Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Dec 1.
Published in final edited form as: Exp Eye Res. 2023 Nov 11;237:109721. doi: 10.1016/j.exer.2023.109721

Blockade of interleukin-6 trans-signaling prevents mitochondrial dysfunction and cellular senescence in retinal endothelial cells

Jessica M Hoffman 1,*, Rebekah Robinson 2, Grace Greenway 2, Joshua Glass 2, Stepan Budkin 2, Shruti Sharma 2,3,*
PMCID: PMC10759313  NIHMSID: NIHMS1945897  PMID: 37956941

Abstract

Interleukin-6 (IL-6) is a multifaceted cytokine implicated in the pathogenesis of diabetic retinopathy (DR). Its activity extends through cis- and trans-signaling (TS) pathways, with cis-signaling limited to specific cell types possessing the membrane-bound IL-6 receptor, while trans-signaling broadly activates various cells without the membrane bound IL-6 receptor, including retinal endothelial cells. In this study, we determined the effects of interleukin-6 trans-signaling on mitochondrial dysfunction and cellular senescence in retinal endothelial cells. Human retinal endothelial cells (HRECs) were cultured and treated with IL-6 + soluble IL-6R or Hyper IL-6 to activate trans-signaling, and with sgp130Fc for inhibition. RT-PCR was conducted to analyze gene expression changes, primarily associated with inflammation and senescence. Cellular senescence was assessed using SA β-gal staining. Mitochondrial function was evaluated using Seahorse XFe24 Bioanalyzer. IL-6 trans-signaling induced inflammatory gene expression as indicated by the upregulation of ICAM1, MCP1, and SERPINA3 levels. Additionally, it reduced mitochondrial respiration and oxidative phosphorylation, and these effects were counteracted by sgp130Fc. Moreover, IL-6 trans-signaling led to altered expression of apoptosis-associated genes, including downregulation of FIS1, BCL2, and MCL1, while promoting cellular senescence, a phenomenon mitigated by sgp130Fc. These results not only deepen our understanding of IL-6 in DR but also carry broader implications for age-related diseases and the aging process itself. This study underscores the potential therapeutic value of targeting IL-6 trans-signaling with sgp130Fc as a promising anti-inflammatory approach for DR and potentially other inflammatory conditions. Further in-vivo investigations are warranted to elucidate the function of IL-6 trans-signaling in aging-related pathologies and overall organismal health.

Keywords: IL-6 trans-signaling, endothelial cells, mitochondrial dysfunction, senescence

1. INTRODUCTION

Interleukin-6 (IL-6) is a well-studied, multifunctional cytokine with a prominent role in the pathogenesis of diabetic retinopathy (DR) (Funatsu et al., 2001; Gabay, 2006; Koleva-Georgieva et al., 2011; Mocan et al., 2006; Rincon, 2012). IL-6 functions primarily through two different signaling modalities. IL-6 cis-signaling functions through a membrane-bound IL-6 receptor expressed on limited cell types; conversely, IL-6 trans-signaling (TS) functions without cell specificity through a soluble IL-6R (sIL-6R) (Coughlin et al., 2017; Rose-John, 2012; Scheller et al., 2014). This signaling pathway greatly expands the extent of IL-6 activation to include cells that do not express the membrane-bound form of the receptor, including retinal endothelial cells, as it only requires sIL-6R and the ubiquitously expressed IL-6 co-receptor glycoprotein 130 (gp130) (Jostock et al., 2001). In previous publications, we and others have shown that the effects of IL-6 TS are primarily pro-inflammatory (Becker et al., 2004; Garbers et al., 2015; Rose-John, 2012; Scheller et al., 2011; M. L. Valle et al., 2019; Yego et al., 2009). A third modality of IL-6, known as IL-6 cluster signaling or trans-presentation, occurs through the complex of IL-6 and membrane-bound IL-6R on a transmitter cell activating signaling via the gp130 co-receptor of a target cell (Heink et al., 2017; Rose-John et al., 2023); however, this has only been observed in immune cells.

Recent studies have implicated IL-6 TS in retinal oxidative stress and vascular dysfunction associated with DR (Robinson et al., 2020; Rojas et al., 2010; Rojas et al., 2011; M. L. Valle et al., 2019). Previously, in diabetic mice, we found that the selective IL-6 TS inhibitor sgp130Fc, a fused chimera of soluble gp130 and the Fc-region of IgG1, reduces retinal oxidative damage associated with diabetes (Robinson et al., 2020), and this treatment corrects diabetes-induced proteomic alterations in murine vitreous fluid (Robinson et al., 2020). In human retinal endothelial cells (HRECs), IL-6 TS induces expression of genes associated with inflammation (Robinson et al., 2021; M. L. Valle et al., 2019), leads to decreased endothelial barrier function (Glass et al., 2021; M. L. Valle et al., 2019), and promotes mitochondrial dysfunction and apoptosis (M. L. Valle et al., 2019). Therefore, understanding interventions to block IL-6 TS may have therapeutic benefits to DR patients.

Here, we expand on our recent work and further investigate the functions of IL-6 TS in retinal endothelial cells. We find that IL-6 TS increases inflammatory gene expression, decreases mitochondrial respiration and oxidative phosphorylation, alters expression of the mitochondrial and apoptosis-associated genes, and induces cellular senescence. sgp130Fc, a selective IL-6 TS inhibitor, significantly inhibited these effects, thus suggesting its therapeutic potential as an anti-inflammatory drug.

2. METHODS

2.1. Cell culture and treatments

Human retinal endothelial cells (HRECs, Cat# ACBRI 181) were purchased from Cell Systems (Kirkland, WA, USA). HRECs were maintained on gelatin-coated (Gelatin-Based Coating Solution, Cat# 6950, Cell Biologics, Chicago, IL, USA) culture dishes in complete human endothelial cell media with supplement kit containing 5% fetal bovine serum (FBS) and 1% antibiotic-antimycotic solution (Cat# H1168, Cell Biologics). Confluent HRECs were serum starved in media with 1% FBS for 4 hours prior to all treatments. Human corneal epithelial cells (hTCEpi (Robertson et al., 2005); kindly provided by Dr. Danielle Robertson) were maintained in serum-free keratinocyte growth media (KGM-2; Lonza, Walkersville, MD, USA) containing 0.15 mM calcium and supplemented with KGM-2 Supplement Kit (Cat# C-39011). Both cell types were cultured at 37 °C in a humidified incubator containing 5% CO2, with the media changed every alternate day.

