Abstract
Nanoplastics (NPs) have been found in many ecological environments (aquatic, terrestrial, air). Currently, there is great concern about the exposition and impact on animal health, including humans, because of the effects of ingestion and accumulation of these nanomaterials (NMs) in aquatic organisms and their incorporation into the food chain. NPs´ mechanisms of action on humans are currently unknown. In this study, we evaluated the altered molecular mechanisms on human neural stem cell line (hNS1) after 4 days of exposure to 30 nm polystyrene (PS) NPs (0.5, 2.5 and 10 μg/mL). Our results showed that NPs can induce oxidative stress, cellular stress, DNA damage, alterations in inflammatory response, and apoptosis, which could lead to tissue damage and neurodevelopmental diseases.
1. Introduction
Large plastic production [1, 2] and use have resulted in the release of plastic waste into aquatic, terrestrial and even aerial ecosystems, being a great problem to current and future generations [3]. These plastic materials with time, UV radiation, environmental variables, etc. can fragment into small micro (1 μm—5 mm, microplastics, MPs) and nano (< 1 μm, nanoplastics, NPs) sized particles [4, 5]. MPs and NPs are made of different plastic types such as polypropylene (PP), polyethylene (PE), or polystyrene (PS) [6, 7]. NPs and MPs are emerging pollutants which can accumulate in organisms and whose toxic and health effects have made them one of the international environmental, public health, and animal health priority targets [7, 8]. The MPs and NPs can enter the human body by inhalation, ingestion, and skin contact [9]. However, the answer to how these NMs pass through the gut, lungs and epithelia to other organs is very scarce. There is scientific evidence that they can reach the systemic circulation, penetrate, and accumulate in different tissues and organs such as brain, eyes, spleen, liver, bone marrow, etc. [9–11]. Other studies have shown that MPs and NPs produce impacts on development, growth, reproduction, behavior, and mortality in aquatic [12] and terrestrial animals [13]. In addition, some research suggests that NPs can accumulate in living organisms and can cause inflammation [14], oxidative stress [7], dysregulation of energy metabolism [15], endocrine disruption [16], apoptosis [17], and growth inhibition [18], among others. It has been suggested that oxidative stress can cause cellular damage that can lead to neuronal disorders, as they produce inhibition of acetylcholinesterase (AChE) activity and alter neurotransmitter levels [19, 20]. In addition, studies from our group, demonstrate that PS NPs cause increased gene expression of oxidative stress markers, apoptosis, inflammation, and inhibition of neurotransmitter (AChE) gene expression in zebrafish embryos (Zfe) [21]. Furthermore, these particles are able to enter the Zfe central nervous system (CNS), and cause deleterious effects, as well as endocrine system effects and behavioral alterations [11]. Their potential neurodevelopmental toxicity is a concern, as these nanomaterials can cross the Blood-Brain Barrier (BBB) [22]. In aquatic organisms the presence of latex NPs and PS NPs has been observed in various organs, including the brain of Medaka (Oryzias latipes) and other fish [23], producing behavioral disorders [24]. Currently, there are very few studies investigating the potential neurotoxicity of PS NPs in neural cell models. However, PS NPs have shown to reduce viability, activate inflammatory response, and induce apoptosis in other types of human cells such as A549 alveolar cells [25]. The relationship between NPs and alterations at the level of gene expression in stem cells is so far unknown [26].
The development of in vitro models for toxicity testing is currently being encouraged [27]. These models better reproduce human physiology and are replacing animal models. The main trend is to use immortalized cell lines derived from cancer tissues and, recently, models that include stem cells have also begun to be used [28]. These new models have advantages over cancer lines in that they do not have an altered genotype, which allows the presence of physiologically more important cell types and makes it possible to estimate interindividual variation [29, 30]. In our work, we analyzed the effects of NPs in an in vitro model based on human neural stem cells (hNS1), in order to obtain a real response of the effects caused by exposure to nanoparticles and to obtain more reliable results. To address this work, gene expression of different metabolic pathways, such as stress response (hsp27/hspB1, hsp60, hsp70/hspA5, and hsp90α), DNA repair (xrcc1, gad45a, rad51), oxidative damage response (Cu/ZnSOD 1, MnSOD 2), apoptotic response (Cas3a, Cas7, p53, Bcl2), and mitochondrial response (Cox5A), were analyzed after PS NP exposure, as biomarkers of NPs damage. Cells were exposed to concentrations similar to those present in the environment and/or used in previous studies (0.5, 2.5, and 10 μg/mL) for 4 days [11, 21, 31–34]. Currently, there is limited information on the neurotoxicity of NPs in mammals [22] and there are no data on the concentration and bioaccumulation of these nanomaterials in humans. This study provides a platform to examine the impacts of Polystyrene nanoparticles (PS NPs) on human neural stem cells, focusing on potential damage at the neurotoxicogenomic level in humans as the mechanisms of toxicity are largely unknown.
2. Material and methods
2.1 Cell culture
Cell line hNS1 was used as a model of human neural stem cells (hNSCs) that has been previously characterized [35–38]. This cell line is non-transformed, derived from human fetal forebrain and immortalized with v-myc [39]. Cells were cultured on poly-L-lysine (10 μg/mL; Sigma) coated plastic plates and proliferated in human stem cell (HSC) medium [Dulbecco’s Modified Eagle Medium (DMEM)/F12 with GlutaMAX-I medium (Gibco) containing 0.26% AlbumaMAXb (Gibco), 0.6% glucose (Merck), N2 Supplement 1X (Gibco), 5 mM HEPES (Gibco), penicillin/ streptomycin 1× (P/S; Lonza), non-essential aminoacids 1X (Gibco)] and supplemented with 20 ng/mL epidermal growth factor (EGF; PreproTech) and 20 ng/mL basic fibroblast growth factor (FGF2; PreproTech). hNS1 cells were differentiated by withdrawal of growth factors (EGF and FGF2) and addition of 0.5% heat-inactivated fetal bovine serum (FBS) (differentiation medium). Cells were kept in an incubator set to 37 °C and 5% CO2.
