappas G, Aguilar-Morante D, Dinant C, Bartek J. CtIP-dependent nascent RNA expression flanking DNA breaks guides the choice of DNA repair pathway. Nat Commun. . 2022;13:5303. doi: 10.1038/s41467-022-33027-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yan Q, Wulfridge P, Doherty J, Fernandez-Luna JL, Real PJ, Tang HY, Sarma K. Proximity labeling identifies a repertoire of site-specific R-loop modulators. Nat Commun. . 2022;13:53. doi: 10.1038/s41467-021-27722-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary
Supplementary.pdf (306.7KB, pdf)

Articles from Acta Biochimica et Biophysica Sinica are provided here courtesy of Acta Biochimica et Biophysica Sinica Editorial Office

RESOURCES