IL-6 trans-signaling (IL-6 TS) was activated with IL-6 (50 ng/mL) and sIL-6R (150 ng/mL; PeproTech, Rocky Hill, NJ, USA) or with Hyper IL-6 (50 ng/mL; kindly provided by Dr. Stefan Rose-John) overnight. For inhibition of IL-6 TS, cells were pretreated with sgp130Fc (10 μg/mL, Cat# 671-GP-100, R&D Systems, Minneapolis, MN, USA) 1 hour prior to activation of IL-6 TS.

2.2. RT-PCR

RNA was isolated from cells using phenol-chloroform extraction with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) as described previously (Rio et al., 2010). RNA concentration and purity was verified by Nanodrop spectrophotometer, and RNA was considered pure if A260/A280 > 1.8 and A260/A230 > 2.0. cDNA was synthesized using High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Foster City, CA, USA) with 1 μg RNA per sample following the manufacturer’s protocol. All primers were designed using the NCBI Primer-BLAST tool, purchased from Integrated Device Technology (San Jose, CA, USA) (Table 1), and RT-PCR reactions were performed using SsoAdvanced Universal SYBR Green Supermix and Bio-Rad CFX Connect Thermocycler (Bio-Rad Laboratories, Hercules, CA, USA). Expression was calculated as 2−ΔΔCq relative to GAPDH expression and expressed as fold change relative to untreated.

Table 1:

List of primer sequences used for RT-PCR analysis

Gene Forward (5’ → 3’) Reverse (5’ → 3’)
ICAM1 AGGGTAAGGTTCTTGCCCAC TGATGGGCAGTCAACAGCTA
MCP1 TCAAACTGAAGCTCGCACTCT GGCATTGATTGCATCTGGC
SERPINA3 CTACTCCAGACAGACGGCTT CTCCATTCTCAACTCTGCCTCA
FIS1 GGAACTACCGGCTCAAGGAAT GGACACAGCAAGTCCGATGA
BCL2 CAGGATAACGGAGGCTGGGATG GACTTCACTTGTGGCCCAGAT
MCL1 AACGCGGTAATCGGACTCAA CCTCCTTCTCCGTAGCCAAA
NOS3 CAGCACATTTGGGAATGGGG AGAGGACACCAGTGGGTCTG
CDKN1A CCGAAGTCAGTTCCTTGTGGAG TTAGGGCTTCCTCTTGGAGAAG
IL6 CTCACCTCTTCAGAACGAATTGACAAACAAA GGTACTCTAGGTATACCTCAAACTCCAAAA
GAPDH AATGAAGGGGTCATTGATGG AAGGTGAAGGTCGGAGTCAA
Open in a new tab

2.3. Seahorse assay

Mitochondrial function was assessed using a Seahorse XFe24 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), the Seahorse XF Cell Mito Stress Test Kit (Agilent), and Seahorse XF Real-Time ATP Rate Assay (Agilent). Cells were seeded (10,000 cells/well) in a 24-well Seahorse cell culture microplate and grown to confluence overnight, and the next day cells were serum starved for four hours and treated with IL-6/sIL-6R ± sgp130Fc. Seahorse XFe24 FluxPack cartridge was hydrated in calibration fluid overnight in a 37 °C non-CO2 incubator. After overnight treatment, cells were washed in Seahorse XF DMEM (Agilent) containing 4 mM L-glutamine, 1 mM pyruvate, and 5.5 mM glucose ± IL-6 TS, then incubated in a 37 °C non-CO2 incubator for 30 min. For Mito Stress, Seahorse cartridge was loaded to inject oligomycin (oligo), carbonyl cyanide-4-trifluoromethoxyphenylhydrazone (FCCP), and rotenone and antimycin A (Rot/AA) at final well concentrations of 1.5 μM (oligo), 2.0 μM (FCCP), and 0.5 μM/0.5 μM (Rot/AA). For ATP Rate, 1.5 μM (oligo) and 0.5 μM/0.5 μM (Rot/AA) were used. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured in 8-minute intervals, beginning with a baseline reading and followed by subsequent toxin injections. Spare respiratory capacity and maximal respiration (Mito Stress) and glycolytic and mitochondrial ATP production rates (ATP rate) for each group were calculated using Wave software (version 4.0, Agilent) and the XF Cell Mito Stress and ATP Rate Assay report generators.

2.4. Western blotting

Cell homogenates were prepared in RIPA buffer (Cat# AKR191, Cell Biolabs, Inc., San Diego, CA, USA) containing protease inhibitor (Cat# P8340, Sigma-Aldrich, St. Louis, MO, USA) and phosphatase inhibitor (Cat# P5726, Sigma-Aldrich) and lysed by sonication. Protein concentrations were determined by Bradford Protein Assay (Cat# 23200, Thermo Scientific, Waltham, MA, USA) following the manufacturer’s protocol. Samples were loaded and run in a pre-cast 4–15% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) (Cat# 4561083, Bio Rad) for electrophoresis and transferred to a nitrocellulose membrane using a Bio-Rad Trans Blot Turbo semi-dry transfer system. The membranes were blocked in 5% milk powder dissolved in tris-buffered saline with 0.1% Tween-20 (TBS-T) for 2–3 hours at room temperature. After blocking, the membrane was incubated with anti-eNOS antibody (1:250; Cat# sc-376751, Santa Cruz, Dallas, TX, USA) at 4 °C overnight, followed by horseradish peroxidase (HRP)-conjugated secondary antibody for 1–1.5 hours at room temperature. Blots were developed with enhanced chemiluminescence (ECL) substrate (Cat# 32109, Thermo Scientific), imaged using a ChemiDoc Imaging System (BioRad), and band pixel density was quantified using ImageJ software (NIH, Bethesda, MD, USA). Protein expression was normalized to β-actin and expressed as fold change relative to untreated.