2.2 Nanoparticle preparation and cells exposure
Pristine PS particles with an average diameter of 30 nm were purchased from Thermo ScientificTM (Spain). NP of 1.05 g/cm³ density were provided as a 1% and 10% solution in water respectively, both with < 2% surfactant (SDS) to prevent agglomeration, and < 0.05% the antibacterial agent NaN3 (only fluorescently labelled particles). Nanoplastic particle size and charge were characterized in cell culture medium by nanoparticle tracking analysis (NTA), direct light scattering (DLS), and electron microscopy [21]. We published this characterization previously [21]. All cells were treated for 4 days with PS NPs after 2 days of seeding in the culture plate [3x105 cells/well (P6)]. The stock solution was shaken and sonicated for 10 min before utilization. The NPs were diluted in differentiation medium at 0.5, 2.5, and 10 μg/mL. The cells were differentiated for 4 days under exposure to PS NPs because preliminary studies showed that during that time of cell differentiation, a higher amount of NPs was found inside the treated cells. The stock solution of NPs was vortexed and sonicated for 10 min before use. NPs were diluted in differentiation medium to a final concentration of 0.5, 2.5 and 10 μg/mL. These concentrations were selected based on literature published. Due to methodological difficulties, very little work had been done measuring nanoparticles in the environment. However, a recent article by Materić [34] using novel methodology to measure NPs, has found these particles in Swedish lakes and streams with an average concentration of 0.56 mg/L. It is only logical to assume that concentrations in more populated/contaminated areas will be higher.
2.3 RNA extraction and cDNA synthesis
Total RNA extraction was performed from 0.5, 2.5, and 10 μg/mL treated 6x105 hNS1 cells and untreated control cells using a commercial kit (Trizol, Invitrogen) according to the manufacturer’s protocol. Cells frozen at -80 °C were homogenized in 500 μL of Trizol and left for 5 min at room temperature. Next, 0.2 volumes of chloroform were added to each sample, mixed, and left for 5 minutes at room temperature. Samples were centrifuged at 15,000 g for 15 minutes at 4 °C. The aqueous phase containing RNA was transferred to an eppendorf tube and precipitated with isopropyl alcohol (0.5 v/v), washed with 70% ethanol, and resuspended in DEPC water. Subsequently, RNA was treated with RNase-free DNase (Roche) followed by phenolization (phenol: chloroform: isoamyl alcohol-extracted, 25:24:1, and isopropanol-precipitated), and resuspended in DEPC water [40]. The quality and quantity of total RNA was determined by agarose electrophoresis and absorbance (Biophotomer Eppendorf). RNA was stored at -80 °C until use. The cDNA was synthesized from 500 ng total RNA, 500 ng Oligo dT20 (Invitrogen), and 100 u/μL MMLV enzyme (Invitrogen, Germany). The cDNA was frozen at -20 °C.
2.4 Real-time PCR
cDNA was used as a template in real-time PCR to analyse the messenger RNA (mRNA) expression profile of genes related to cell stress (hsp27/hspB1, hsp90α, and hsp70/hspA5), oxidative stress (Cu/ZnSOD 1, MnSOD 2, and cat), DNA repair (gadd45α, rad51, and xrcc1), apoptosis (Cas3a, Cas7, Bcl2, and p53), inflammatory (iL-6 and iL-8), and mitochondrial (cox 5A) responses. To amplify the sequence of the genes analysed in this study, oligonucleotides were designed from the GenBank accession sequences (Table 1). Treated cells RNAs were compared with RNAs extracted from control cells. The reaction was performed under the following conditions: initial denaturation at 95 °C for 3 min and 40 cycles of denaturation at 95 °C for 5 s; annealing at 58 °C for 15 s; and elongation at 65 °C for 10 s. The sequences of the oligonucleotides designed in this study for each of the mentioned genes are shown in Table 1. All samples were analysed in duplicate, and two replicates of each plate were performed. ADH:ubiquinone oxidoreductase subunit B4 (NDUFB4) and Ribosomal protein S27 (RPS27) genes, with a coefficient of variation < 0.25 and an M-value < 0.5, were used as endogenous reference controls to normalize the expression data of the selected study genes. PCR efficiency was performed by making calibration curves. A standard curve based on five dilutions of an equimolar mixture of cDNA samples was produced in triplicate to verify the amplification efficiency of each gene (Table 1).
Table 1. Oligonucleotide sequences.