2.5. Senescence-associated β-galactosidase (SA β-gal) staining

To assess cellular senescence, retinal endothelial cells were stained for SA β-gal according to manufacturer’s protocol (Cat# 9860, Cell Signaling Technology, Danvers, MA, USA). Cells at passage 18 were seeded in 96-well plates at a concentration of 10,000 cells per well. Before activating IL-6 trans-signaling with IL-6 (50 ng/mL) and sIL-6R (150 ng/mL) for 24 hrs, cells were treated with or without sgp130Fc (10 μg/mL, 1 hr). Following a wash with 1X DPBS, cells were fixed with a 2% formaldehyde and 0.2% glutaraldehyde solution for 15 minutes at room temperature, washed twice with DPBS, and incubated in an X-gal staining solution (pH 6.0) overnight at 37 °C without CO2. The plate was sealed with parafilm to prevent drying. Stained cells were imaged using the Revolve microscope by ECHO (San Diego, CA, USA) at 10x magnification. Five representative images from each well were captured for all 3 treatment groups (n=3/group). Using ImageJ software, the percentage of SA β-gal stained area was determined per image, quantified using 15 images/group, and plotted as fold change relative to untreated.

2.6. Statistical Analysis

Statistical analyses were performed with GraphPad Prism software 9.0 (GraphPad Software, Inc., San Diego, CA, USA) using One-way ANOVA with Tukey’s posthoc test, and p < 0.05 was considered statistically significant. Data are presented as mean ± standard error of the mean (SEM) from at least two independent experiments.

3. RESULTS

3.1. IL-6 trans-signaling (TS) is a potent inducer of inflammatory gene expression in retinal endothelial cells.

To confirm the induction of an inflammatory phenotype in HRECs, we activated IL-6 TS with and without inhibition with sgp130Fc, and then measured mRNA levels of three well-known inflammatory genes. IL-6 TS strongly upregulated expression of intercellular adhesion molecule 1 (ICAM1, 3.98-fold upregulated), monocyte chemoattractant protein 1 (MCP1, 20.67-fold upregulated), and serine protease inhibitor A3/α1-anti-chymotrypsin (SERPINA3, 47.90-fold upregulated) (Figure 1A). These results are consistent with our previous findings in HRECs in vitro, as these cells do not express the IL-6 receptor and only respond to IL-6 via trans-signaling (Glass et al., 2021; Maria L Valle et al., 2019). To compare the effects of IL-6 TS in a non-vascular tissue, we measured the same genes in corneal epithelial cells under the same treatment conditions. ICAM1 (1.58-fold), MCP1 (1.42-fold), and SERPINA3 (2.73-fold) were also significantly upregulated in this cell line, but to a much lesser extent (Figure 1B).

Figure 1. IL-6 trans-signaling (TS) is a potent inducer of inflammatory gene expression in retinal endothelial cells.

Figure 1.

Open in a new tab

mRNA levels of known inflammatory markers ICAM1, MCP1, and SERPINA3 measured in (A) human retinal endothelial cells (HRECs) and (B) human corneal epithelial cells (hTCEpi) following activation of IL-6 TS +/− pretreatment with sgp130Fc. Data is represented as fold change mean ± SEM; n = 4–8/group; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns = not significant.

3.2. IL-6 trans-signaling (TS) reduces mitochondrial respiration and oxidative phosphorylation.

Our previous studies showed that IL-6 TS can induce mitochondrial membrane depolarization and significantly increases mitochondrial superoxide generation (M. L. Valle et al., 2019). These data suggest a role for IL-6 TS in regulation of oxidative phosphorylation and cellular metabolism. To test this, we measured HREC mitochondrial function using the Seahorse Mito Stress assay following activation of IL-6 TS with and without sgp130Fc (Figure 2A). IL-6 TS induced a significant decrease in maximal respiration (156.09 pmol/min vs. 197.56 pmol/min in untreated cells) and spare respiratory capacity (116.62 pmol/min vs. 143.62 pmol/min in untreated cells), and both of the changes were prevented by pretreatment with sgp130Fc (Figure 2B). This change in mitochondrial respiration was reflected in mitochondrial ATP production, which was also significantly decreased relative to untreated cells (26.59 pmol/min vs. 41.18 pmol/min). We confirmed these changes by assessing relative amounts of ATP generated by oxidative phosphorylation and glycolysis using the Seahorse ATP Rate assay. These data also showed a significant decrease in ATP production by oxidative phosphorylation (50.94 pmol/min vs. 58.36 pmol/min in untreated cells) and accompanying increase in ATP production by glycolysis (49.06 pmol/min vs. 41.64 pmol/min in untreated cells) (Figure 2C).

Figure 2. sgp130Fc prevents IL-6 trans-signaling (TS)-induced mitochondrial dysfunction in retinal endothelial cells.

Figure 2.

Open in a new tab

(A) Seahorse XF Mito Stress test in HRECs following activation of IL-6 TS +/− pretreatment with sgp130Fc showing oxygen consumption rate (OCR) after addition of oligomycin (oligo), carbonylcyanide p-trifluoromethoxyphenylhydrazone (FCCP), and rotenone + antimycin A (Rot/AA). (B) Average maximal respiration, spare respiratory capacity, and mitochondrial ATP production. (C) Relative oxidative phosphorylation and glycolysis in HRECs following activation of IL-6 TS +/− pretreatment with sgp130Fc measured by Seahorse ATP Rate Assay. Data is represented as fold change mean ± SEM; n = 6–7/group; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns = not significant.

3.3. sgp130Fc prevents IL-6 trans-signaling (TS) induced downregulation of mitochondrial function and apoptosis-associated genes.

We previously found that the IL-6 TS-induced mitochondrial changes were accompanied by increased activation of apoptosis, as detected by caspase 3/7 activation and Annexin V staining (M. L. Valle et al., 2019). Here, we confirm these findings by measuring the gene expression of mitochondrial function and apopotsis assoicated genes. mRNA levels of mitochondrial fission 1 protein (FIS1) were significantly reduced (0.63-fold) by IL-6 TS, and expression was restored by inhibition of IL-6 TS with sgp130Fc pretreatment (Figure 3). We also detected similar changes to mRNA expression of two key anti-apoptotic regulators, B-cell lymphoma 2 (BCL2) and myeloid leukemia 1 (MCL1), both of which were downregulated (0.43-fold and 0.38-fold, respectively) by IL-6 TS activation. Interestingly, sgp130Fc treatment appeared to induce upregulation of MCL1 (1.72-fold relative to untreated), the significance of which is unclear.

Figure 3. IL-6 trans-signaling (TS) downregulates mRNA levels of mitochondrial associated genes- FIS1, BCL2, and MCL1.

Figure 3.

Open in a new tab

mRNA levels of FIS1, BCL2, and MCL1 were measured in HRECs following activation of IL-6 TS +/− pretreatment with sgp130Fc. Data is represented as fold change mean ± SEM; n = 4–8/group; *p < 0.05, ***p < 0.001, ns = not significant.