Gene name | Function | Gene symbol | Accession number | Primer (5’–3’) | RT-PCR product size (bp) |
---|---|---|---|---|---|
NADH: ubiquinone oxidoreductase subunit B4 | Reference gene | NDUFB4 | NM_004547.6 | F: TTGGATCGAACATTTCACCTCTCA R1: GTCTGCTTCTGTGTTGTTAGGG |
176 |
Ribosomal protein S27 | Reference gene | RPS27 | NM_001030.6 | F: CGAGAACATGCCTCTCGCAAAG R: AGCATCCTGGGCATTTCACAT |
128 |
Cytochrome c oxidase subnit 5A mitochondrial | Mitochondrialresponse | Cox5A | NM_004255.4 | F: GGCTTAGGGGACTGGTTGTC R: CCGTAAGAGGGCTTGGCTAC |
133 |
Superoxide dismutase 1 | Antioxidant activity | Cu/ZnSOD1 | NM_000454.5 | F: ATGACTTGGGCAAAGGTGGA R: GGGCCTCAGACTACATCCAAG |
120 |
Superoxide dismutase 2 | Antioxidant activity | MnSOD2 | NM_001024465.3 | F: GCACTAGCAGCATGTTGAGC R: TTGATGTGAGGTTCCAGGGC |
139 |
Catalase | Antioxidant activity | cat | NM_001752 | F: CTGACTACGGGAGCCACATC R: GATGAGCGGGTTACACGGAT |
184 |
Heat shock protein | Stress response | hsp90α | NM_001017963.3 | F: GTGCTCGAGTCACATTCTGC R: CAACCCTTGGAGCAGCTAGT |
174 |
Heat shock protein | Stress response | hsp70/hspA5 | NM_005347 | F: TGAACCCTAGCTGTGTCAGA R: GCACCAGCCTGTCCTTTATT |
222 |
Heat shock protein | Stress response | hsp27/HspB1 | NM_001540.5 | F: GGCCCAGAAGCTGCAAAATC R: AAAGAACACACAGGTGGCGG |
112 |
Growth arrest and DNA-damage-inducible | DNA repair | gadd45α | NM_001924.4 | F: CACTGTCGGGGTGTACGAAG R: GTTGATGTCGTTCTCGCAGC |
157 |
X-ray repair cross complementing 1 | DNA repair | xrcc1 | NM_006297.3 | F: CCGATACGTCACAGCCTTCA R: TGTAGATCCATCGGGGACGA |
152 |
DNA repair protein RAD51 homolog 1 | DNA repair | rad51 | NM_002875.5 | F: GCAGTGCAAGCTATTTCAAGACA R: GCACAATCATCTGCAAGTGGG |
123 |
Interleukin | Inflammatory response | IL-6 | NM_000600.5 | F: TGCAATAACCACCCCTGACC R: GTGCCCATGCTACATTTGCC |
98 |
Interleukin | Inflammatory response | IL-8 | BC013615.1 | F3: GGCAACCCTAGTCTGCTAGC R3: TAAAGTGCTTCCACATGTCCTC |
139 |
Tumor necrosis factor alpha | Inflammatory response | TNFα | NM_000594.4 | F: AGAACTCACTGGGGCCTACA R: GCTCCGTGTCTCAAGGAAGT |
177 |
Tumor suppression | Inflammatory response | p53 | NM_000546.6 | F: TTCTGTCCCTTCCCAGAAAACC R: AACCCACAGCTGCACAGGGC |
156 |
Apoptosis regulator Bcl-2 | Apoptotic response | Bcl2 | NM_000633.3 | F: CCTATCTGGGCCACAAGTGAA R: ACAGCCTGCAGCTTTGTTTC |
122 |
Caspase-3 | Apoptotic response | Cas3a | NM_004346.4 | F: TGGTTTGAGCCTGAGCAGAG R: TGGCAGCATCATCCACACAT |
122 |
Caspase-7 | Apoptotic response | Cas7 | NM_001227.5 | F: TGGTTTGAGCCTGAGCAGAG R: TGGCAGCATCATCCACACAT |
142 |
Amplification of a single DNA fragment was confirmed by analysing the melting curve after amplification. All samples were analysed in duplicate and three independent PCR replicates were performed for each experiment. Cycle threshold (Ct) values were converted to relative gene expression levels by using the 2-DDCt method and Bio- Rad CFX Manager 3.1 software.
2.5 Statistical analysis
The RNA levels obtained were normalized against NADH: ubiquinone oxidoreductase subunit B4 (NDUFB4) and Ribosomal protein S27 (RPS27) reference genes. The comparison between the control and the treated larvae were done using the variance analysis test (ANOVA) with Dunnett’s multiple comparison tests. A level of significance is indicated: p≤0.05 (*). All statistical tests were performed with SPSS® 27.0 (SPSS Incorporated, Chicago IL, USA).
3. Results and discussion
Electron microscopy characterization of PS NPs showed that these particles were round with an average size of 25.1 ± 4 nm [21]. However, nanoparticle tracking analysis (NTA) analysis in cell culture medium showed agglomeration of these particles, even after sonicating. Particle size distribution and charge was as follows: 112.4 ± 37.5 nm size and -25 ± 1.06 mV charge for the 0.5 μg/mL concentration; 112.0 ± 44.2 nm and -33.8 ± 1.3 mV for the 2.5 μg/mL concentration; and 115 ± 43.9 and -33.95 ± 0.64 mV for the 10 μg/mL concentration. Even though aggregation was observed, we did not interfere with this natural phenomenon by adding surfactants as these could confound toxicity studies [41]. In addition, NPs are found in nature in both aggregated and unaggregated states and its important to evaluate effects of aggregated particles [42, 43]. Future studies should study aggregation patterns in test media as these could affect results [44].
3.1 Effects of PS NPs on gene expression of human neural stem cell line (hNS1)
To assess the molecular mechanisms of action of PS NPs, the expression changes of several genes in hNS1 cells were evaluated after PS NP exposure to three concentrations (0.5, 2.5 and 10 μg/mL) for 4 days. In general, we have found that NPs affected most gene expression in a concentration dependent manner, although some genes were upregulated while others were downregulated. Several genes were not altered.
3.2 Stress response: hsp27/ hspB1, hsp90α, and hsp70/hspA5
HSPs belong to a large family of conserved proteins whose function is to maintain cellular balance in response to different external factors [45–47]. In this study, the alteration of three stress response genes (hsp27/hspB1, hsp70/hspA5 and hsp90α) were assessed after 4 days of exposure. The results showed an increase of hsp27/hspB1 and hsp90α mRNA expression by PS NPs at 0.5, 2.5 and 10 μg/mL (Fig 1), being statistically significant at the highest concentration.
Fig 1. Expression levels of the hsp27/hspB1, hsp70/hspA5, and hsp90α genes.
Statistical differences compared to control were marked with asterisks (p—value< 0.05). C: control. Error bars are based on the standard deviation.
In contrast, inhibition of hsp70/hspA5 mRNA expression by PS NPs was observed at all concentrations studied, although only significant at 10 μg/mL. These results demonstrate that PS NPs alter the cellular response to stress in human neural cells. HSP27/HSPB1 belongs to the family of small heat shock protein (SHSPs, between 12 and 43 kDa) [48] which plays an essential physiological and pathophysiological role in diverse neurodegenerative diseases [47]. Members of this family, including HSP27/HSPB1, are expressed in the central nervous system in stress and non-stress situations [49] and are related to neurodegenerative diseases (Alzheimer’s, Alexander’s disease, multiple sclerosis) [47]. Moreover, The SHSPs interact with protein aggregates that present a detrimental conformation, such as β-amyloid peptide aggregates in Alzheimer’s disease, superoxide dismutase 1 in sclerosis, etc. Our data show that the presence of NPs can induce activation of hsp27/hspB1 gene expression. This is important because previous studies show that it is upregulated in the brains of people with Alexander and Alzheimer’s diseases [50–52]. Moreover, HSP27/HSPB1 regulates the activation of proinflammatory genes [53] and the release of proinflammatory mediators [54], in reaction to cell damage or stress [55]. Furthermore, previous studies showed that when this protein is administered extracellularly it modulates immune and inflammatory processes [56], and it has also been shown to block the apoptotic pathway [57, 58]. On the other hand, the other two HSPs studied, HSP70/HSPA5 and HSP90α, are large ATP-dependent chaperones with a molecular mass of approximately 40 to 105 kDa. As mentioned above, our results seem to indicate that NPs modify the expression of both genes. hsp70/hspA5 and hsp90α can be induced under stress, unlike the hsp90β isoform that is constitutively expressed [46]. In the presence of PS NPs, hsp90α expression levels increased. In contrast, treatment with PS NPs downregulated hsp70/hspA5 expression. Inhibition of the antiapoptotic gene hsp70/hspA5 has been described in Zfe [21], in human cells [26], and in Apostichopus japonicus [59] exposed to NPs. It appears that these nanomaterials alter the stress and anti-apoptotic response of the hsp70/hspA5 gene. Previous studies suggest that this down-regulation of the hsp70/hspA5 antiapoptotic gene may be related to entry into apoptosis [60, 61]. On the other hand, HSP70/HSPA5 has an alternate role in protein folding, together with HSP90α [62]. This is the first evidence that NPs induce hsp90α overexpression in human neuronal cells. However, hsp70/hspA5 and hsp90α up-regulation has been observed in Daphnia pulex after treatment to 75 nm PS particles [63]. It is possible that in the face of the inhibition of hsp70/hspA5 expression shown in our results, the correct folding carried out by HSP70/HSPA5 together with HSP90α [62] cannot take place and this has neurotoxic consequences in the cell by accumulation of misfolded proteins. Clearly further work is needed to corroborate these hypotheses.
3.3 Oxidative stress response: Cu/Zn SOD1, MnSOD2, and cat
Previous studies have described that NPs can stimulate reactive oxygen species (ROS) production and cause oxidative stress in human cells [64], Zfe [17, 21, 63–65], and in Daphnia pulex and Karenia mikimotoi [66]. Increased ROS can generate oxidative stress, mitochondrial damage, amplified inflammatory cytokines and proapoptotic factors that could induce apoptosis in cells and in animals [56, 67–70]. Superoxide dismutase (SOD) and catalase (CAT) enzymes can be activated in the presence of ROS. These antioxidant enzymes have the function of protecting against ROS [71]. There are two different SOD isoenzymes (SOD1 and SOD2) present inside cells [72]. SOD 1 (Cu/ZnSOD1) is located in the cytoplasm and in the mitochondrial intermembrane space, peroxisomes, and nucleus. SOD 2 (MnSOD2) is a mitochondrial manganese protein, responsible for the removal of superoxide anions produced during oxidative phosphorylation. Catalase (CAT) is an enzyme that mitigates the toxic effects of hydrogen peroxide [73]. In this study, the effect of PS NPs (30 nm) on hNS1 induced changes in the expression of Cu/ZnSOD1 and cat (Fig 2), specifically, it resulted in the activation of RNA expression of these oxidative stress-related genes, although not in a dose-dependent manner (Fig 2).
Fig 2. Cat, Cu/ZnSOD1 and MnSOD2 genes expression.
Statistical differences of controls versus larvae exposed to NPs are indicated by asterisks (p-value < 0.05). C: control. Error bars are based on the standard deviation.
These results agree with data obtained in human HepG2 cells exposed to 50 nm NPs [74] and in zebrafish embryos (Zfe) exposed to 30 nm NPs [21]. However, the opposite result was reported by Aliakbarzadeh [30] who demonstrated that exposure to NPs inhibited CAT activity in zebrafish larvae. Oxidative stress can be considered as one of the molecular initiating events responsible for the toxicity of NPs [75].
3.4 DNA Damage response: gadd45α, rad51, and xrcc1
NPs can cause DNA damage in blood cells in mussels [76], in fish [77, 78], and in other aquatic species [79–82]. Most of these evaluations have been performed using the comet assay, but there are almost no studies that analyze the response at the molecular level of genes implicated in response to DNA damage. In this study, we decided to analyze the expression of three genes related to the DNA repair process, gadd45α, rad51, and xrcc1 in human neural stem cells exposed to PS NPs for 4 days. Gadd45α is involved in the repair of DNA by nucleotide excision [83] and in mediating apoptosis induced by stress and genotoxic agents, such as pollutants or radiation. RAD51 is a protein implicated in DNA repair of double-strand breaks (DSBR), and their dysfunction is linked to diseases like cancer [84]. XRCC1 is a protein that interacts with multiple enzymatic components in single-stranded DNA break repair (SSBR) [85]. Together they are capable of accelerating SSRP and DSBR. In NP-treated hNS1 cells, the expression levels of the genes, gadd45α and rad51, were increased at the highest dose, whereas the xrcc1 expression was decreased after NPs exposure, only significant at 2.5 μg/mL (Fig 3).
Fig 3. Representation of gadd45α, rad51, and xrcc1 gene expression.
Asterisks indicate statistical differences compared to controls (p-value < 0.05). C: control. Error bars are based on the standard deviation.