3.4. IL-6 trans-signaling (TS) increased endothelial nitric oxide synthase (eNOS) expression in HRECs.

Our previous studies showed that IL-6 TS significantly reduced nitric oxide (NO) levels in HRECs. To explore any affects of IL-6 TS on expression of endothelial nitric oxide synthase (eNOS/NOS3), we measured eNOS levels by RT-PCR and western blotting following activation of IL-6 TS with and without sgp130Fc pretreatment. Suprisingly, we found that IL-6 TS significantly upregulated NOS3 mRNA (1.53-fold) and eNOS protein (1.43-fold) expression (Figure 4). While possible that this change in expression may be compensatory for altered NO levels through other mechanisms, this is only speculation, and further studies are required to fully elucidate the effects of IL-6 TS on endothelial NO regulation.

Figure 4. IL-6 trans-signaling (TS) increased endothelial nitric oxide synthase (eNOS) expression in retinal endothelial cells.

Figure 4.

Open in a new tab

(A) mRNA expression (n = 4–9/group) and (B) protein levels (n = 15–21/group) of NOS3/eNOS measured in HRECs following activation of IL-6 TS +/− pretreatment with sgp130Fc, using RT-PCR and western blotting, respectively. Data is represented as fold change mean ± SEM; *p < 0.05, **p < 0.01, ns = not significant.

3.5. Pretreatment with sgp130Fc protects endothelial cells from trans-signaling (TS) induced cellular senescence.

In endothelial cells, studies have shown overlap between the mechanisms inducing apoptosis and cellular senescence, and that senescent endothelial cells may be primed for apoptosis induction due to intracellular oxidative stress or other cellular damage (Barriuso et al., 2023; Zhang et al., 2002). We examined levels of senescent endothelial cells following activation of IL-6 TS with and without sgp130Fc pretreatment using senescence-associated β-galactosidase (SA β-gal) staining (Figure 5A). This revealed a modest but statistically significant increase (1.30-fold) in SA β-gal activity in the IL-6 TS group, which was prevented by pretreatment with sgp130Fc (Figure 5B). To confirm these results, we measured mRNA expression of senescence regulator CDKN1A (p21 CIP1), which was significantly upregulated (1.63-fold) after IL-6 TS activation (Figure 5C). As a component of the senescence-associated secretory phenotype (SASP), we also measured mRNA expression of IL6 in endothelial cells, showing 1.64-fold upregulation of this gene following activation of IL-6 TS (Figure 5D), and pretreatment with sgp130Fc significantly abrogated this effect. Together with our previously published data showing IL-6 TS-induced endothelial apoptosis (M. L. Valle et al., 2019), these results provide further evidence for the role of IL-6 TS in endothelial dysfunction and in the pathogenesis of retinal vascular disease.

Figure 5. Pretreatment with sgp130Fc protects retinal endothelial cells from IL-6 trans-signaling (TS) induced senescence.

Figure 5.

Open in a new tab

(A) Representative images and (B) quantification of SA β-galactosidase staining (blue) in HRECs following activation of IL-6 TS +/− pretreatment with sgp130Fc. Data is represented as fold change mean ± SEM; five fields per well, n = 3/group (15 images/group); *p < 0.05, **p < 0.01. (C) mRNA expression of the senescence marker, CDKN1A (p21 CIP1). Data is represented as fold change mean ± SEM; n = 8/group; ****p < 0.0001, ns = not significant. (D) mRNA expression of IL6, a component of the senescence-associated secretory phenotype (SASP). Data is represented as fold change mean ± SEM; n = 4–5/group; *p < 0.05, ***p < 0.001, ns = not significant.

4. DISCUSSION

In our previously published studies, we have found that IL-6 trans-signaling (TS) is a prominent regulator of inflammation and vascular dysfunction in diabetic retinopathy (DR) (Glass et al., 2021; Robinson et al., 2021; Robinson et al., 2020; M. L. Valle et al., 2019). This study further strengthens the evidence that IL-6 TS is involved in cellular dysfunction in retinal endothelial cells in vitro. IL-6 TS is the major mechanism of IL-6 activation in HRECs, as these cells lack the membrane bound IL-6 receptor, making them unresponsive to IL-6 cis-signaling (Scheller et al., 2014; M. L. Valle et al., 2019). Studies have shown that this IL-6 TS pathway is also involved in several other diseases including rheumatoid arthritis (Kang et al.; Srirangan & Choy), inflammatory bowel disease (Kang et al.; Mitsuyama et al.; Mudter & Neurath), diabetes (Chen et al., 2016, 2017; Feigerlova & Battaglia-Hsu, 2017), and atherosclerosis (Hartman & Frishman; Schuett et al.); therefore, there is a need to understand the specific role of IL-6 TS and its utility as a therapeutic target, while keeping IL-6 cis-signaling intact.

In endothelial cells, IL-6 TS is associated with increased expression of leukocyte adhesion molecules and vascular leakage (Alsaffar et al., 2018; Q. Chen et al., 2006; DeLeo, 2007; Hurst et al., 2001; Romano et al., 1997; M. L. Valle et al., 2019; Wei et al., 2013; Zegeye et al., 2018). This pathway plays an important role in monocyte recruitment to a site of injury or infection during the transition from acute to chronic inflammation, including through adhesion molecules (ICAM-1), chemokines (MCP-1), and other modulators of immune cell function, such as SERPINA3 (DeLeo, 2007; Hurst et al., 2001; Kalsheker, 1996; Robinson et al., 2021; Romano et al., 1997; Rose-John, 2012). Our results are in agreement with these previous studies, as these inflammatory markers and immune modulators were upregulated with IL-6 TS activation and were returned to baseline levels by sgp130Fc in the present study.

We have previously shown that IL-6 TS activation induces loss of mitochondrial membrane potential and elevated levels of mitochondrial superoxide generation in retinal endothelial cells (M. L. Valle et al., 2019). The current study further supports these findings, showing reduced mitochondrial respiration and oxidative phosphorylation in response to IL-6 TS activation. IL-6 is well known to play a role in systemic metabolic regulation, but its specific functions across tissues and cell types are complex and not completely understood. In skeletal muscle, IL-6 signaling increases glucose uptake independent of insulin signaling (Febbraio et al., 2004; Glund et al., 2007), while in adipocytes IL-6 signaling decreases mitochondrial membrane potential and leads to accumulation of reactive oxygen species (ROS) (Ji et al., 2011). IL-6 has also been shown to modulate expression of proteins involved in mitochondrial fission, and inhibition of IL-6 signaling prevented disease progression in an experimental model of cachexia (Bach et al., 2005; White et al., 2012). Importantly, many studies on the metabolic effects of IL-6 focus only on cis-signaling, or in the case of in-vivo studies, do not differentiate between cis- and trans-signaling. In the central nervous system (CNS), specifically IL-6 TS functions similar to leptin to reduce feeding in obese mice (Timper et al., 2017); outside of the CNS, however, trans-signaling has been implicated in obesity-associated inflammation (Kraakman et al., 2015). Therefore, there is still a large gap in our knowledge about the role of IL-6 cis- and trans-signaling on metabolic function.

Chronic cytokine stimulation has been shown to induce cellular stress leading to growth arrest or senescence (He & Sharpless, 2017). Interestingly, we found cellular senescence to be increased after activation of IL-6 TS, suggesting a new means by which IL-6 TS can cause negative cellular and tissue health outcomes. Senescence has been implicated in ocular diseases, such as DR and age-related macular degeneration (AMD) (Soleimani et al., 2023) (J. Chen et al., 2006), and the senescence-associated secretory phenotype (SASP) induced by the accumulation of senescent cells in the aging retina is implicated in the development of AMD (Lee et al., 2021). A study by the Kolosova lab found that senescence-accelerated OXYS rats developed a disease profile similar to that seen in human AMD (Kozhevnikova et al., 2013). The SASP also contributes to recruitment of immune cells for clearance of senescent cells, modulates tissue repair, and possibly affects aging of surrounding tissues (Rodier & Campisi, 2011).

It has also been shown that human umbilical vein endothelial cells (HUVECs) expressed increased levels of senescence markers p21CIP1 and p16INK4a after exposure to hyperglycemic conditions (Di Tomo et al., 2021). Additionally, studies in rats have associated increased cellular p16INK4a and SA β-gal activity with hyperglycemia in the context of DR studies (Lamoke et al., 2015). Taken together, our results suggest that IL-6 TS may play a role in increasing cellular senescence or altering the expression of SASP-related markers; however, further in-vivo studies are required to delineate the specific roles of IL-6 TS and hyperglycemia on cellular senescence in the context DR.

Overall, this study provides further evidence for the translational relevance of inhibiting IL-6 TS in the context of retinal vascular dysfunction. While our current and previous studies in diabetic mice have shown the efficacy of selective inhibition of IL-6 TS with sgp130Fc, it is important to note that sgp130Fc can simultaneously inhibit other IL-6 family members, particularly IL-11, which can function through a similar trans-signaling mechanism through its soluble receptor (Lokau et al., 2016), which warrants further investigation. Recent clinical trials have found that the treatment of patients with inflammatory bowel disease with sgp130Fc was safe and effective (Schreiber et al., 2021). Additionally, new sgp130Fc variants have been developed to limit potential inhibition of other IL-6 family cytokines, including sgp130FLYFc and Cs130Fc, which show inhibition of IL-6 TS with diminished inhibition of IL-11 trans-signaling (Berg et al., 2021; Heise et al., 2021; Lokau et al., 2021). Further research is required to fully elucidate the clinical utility of such inhibitor specificity in different disease states.

While our study used ocular cell lines and focused on DR and other ophthalmologic diseases, our results have the potential to be applicable to other diseases and organismal phenotypes. As stated above, IL-6 TS has been implicated in multiple inflammation-related diseases, as well as cardiovascular and metabolic pathologies. The majority of these diseases tend to be age-related, including many ocular disorders such as DR. IL-6 has been associated with multiple age-related phenotypes, including reduction in physical function and cognition (Maggio et al., 2006), and high circulating IL-6 levels are associated with increased risk of mortality longitudinally (Baune et al., 2011). This overall age-related increase in inflammatory burden is often referred to as ‘inflammaging’, and evidence suggests IL-6 may play a major role in this process. However, it is not known to what degree these effects are driven by IL-6 cis- or trans-signaling. Future in-vivo studies are required to ascertain the role of IL-6 TS on age-related diseases and overall organismal health, as well as to determine if blockade of IL-6 TS may be a viable intervention to slow the aging process.

Highlights.

  • IL-6 trans-signaling (TS) induces inflammatory gene expression and mitochondrial dysfunction in HRECs.

  • IL-6 TS decreases maximal respiration, spare respiratory capacity, and ATP production.

  • IL-6 TS activation causes increase in endothelial cell senescence.

  • sgp130Fc abrogates these effects thus highlighting its therapeutic potential.

Acknowledgments:

We would like to thank Justin Bloom, B.S. and Grace Rountree, B.S. for their technical assistance in performing experiments.

Funding:

This study is supported by the National Institutes of Health, National Eye Institute (Bethesda, MD, USA) grant # R01-EY026936 awarded to SS, grant # P30-EY031631 Center Core Grant for Vision Research, National Institute of Aging grant # R00-AG059920 awarded to JMH, and an Augusta University Intramural Grant to JMH and SS.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflicts of Interest: The authors declare no conflicts of interest.