These results suggest that oxidative stress induced by NPs [26, 69, 86–88] can produce DNA damage [89]. Previous studies in mice with the xrcc1 gene deletion show a link between DNA strand break repair and neurogenesis [90]. Also, deletion of xrcc1 in the brain results in neuropathologies [90]. Inherited mutations in xrcc1 lead to neurodevelopmental disorders and/or neurodegeneration [91, 92]. The inhibition of xrcc1 expression and hsp27/hspB1 activation in the presence of NPs suggests that these nanomaterials could cause DNA damage with neuropathological implications that could be related to neurodegenerative disorders. This information opens an avenue for further study of the possible damage of NPs at the level of the nervous system. Overexpression of gadd45α and rad51 genes would indicate activation of DNA repair mechanisms by the presence of NPs, suggesting that DNA damage was likely caused by activation of oxidative stress induced in hNSCs. These results agree with those obtained in Allium cepa cells [93] but are in discordance with results obtained with NPs in Zfe [21]. The model used for the toxicity tests (whole organism vs cells) and the exposure conditions could explain the difference between the results. This is the first study demonstrating that NPs produce DNA damage in human neuronal cells.
3.5 Apoptotic response: Cas3a, Cas7, p53 and anti-apoptotic gene Bcl2
Quantitative polymerase chain reaction (qPCR) assays indicated that the mRNA level of Cas7 increased significantly in cells treated with NPs at the lowest concentration, whereas Bcl2 increased significantly at all concentrations studied and Cas3α and p53 did not change expression levels (Fig 4). Bcl2 is a member of the family of anti-apoptotic genes inhibiting proapoptotic genes [88]. The up regulation of this antiapoptotic gene could be a consequence of the entry into apoptosis and could be in agreement with the observed activation of the expression of the hsp27/hspB1 gene, whose anti-apoptotic function has been described [57, 58]. This would suggest that NPs induce the expression of antiapoptotic proteins. This result agrees with those obtained in Zfe, Crassostrea virginica, and Sterechinus neumayeri exposed to NPs [94–96]. In contrast, our previous results showed down-regulation of Bcl2 activity after NPs exposure in Zfe [21]. This discrepancy in results may be due to the difference in response to PS NPs from a whole organism or from a specific cell culture of hNSC, as in the Zfe model observe the response of all cell types within the individual, and not only neural cells. On the other hand, the exposure times were different in both models. Caspases are a family of highly conserved intracellular proteases cysteine-dependent intracellular proteases with an important role in inflammatory responses and apoptosis [92]. Caspases -3, -6 and -7 belong to the group of apoptosis executioners [97]. In this study, we analyzed the expression of two caspases (Cas3a and Cas7) involved in apoptosis. The results show a tendency to activate Cas7 gene expression at the lowest concentration, but Cas3a was not significantly altered (Fig 4).
Fig 4. Expression of the Cas3a, Cas7, Bcl2 and p53 genes.
Error bars are based on the standard deviation. Asterisks indicate statistical differences compared to controls (p-value < 0.05). C: control.
It is possible that predicted NP-induced apoptosis could be partially blocked by overexpression of anti-apoptotic genes (Bcl2 and hsp27/hspB1). This is supported by previous results suggesting that the NPs activate programmed cell death in human lung epithelial cells [25]. Assays with shorter exposure times would probably allow us to test this hypothesis. The p53 tumor suppressor is a homotetrameric transcription factor involved in the control of cell proliferation and cell cycle, senescence, cell survival and apoptosis [88, 98]. ROS act as a key initiator in several signalling pathways involving cell cycle and energy metabolism [99]. Qiang and Cheng [100] have reported ROS-mediated activation of the p53 apoptotic cascade due to MPs exposure. Moreover, the p53 gene transduces signals to stimulate apoptosis through activation of cas3b and gadd45ba [101, 102]. Our results show that p53 gene expression does not change in human neuronal cells after exposure to NPs for 4 days (Fig 4).
In general, we hypothesize that the increased expression of the anti-apoptotic genes Bcl2 and hsp27/hspB1 after exposure of neuronal cells to NPs is possibly the result of activation of apoptosis as this process usually occurs as a consequence of oxidative stress and DNA damage induced by NPs. Ultimately, our results suggest that DNA damage and oxidative stress produced by NPs in human neuronal cells induce apoptosis. This is supported by the overexpression of the anti-apoptotic genes Bcl2 and hsp27/hspB1, together with the activation of the apoptotic gene Cas7. Our results show that the executing caspases are only activated at the lowest concentration of NPs. It is possible that the anti-apoptotic response is preventing the cell from entering apoptosis.
3.6 Inflammatory and mitochondrial response: IL-6, IL-8, TNF and Cox5A
Our results show that PS NPs induced biphasic responses in these genes as they inhibited TNFa expression after 2.5 μg/mL exposure and activated TNFa expression after 10 μg/mL exposure (Fig 5).
Fig 5. Expression of the TNFα, IL-8, and IL-6 genes.
Error bars are based on the standard deviation. Asterisks indicate statistical differences compared to controls (p-value < 0.05). C: control.
Moreover, they inhibited the expression of IL-6 at all concentrations used but specially at 0.5 μg/mL (albeit not significantly) and IL-8 gene when cells are exposed to 0.5 μg/mL (Fig 5). However, as the graph shows (Fig 5), a trend of IL-8 gene activation is observed when we increased the concentration of PS NPs. Therefore, here we demonstrate that PS NPs can modify the expression of TNFα and IL-6 and IL-8, which are essential genetic markers in the inflammatory mechanisms. Activation of the inflammatory response has been described in human lung epithelial cells [25] and in Zfe exposed to NPs [14, 21, 103]. On the other hand, it has been previously shown in human synovial fibroblasts (SFC) that proinflammatory cytokines such as TNF, IL-1, and IL-6 can induce the expression of hsp70/hspA5 under cellular stress [104] in order to protect the cell from apoptosis. It is possible that the inhibition of hsp70/hspA5 observed in our results after exposure to PS NPs is a consequence of the non-activation of one of the proinflammatory genes analyzed (IL-6). Our results suggest that NPs can modify the inflammatory response in human neural stem cells, but this depended on the concentration of the NPs.