References

  1. Alsaffar H, Martino N, Garrett JP, & Adam AP (2018). Interleukin-6 promotes a sustained loss of endothelial barrier function via Janus kinase-mediated STAT3 phosphorylation and de novo protein synthesis. American Journal of Physiology-Cell Physiology, 314(5), C589–C602. [DOI] [PubMed] [Google Scholar]
  2. Bach D, Naon D, Pich S, Soriano FX, Vega N, Rieusset J, Laville M, Guillet C, Boirie Y, & Wallberg-Henriksson H (2005). Expression of Mfn2, the Charcot-Marie-Tooth neuropathy type 2A gene, in human skeletal muscle: effects of type 2 diabetes, obesity, weight loss, and the regulatory role of tumor necrosis factor α and interleukin-6. Diabetes, 54(9), 2685–2693. [DOI] [PubMed] [Google Scholar]
  3. Barriuso D, Alvarez-Frutos L, Gonzalez-Gutierrez L, Motino O, Kroemer G, Palacios-Ramirez R, & Senovilla L (2023). Involvement of Bcl-2 Family Proteins in Tetraploidization-Related Senescence. Int J Mol Sci, 24(7). 10.3390/ijms24076374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Baune BT, Rothermundt M, Ladwig KH, Meisinger C, & Berger K (2011). Systemic inflammation (Interleukin 6) predicts all-cause mortality in men: results from a 9-year follow-up of the MEMO Study. Age (Dordr), 33(2), 209–217. 10.1007/s11357-010-9165-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Becker C, Fantini MC, Schramm C, Lehr HA, Wirtz S, Nikolaev A, Burg J, Strand S, Kiesslich R, Huber S, Ito H, Nishimoto N, Yoshizaki K, Kishimoto T, Galle PR, Blessing M, Rose-John S, & Neurath MF (2004). TGF-beta suppresses tumor progression in colon cancer by inhibition of IL-6 trans-signaling. Immunity, 21(4), 491–501. 10.1016/j.immuni.2004.07.020 [DOI] [PubMed] [Google Scholar]
  6. Berg AF, Ettich J, Weitz HT, Krusche M, Floss DM, Scheller J, & Moll JM (2021). Exclusive inhibition of IL-6 trans-signaling by soluble gp130(FlyR)Fc. Cytokine X, 3(4), 100058. 10.1016/j.cytox.2021.100058 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen H, Zhang X, Liao N, & Wen F (2016). Increased levels of IL-6, sIL-6R, and sgp130 in the aqueous humor and serum of patients with diabetic retinopathy. Mol Vis, 22, 1005–1014. https://www.ncbi.nlm.nih.gov/pubmed/27563232 [PMC free article] [PubMed] [Google Scholar]
  8. Chen H, Zhang X, Liao N, & Wen F (2017). Assessment of biomarkers using multiplex assays in aqueous humor of patients with diabetic retinopathy. BMC Ophthalmol, 17(1), 176. 10.1186/s12886-017-0572-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen J, Huang X, Halicka D, Brodsky S, Avram A, Eskander J, Bloomgarden NA, Darzynkiewicz Z, & Goligorsky MS (2006). Contribution of p16INK4a and p21CIP1 pathways to induction of premature senescence of human endothelial cells: permissive role of p53. Am J Physiol Heart Circ Physiol, 290(4), H1575–1586. 10.1152/ajpheart.00364.2005 [DOI] [PubMed] [Google Scholar]
  10. Chen Q, Fisher DT, Clancy KA, Gauguet J-MM, Wang W-C, Unger E, Rose-John S, von Andrian UH, Baumann H, & Evans SS (2006). Fever-range thermal stress promotes lymphocyte trafficking across high endothelial venules via an interleukin 6 trans-signaling mechanism. Nature immunology, 7(12), 1299–1308. [DOI] [PubMed] [Google Scholar]
  11. Coughlin BA, Feenstra DJ, & Mohr S (2017). Müller cells and diabetic retinopathy. Vision research, 139, 93–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. DeLeo FR (2007). Attractive shedding. Blood, The Journal of the American Society of Hematology, 110(6), 1711–1712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Di Tomo P, Alessio N, Falone S, Pietrangelo L, Lanuti P, Cordone V, Santini SJ, Di Pietrantonio N, Marchisio M, Protasi F, Di Pietro N, Formoso G, Amicarelli F, Galderisi U, & Pandolfi A (2021). Endothelial cells from umbilical cord of women affected by gestational diabetes: A suitable in vitro model to study mechanisms of early vascular senescence in diabetes. FASEB J, 35(6), e21662. 10.1096/fj.202002072RR [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Febbraio MA, Hiscock N, Sacchetti M, Fischer CP, & Pedersen BK (2004). Interleukin-6 is a novel factor mediating glucose homeostasis during skeletal muscle contraction. Diabetes, 53(7), 1643–1648. [DOI] [PubMed] [Google Scholar]
  15. Feigerlova E, & Battaglia-Hsu SF (2017). IL-6 signaling in diabetic nephropathy: From pathophysiology to therapeutic perspectives. Cytokine Growth Factor Rev, 37, 57–65. 10.1016/j.cytogfr.2017.03.003 [DOI] [PubMed] [Google Scholar]
  16. Funatsu H, Yamashita H, Shimizu E, Kojima R, & Hori S (2001). Relationship between vascular endothelial growth factor and interleukin–6 in diabetic retinopathy. Retina, 21(5), 469–477. [DOI] [PubMed] [Google Scholar]
  17. Gabay C (2006). Interleukin-6 and chronic inflammation. Arthritis Res Ther, 8 Suppl 2, S3. https://doi.org/ar1917 [pii] 10.1186/ar1917 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Garbers C, Aparicio-Siegmund S, & Rose-John S (2015). The IL-6/gp130/STAT3 signaling axis: recent advances towards specific inhibition. Curr Opin Immunol, 34, 75–82. 10.1016/j.coi.2015.02.008 [DOI] [PubMed] [Google Scholar]
  19. Glass J, Robinson R, Lee T-J, Sharma A, & Sharma S (2021). Interleukin-6 Trans-Signaling Mediated Regulation of Paracellular Permeability in Human Retinal Endothelial Cells. International Journal of Translational Medicine, 1(2), 137–153. [Google Scholar]
  20. Glund S, Deshmukh A, Long YC, Moller T, Koistinen HA, Caidahl K, Zierath JR, & Krook A (2007). Interleukin-6 directly increases glucose metabolism in resting human skeletal muscle. Diabetes, 56(6), 1630–1637. [DOI] [PubMed] [Google Scholar]
  21. Hartman J, & Frishman WH (2014). Inflammation and atherosclerosis: a review of the role of interleukin-6 in the development of atherosclerosis and the potential for targeted drug therapy. Cardiol Rev, 22(3), 147–151. 10.1097/CRD.0000000000000021 [DOI] [PubMed] [Google Scholar]
  22. He S, & Sharpless NE (2017). Senescence in Health and Disease. Cell, 169(6), 1000–1011. 10.1016/j.cell.2017.05.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Heink S, Yogev N, Garbers C, Herwerth M, Aly L, Gasperi C, Husterer V, Croxford AL, Möller-Hackbarth K, & Bartsch HS (2017). Trans-presentation of IL-6 by dendritic cells is required for the priming of pathogenic TH17 cells. Nature immunology, 18(1), 74–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Heise D, Derrac Soria A, Hansen S, Dambietz C, Akbarzadeh M, Berg AF, Waetzig GH, Jones SA, Dvorsky R, Ahmadian MR, Scheller J, & Moll JM (2021). Selective inhibition of IL-6 trans-signaling by a miniaturized, optimized chimeric soluble gp130 inhibits T(H)17 cell expansion. Sci Signal, 14(696). 10.1126/scisignal.abc3480 [DOI] [PubMed] [Google Scholar]
  25. Hurst SM, Wilkinson TS, McLoughlin RM, Jones S, Horiuchi S, Yamamoto N, Rose-John S, Fuller GM, Topley N, & Jones SA (2001). Il-6 and its soluble receptor orchestrate a temporal switch in the pattern of leukocyte recruitment seen during acute inflammation. Immunity, 14(6), 705–714. [DOI] [PubMed] [Google Scholar]
  26. Ji C, Chen X, Gao C, Jiao L, Wang J, Xu G, Fu H, Guo X, & Zhao Y (2011). IL-6 induces lipolysis and mitochondrial dysfunction, but does not affect insulin-mediated glucose transport in 3T3-L1 adipocytes. Journal of bioenergetics and biomembranes, 43(4), 367. [DOI] [PubMed] [Google Scholar]
  27. Jostock T, Müllberg J, Özbek S, Atreya R, Blinn G, Voltz N, Fischer M, Neurath MF, & Rose-John S (2001). Soluble gp130 is the natural inhibitor of soluble interleukin-6 receptor transsignaling responses. European journal of biochemistry, 268(1), 160–167. [DOI] [PubMed] [Google Scholar]
  28. Kalsheker NA (1996). α1-antichymotrypsin. The international journal of biochemistry & cell biology, 28(9), 961–964. [DOI] [PubMed] [Google Scholar]
  29. Kang S, Tanaka T, Narazaki M, & Kishimoto T (2019). Targeting Interleukin-6 Signaling in Clinic. Immunity, 50(4), 1007–1023. 10.1016/j.immuni.2019.03.026 [DOI] [PubMed] [Google Scholar]
  30. Koleva-Georgieva DN, Sivkova NP, & Terzieva D (2011). Serum inflammatory cytokines IL-1β, IL-6, TNF-α and VEGF have influence on the development of diabetic retinopathy. Folia medica, 53(2), 44–50. [DOI] [PubMed] [Google Scholar]
  31. Kozhevnikova OS, Korbolina EE, Ershov NI, & Kolosova NG (2013). Rat retinal transcriptome: effects of aging and AMD-like retinopathy. Cell Cycle, 12(11), 1745–1761. 10.4161/cc.24825 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kraakman MJ, Kammoun HL, Allen TL, Deswaerte V, Henstridge DC, Estevez E, Matthews VB, Neill B, White DA, & Murphy AJ (2015). Blocking IL-6 trans-signaling prevents high-fat diet-induced adipose tissue macrophage recruitment but does not improve insulin resistance. Cell metabolism, 21(3), 403–416. [DOI] [PubMed] [Google Scholar]
  33. Lamoke F, Shaw S, Yuan JH, Ananth S, Duncan M, Martin P, & Bartoli M (2015). Increased Oxidative and Nitrative Stress Accelerates Aging of the Retinal Vasculature in the Diabetic Retina. PloS one, 10(10). https://doi.org/ARTN e0139664 10.1371/journal.pone.0139664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lee KS, Lin S, Copland DA, Dick AD, & Liu J (2021). Cellular senescence in the aging retina and developments of senotherapies for age-related macular degeneration. J Neuroinflammation, 18(1), 32. 10.1186/s12974-021-02088-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lokau J, Garbers Y, Grötzinger J, & Garbers C (2021). A single aromatic residue in sgp130Fc/olamkicept allows the discrimination between interleukin-6 and interleukin-11 trans-signaling. Iscience, 24(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lokau J, Nitz R, Agthe M, Monhasery N, Aparicio-Siegmund S, Schumacher N, Wolf J, Möller-Hackbarth K, Waetzig GH, & Grötzinger J (2016). Proteolytic cleavage governs interleukin-11 trans-signaling. Cell reports, 14(7), 1761–1773. [DOI] [PubMed] [Google Scholar]
  37. Maggio M, Guralnik JM, Longo DL, & Ferrucci L (2006). Interleukin-6 in aging and chronic disease: a magnificent pathway. J Gerontol A Biol Sci Med Sci, 61(6), 575–584. 10.1093/gerona/61.6.575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mitsuyama K, Sata M, & Rose-John S (2006). Interleukin-6 trans-signaling in inflammatory bowel disease. Cytokine Growth Factor Rev, 17(6), 451–461. 10.1016/j.cytogfr.2006.09.003 [DOI] [PubMed] [Google Scholar]
  39. Mocan MC, Kadayifcilar S, & Eldem B (2006). Elevated intravitreal interleukin-6 levels in patients with proliferative diabetic retinopathy. Canadian Journal of Ophthalmology, 41(6), 747–752. [DOI] [PubMed] [Google Scholar]
  40. Mudter J, & Neurath MF (2007). Il-6 signaling in inflammatory bowel disease: pathophysiological role and clinical relevance. Inflamm Bowel Dis, 13(8), 1016–1023. 10.1002/ibd.20148 [DOI] [PubMed] [Google Scholar]
  41. Rincon M (2012). Interleukin-6: from an inflammatory marker to a target for inflammatory diseases. Trends Immunol, 33(11), 571–577. 10.1016/j.it.2012.07.003 S1471–4906(12)00122–6 [pii] [DOI] [PubMed] [Google Scholar]
  42. Rio DC, Ares M Jr., Hannon GJ, & Nilsen TW (2010). Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc, 2010(6), pdb prot5439. 10.1101/pdb.prot5439 [DOI] [PubMed] [Google Scholar]
  43. Robertson DM, Li L, Fisher S, Pearce VP, Shay JW, Wright WE, Cavanagh HD, & Jester JV (2005). Characterization of growth and differentiation in a telomerase-immortalized human corneal epithelial cell line. Investigative Ophthalmology & Visual Science, 46(2), 470–478. [DOI] [PubMed] [Google Scholar]