Cytochrome c oxidase (COX) is a mitochondrial enzyme of the respiratory chain. This protein is implicated in proton pumping and is essential for ATP synthesis. Deficient COX5A expression significantly impairs COX function, thus causing mitochondrial dysfunction in skeletal muscle, pulmonary arterial hypertension, and growth retardation [105, 106]. COX has a regulatory role in electron transport [107]. Many xenobiotics inhibit COX activity and generate mitochondrial stress, but their mechanisms are unknown [108, 109]. However, little is known about the role of COX5A in the response to pollutants. Our results showed that hNS1 cells exposed to different concentrations of NPs did not modify Cox5A expression (Fig 6).
Fig 6. Expression of the Cox5A gene.
C: control. Error bars are based on the standard deviation.
These results contradict previous data and possible differences in NP size and/or concentrations could be responsible for these differences [110, 111].
4. Conclusions
Our results show that Cu/ZnSOD 1 and cat expression are activated in hNSC exposed to PS NPs. This antioxidant response may be a consequence of the production of reactive oxygen species (ROS) induced by NPs entering the cells. Possibly the antioxidant metabolism response is not sufficient to stop ROS damage to DNA. As a consequence of this DNA damage, the expression levels of genes involved in DNA repair (gadd45a and rad51) are increased, although an inhibition of xrcc1 is also seen. All this suggests that DNA repair mechanisms are altered in hNSC treated with PS NPs. The oxidative stress and DNA damage produced by NPs would activate cell apoptosis. This is supported by the increased expression of anti-apoptotic genes, such as Bcl2 and hsp27/hspB1, together with the apoptotic gene Cas7. However, the up regulation of anti-apoptotic genes (Bcl2 and hsp27/hspB1) would not have been sufficient to block the activation of apoptotic gene expression (Cas7). It is possible that there is a partial blockade of these apoptotic genes at the concentrations and times studied, but further research is needed in this line of investigation. On the other hand, inhibition of hsp70/hspA5, a chaperone involved in the early steps of protein folding, would avoid the activity of HSP90α. This would lead to the accumulation of misfolded proteins and potential cellular neurotoxic effects. Finally, NPs alter the inflammatory response (TNFα, IL-6 and IL-8) of hNSC, but effects depended on concentrations, and possibly timing and size of NPs studied. The results of this study suggest that PS NPs can cause damage and functional alterations in human neuronal cells. Therefore, the effects of NPs on pathways related to neurodevelopmental problems and neurodegenerative diseases need to be further investigated.
Acknowledgments
We would like to thank Helena Dorado Monreal, Laura Flores López and Sonia de la Mata from the Departamento de Física Matemática y de Fluidos (UNED) for their technical support, and the Electron Microscopy Unit (Instituto de Salud Carlos III) for the contribution in the processing and analysis of electron microscopy samples.
Data Availability
All Results NPs cells files are available from the Dryad repository (doi:10.5061/dryad.zpc866tf9).
Funding Statement
The authors received no specific funding for this work.
References
- 1.Jambeck J.R., Geyer R., Wilcox C., Siegler T.R., Perryman M., Andrady A., et al. 2015. Marine pollution. Plastic waste inputs from land into the ocean. Science. 347(6223), 768–71. doi: 10.1126/science.1260352 [DOI] [PubMed] [Google Scholar]
- 2.Plastics Europe, 2020. Plastics the Facts 2020. https://www.plasticseurope.org/en/resources/publications/4312-plastics-facts-2020. (Accessed February 2021).
- 3.Huang D., Tao J., Cheng M., Deng R., Chen S., Yin L., et al. 2021. Microplastics and nanoplastics in the environment: Macroscopic transport and effects on creatures. Hazard Mater. 407,124399. doi: 10.1016/j.jhazmat.2020.124399 [DOI] [PubMed] [Google Scholar]
- 4.Andrady A.L., 2017. The plastic in microplastics: A review. Mar Pollut Bull; 119: 12–699 22. doi: 10.1016/j.marpolbul.2017.01.082 [DOI] [PubMed] [Google Scholar]
- 5.Gigault J., Ter Halle A., Baudrimont M., Pascal P.-Y., Gauffre F., Phi T.-L., et al., 2018. Current opinion: what is a nanoplastic? Environ. Pollut. 235, 1030–1034. doi: 10.1016/j.envpol.2018.01.024 [DOI] [PubMed] [Google Scholar]
- 6.Matsuguma Y, Takada H., Kanke H., Sakurai S., Suzuki T., Itoh M., et al. 2017. Microplastics in sediment cores from Asia and Africa as indicators of temporal trends in plastic pollution. Archives of Environmental Contamination and Toxicology 73(2):230–9. https://link.springer.com/article/10.1007/s00244-017-0414-9 [DOI] [PubMed] [Google Scholar]
- 7.Lei L., Liu M., Song Y., Lu S., Hu J., Cao C., et al. 2018. Polystyrene (nano) microplastics cause size-dependent neurotoxicity, oxidative damage and other adverse effects in Caenorhabditis elegans, Environ. Sci.: Nano 5 (8), 2009–2020. doi: 10.1039/C8EN00412A [DOI] [Google Scholar]
- 8.Bradney L., Wijesekara H., Palansooriya K.N., Obadamudalige N., Bolan N.S., Ok Y. S., et al. 2019. Particulate plastics as a vector for toxic trace-element uptake by aquatic and terrestrial organisms and human health risk. Environ. Int. 131, 104937. doi: 10.1016/j.envint.2019.104937 [DOI] [PubMed] [Google Scholar]