  44. Robinson R, Brown D, Churchwell L, Lee TJ, Kodeboyina SK, Bloom J, Sharma A, & Sharma S (2021). RNA-Seq analysis reveals gene expression changes induced by IL-6 trans-signaling activation in retinal endothelial cells. Cytokine, 139, 155375. 10.1016/j.cyto.2020.155375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Robinson R, Srinivasan M, Shanmugam A, Ward A, Ganapathy V, Bloom J, Sharma A, & Sharma S (2020). Interleukin-6 trans-signaling inhibition prevents oxidative stress in a mouse model of early diabetic retinopathy. Redox Biol, 34, 101574. 10.1016/j.redox.2020.101574 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rodier F, & Campisi J (2011). Four faces of cellular senescence. J Cell Biol, 192(4), 547–556. 10.1083/jcb.201009094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rojas M, Zhang W, Lee DL, Romero MJ, Nguyen DT, Al-Shabrawey M, Tsai N-T, Liou GI, Brands MW, & Caldwell RW (2010). Role of IL-6 in angiotensin II–induced retinal vascular inflammation. Investigative Ophthalmology & Visual Science, 51(3), 1709–1718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Rojas MA, Zhang W, Xu Z, Nguyen DT, Caldwell RW, & Caldwell RB (2011). Interleukin 6 has a critical role in diabetes-induced retinal vascular inflammation and permeability. Investigative Ophthalmology & Visual Science, 52(14), 1003–1003.21051698 [Google Scholar]
  49. Romano M, Sironi M, Toniatti C, Polentarutti N, Fruscella P, Ghezzi P, Faggioni R, Luini W, Van Hinsbergh V, & Sozzani S (1997). Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity, 6(3), 315–325. [DOI] [PubMed] [Google Scholar]
  50. Rose-John S (2012). IL-6 trans-signaling via the soluble IL-6 receptor: importance for the pro-inflammatory activities of IL-6. Int J Biol Sci, 8(9), 1237–1247. 10.7150/ijbs.4989 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Rose-John S, Jenkins BJ, Garbers C, Moll JM, & Scheller J (2023). Targeting IL-6 trans-signalling: past, present and future prospects. Nature Reviews Immunology, 1–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Scheller J, Chalaris A, Schmidt-Arras D, & Rose-John S (2011). The pro-and anti-inflammatory properties of the cytokine interleukin-6. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1813(5), 878–888. [DOI] [PubMed] [Google Scholar]
  53. Scheller J, Garbers C, & Rose-John S (2014). Interleukin-6: from basic biology to selective blockade of pro-inflammatory activities. Semin Immunol, 26(1), 2–12. 10.1016/j.smim.2013.11.002 [DOI] [PubMed] [Google Scholar]
  54. Schreiber S, Aden K, Bernardes JP, Conrad C, Tran F, Hoper H, Volk V, Mishra N, Blase JI, Nikolaus S, Bethge J, Kuhbacher T, Rocken C, Chen M, Cottingham I, Petri N, Rasmussen BB, Lokau J, Lenk L, … Rosenstiel P (2021). Therapeutic Interleukin-6 Trans-signaling Inhibition by Olamkicept (sgp130Fc) in Patients With Active Inflammatory Bowel Disease. Gastroenterology, 160(7), 2354–2366 e2311. 10.1053/j.gastro.2021.02.062 [DOI] [PubMed] [Google Scholar]
  55. Schuett H, Luchtefeld M, Grothusen C, Grote K, & Schieffer B (2009). How much is too much? Interleukin-6 and its signalling in atherosclerosis. Thromb Haemost, 102(2), 215–222. 10.1160/TH09-05-0297 [DOI] [PubMed] [Google Scholar]
  56. Soleimani M, Cheraqpour K, Koganti R, & Djalilian AR (2023). Cellular senescence and ophthalmic diseases: narrative review. Graefes Archive for Clinical and Experimental Ophthalmology. 10.1007/s00417-023-06070-9 [DOI] [PubMed] [Google Scholar]
  57. Srirangan S, & Choy EH (2010). The role of interleukin 6 in the pathophysiology of rheumatoid arthritis. Ther Adv Musculoskelet Dis, 2(5), 247–256. 10.1177/1759720X10378372 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Timper K, Denson JL, Steculorum SM, Heilinger C, Engström-Ruud L, Wunderlich CM, Rose-John S, Wunderlich FT, & Brüning JC (2017). IL-6 improves energy and glucose homeostasis in obesity via enhanced central IL-6 trans-signaling. Cell reports, 19(2), 267–280. [DOI] [PubMed] [Google Scholar]
  59. Valle ML, Dworshak J, Sharma A, Ibrahim AS, Al-Shabrawey M, & Sharma S (2019). Inhibition of interleukin-6 trans-signaling prevents inflammation and endothelial barrier disruption in retinal endothelial cells. Experimental eye research, 178, 27–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Valle ML, Dworshak J, Sharma A, Ibrahim AS, Al-Shabrawey M, & Sharma S (2019). Inhibition of interleukin-6 trans-signaling prevents inflammation and endothelial barrier disruption in retinal endothelial cells. Exp Eye Res, 178, 27–36. 10.1016/j.exer.2018.09.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wei L-H, Chou C-H, Chen M-W, Rose-John S, Kuo M-L, Chen S-U, & Yang Y-S (2013). The role of IL-6 trans-signaling in vascular leakage: implications for ovarian hyperstimulation syndrome in a murine model. The Journal of Clinical Endocrinology & Metabolism, 98(3), E472–E484. [DOI] [PubMed] [Google Scholar]
  62. White JP, Puppa MJ, Sato S, Gao S, Price RL, Baynes JW, Kostek MC, Matesic LE, & Carson JA (2012). IL-6 regulation on skeletal muscle mitochondrial remodeling during cancer cachexia in the Apc Min/+ mouse. Skeletal muscle, 2(1), 1–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Yego ECK, Vincent JA, Sarthy V, Busik JV, & Mohr S (2009). Differential Regulation of High Glucose–Induced Glyceraldehyde-3-Phosphate Dehydrogenase Nuclear Accumulation in Müller Cells by IL-1β and IL-6. Investigative ophthalmology & visual science, 50(4), 1920–1928. [DOI] [PubMed] [Google Scholar]
  64. Zegeye MM, Lindkvist M, Fälker K, Kumawat AK, Paramel G, Grenegård M, Sirsjö A, & Ljungberg LU (2018). Activation of the JAK/STAT3 and PI3K/AKT pathways are crucial for IL-6 trans-signaling-mediated pro-inflammatory response in human vascular endothelial cells. Cell Communication and Signaling, 16(1), 1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhang J, Patel JM, & Block ER (2002). Enhanced apoptosis in prolonged cultures of senescent porcine pulmonary artery endothelial cells. Mech Ageing Dev, 123(6), 613–625. 10.1016/s0047-6374(01)00412-2 [DOI] [PubMed] [Google Scholar]

RESOURCES