- 9.Yee M.S., Hii L.W., Looi C.K., Lim W.M., Wong S.F., Kok Y.Y., et al. 2021. Impact of Microplastics and Nanoplastics on Human Health. Nanomaterials 11(2), 496. doi: 10.3390/nano11020496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lehner R.; Weder C.; Petri-Fink A.; Rothen-Rutishauser B., 2019. Emergence of Nanoplastic in the Environment and Possible Impact on Human Health. Environ. Sci. Technol., 53, 1748–1765. doi: 10.1021/acs.est.8b05512 [DOI] [PubMed] [Google Scholar]
- 11.Torres-Ruiz M., Alba M., Morales M., Martin-Folgar R., Carmen González MC., Cañas I., et al. 2023. Neurotoxicity and endocrine disruption caused by polystyrene nanoparticles in zebrafish embryo. Science of The Total Environment, 874,162406. doi: 10.1016/j.scitotenv.2023.162406 [DOI] [PubMed] [Google Scholar]
- 12.Wang Y., Branicky R., Noe A., Hekimi S., 2018. Superoxide dismutases: dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 217, 1915–1928. doi: 10.1083/jcb.201708007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Larue C., Sarret G., Castillo-Michel H., Pradas Del Real A.E., 2021. A Critical Review on the Impacts of Nanoplastics and Microplastics on Aquatic and Terrestrial Photosynthetic Organisms. Small. 17(20), 2005834. doi: 10.1002/smll.202005834 [DOI] [PubMed] [Google Scholar]
- 14.Brun N.R., Koch B.E.V., Varela M., Peijnenburg W.J.G.M., Spaink H.P., Vijver M.G., 2018. Nanoparticles induce dermal and intestinal innate immune system responses in zebrafish embryos. Environmental Science: Nano 5, 904–916. doi: 10.1039/c8en00002f [DOI] [Google Scholar]
- 15.Wright S.L., Thompson R.C., Galloway T.S., 2013. The physical impacts of microplastics on marine organisms: a review. Environ Pollut. 178:483–92. doi: 10.1016/j.envpol.2013.02.031 [DOI] [PubMed] [Google Scholar]
- 16.Rochman C.M., Kurobe T., Flores I., Teh SJ. 2014. Early warning signs of endocrine disruption in adult fish from the ingestion of polyethylene with and without sorbed chemical pollutants from the marine environment. Sci Total Environ. 493:656–61. doi: 10.1016/j.scitotenv.2014.06.051 [DOI] [PubMed] [Google Scholar]
- 17.Hu Q., Wang H., He C., Jin Y., Fu Z., 2020. Polystyrene nanoparticles trigger the activation of p38 MAPK and apoptosis via inducing oxidative stress in zebrafish and macrophage cells. Environ. Pollut. 269, 116075. doi: 10.1016/j.envpol.2020.116075 [DOI] [PubMed] [Google Scholar]
- 18.Besseling E., Foekema E.M., Van Franeker J.A., Leopold M.F., Kühn S., Bravo Rebolledo E.L., et al. 2015. Microplastic in a macro filter feeder: Humpback whale Megaptera novaeangliae. Mar Pollut Bull. 95,248–52. doi: 10.1016/j.marpolbul.2015.04.007 [DOI] [PubMed] [Google Scholar]
- 19.Yong C.Q.Y., Valiyaveetill S., Tang B.L., 2020. Toxicity of microplastics and nanoplastics in mammalian systems. Int. J. Environ. Res. Public Health. 17. doi: 10.3390/ijerph17051509 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Barboza L.G.A., Vieira L.R., Branco V., Figueiredo N., Carvalho F., Carvalho C., et al. 2018. Microplastics cause neurotoxicity, oxidative damage and energy-related changes and interact with the bioaccumulation of mercury in the European seabass, Dicentrarchus labrax (Linnaeus, 1758). Aquat Toxicol. 195, 49–57. doi: 10.1016/j.aquatox.2017.12.008 [DOI] [PubMed] [Google Scholar]
- 21.Martin-Folgar R., Torres-Ruiz M., de Alba M., Cañas-Portilla A.I., González M.C., Morales M., 2023. Molecular effects of polystyrene nanoplastics toxicity in zebrafish embryos (Danio rerio). Chemosphere; 312(Pt 1):137077. doi: 10.1016/j.chemosphere.2022.137077 [DOI] [PubMed] [Google Scholar]
- 22.Prüst M., Meijer J., Westerink RHS., 2020. The plastic brain: neurotoxicity of micro- and nanoplastics. Part Fibre Toxicol. 17(1), 24. doi: 10.1186/s12989-020-00358-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kashiwada S., 2006. Distribution of nanoparticles in the see-through Medaka (Oryzias latipes). Environ. Health Perspect. 114, 1697–1702. doi: 10.1289/ehp.9209 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mattsson K., Johnson E.V., Malmendal A., Linse S., Hansson L.-A., Cedervall T., 2017. Brain damage and behavioural disorders in fish induced by plastic nanoparticles delivered through the food chain. Sci. Rep. 7, 11452. doi: 10.1038/s41598-017-10813-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xu M., Halimu G., Zhang Q., Song Y., Fu X., Li Y., et al. 2019. Internalization and toxicity: A preliminary study of effects of nanoplastic particles on human lung epithelial cell. Sci Total Environ.694, 133794. doi: 10.1016/j.scitotenv.2019.133794 [DOI] [PubMed] [Google Scholar]
- 26.Im G.B., Kim Y.G, Jo I.S., Yoo T.Y., Kim S.W., Park H.S., et al. 2022. Effect of polystyrene nanoplastics and their degraded forms on stem cell fate. Hazard Mater. 430, 128411. doi: 10.1016/j.jhazmat.2022.128411 [DOI] [PubMed] [Google Scholar]
- 27.Fröhlich E. 2018. Comparison of conventional and advanced in vitro models in the toxicity testing of nanoparticles. Artif. Cells Nanomed Biotechnol. 46, 1091–1107. doi: 10.1080/21691401.2018.1479709 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.More S., Bampidis V., Benford D., Bragard C., Halldorsson T., Hernández-Jerez A. 2021. Guidance on risk assessment of nanomaterials to be applied in the food and feed chain: Human and animal health. EFSA J. 19 (8), e06768. doi: 10.2903/j.efsa.2021.6768 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Busch M., Brouwer H., Aalderink G., Bredeck G., Kämpfer A.A.M., Schins R.P.F., et al. 2023. Investigating nanoplastics toxicity using advanced stem cell-based intestinal and lung in vitro models. Front Toxicol. 27;5:1112212. doi: 10.3389/ftox.2023.1112212 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Aliakbarzadeh F., Rafiee M., Khodagholi F., Khorramizadeh M.R., Manouchehri H., Eslami A., et al. 2023. Adverse effects of polystyrene nanoplastic and its binary mixtures with nonylphenol on zebrafish nervous system: From oxidative stress to impaired neurotransmitter system. Environ Pollut. 15:317:120587. doi: 10.1016/j.envpol.2022.120587 [DOI] [PubMed] [Google Scholar]
- 31.Torres-Ruiz M., De la Vieja A., de Alba Gonzalez M., Esteban Lopez M., Castaño Calvo A., Cañas Portilla A.I., 2021. Toxicity of nanoplastics for zebrafish embryos, what we know and where to go next. Sci Total Environ. 797, 149125. doi: 10.1016/j.scitotenv.2021.149125 [DOI] [PubMed] [Google Scholar]
- 32.Materić D., Holzinger R., Niemann H., 2022a. Nanoplastics and ultrafine microplastic in the Dutch Wadden Sea–The hidden plastics debris? Science of The Total Environment; 846: 157371. doi: 10.1016/j.scitotenv.2022.157371 [DOI] [PubMed] [Google Scholar]
- 33.Materić D., Kjær H.A., Vallelonga P., Tison J.L., Röckmann T., Holzinger R., 2022b. Nanoplastics measurements in Northern and Southern polar ice. Environmental Research; 208: 112741. doi: 10.1016/j.envres.2022.112741 [DOI] [PubMed] [Google Scholar]
- 34.Materić D., Peacock M., Dean J., Futter M., Maximov T., Moldan F., et al. 2022c. Presence of nanoplastics in rural and remote surface waters. Environmental Research Letters; 17, 054036. doi: 10.1088/1748-9326/ac68f7 [DOI] [Google Scholar]
- 35.Sandoval L., Rosca A., Oniga A., Zambrano A., Ramos J.J., González MC., et al. 2019. Effects of chlorpyrifos on cell death and cellular phenotypic specification of human neural stem cells Science of the Total Environment 683, 445–454. doi: 10.1016/j.scitotenv.2019.05.270 [DOI] [PubMed] [Google Scholar]
- 36.Coronel R., Bernabeu-Zornoza A., Palmer C., Muñiz-Moreno M., Zambrano A., Cano E., et al. 2018. Role of Amyloid Precursor Protein (APP) and Its Derivatives in the Biology and Cell Fate Specification of Neural Stem Cells, Molecular Neurobiology, 55(9), pp. 7107–7117. doi: 10.1007/s12035-018-0914-2 [DOI] [PubMed] [Google Scholar]
- 37.Liste I., García-García E. and Martínez-Serrano A., 2004. The Generation of Dopaminergic Neurons by Human Neural Stem Cells Is Enhanced by Bcl-XL, Both In Vitro and In Vivo, Journal of Neuroscience, 24 (48), 10786–10795. doi: 10.1523/JNEUROSCI.3208-04.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Liste I., García-García E., Bueno C., Martínez-Serrano A., 2007. Bcl-XL modulates the differentiation of immortalized human neural stem cells. Cell Death and Differentiation, 14(11), pp. 1880–1892. doi: 10.1038/sj.cdd.4402205 [DOI] [PubMed] [Google Scholar]
- 39.Villa A., Snyder E. Y., Vescovi A., Martínez-Serrano A., 2000. Establishment and properties of a growth factor-dependent, perpetual neural stem cell line from the human CNS. Experimental neurology, 161(1), 67–84. doi: 10.1006/exnr.1999.7237 [DOI] [PubMed] [Google Scholar]
- 40.Martínez-Paz P., Morales M., Urien J., Morcillo G., Martínez-Guitarte J.L., 2017. Endocrine-related genes are altered by antibacterial agent triclosan in Chironomus riparius aquatic larvae. Ecotoxicol. Environ. Saf. 140, 185–190. doi: 10.1016/j.ecoenv.2017.02.047 [DOI] [PubMed] [Google Scholar]
- 41.Summers S., Henry T., & Gutierrez T., 2018. Agglomeration of nano-and microplastic particles in seawater by autochthonous and de novo-produced sources of exopolymeric substances. Marine pollution bulletin, 130, 258–267. doi: 10.1016/j.marpolbul.2018.03.039 [DOI] [PubMed] [Google Scholar]
- 42.Wang J., Zhao X., Wu A., Tang Z., Niu L., Wu F., et al. 2021. Aggregation and stability of sulfate-modified polystyrene nanoplastics in synthetic and natural waters. Environmental Pollution. 268, 114240. doi: 10.1016/j.envpol.2020.114240 [DOI] [PubMed] [Google Scholar]
- 43.Olubukola S., Alimi J., Budarz F, Hernandez L.M., Tufenkji N., 2018. Microplastics and Nanoplastics in Aquatic Environments: Aggregation, Deposition, and Enhanced Contaminant Transport. Environ Sci Technol 52 (4):1704–1724. doi: 10.1021/acs.est.7b05559 [DOI] [PubMed] [Google Scholar]
- 44.Vaz V.P., Nogueira D.J., Vicentini D.S., Matias W.G., 2021. Can the sonication of polystyrene nanoparticles alter the acute toxicity and swimming behavior results for Daphnia magna? Environ. Sci. Pollut. Control Ser. 28, 14192–14198. doi: 10.1007/s11356-021-12455-2 [DOI] [PubMed] [Google Scholar]
- 45.Sørensen J.G., Kristensen T.N., Loeschcke V., 2003. The evolutionary and ecological role of heat shock proteins. Ecology Letters, 6, 1025–1037. doi: 10.1046/j.1461-0248.2003.00528.x [DOI] [Google Scholar]
- 46.Miller D.J., Fort P.E., 2018. Heat shock proteins regulatory role in neurodevelopment. Front. Neurosci. 12, 12. doi: 10.3389/fnins.2018.00821 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Zhu Z., Reiser G., 2018. The small heat shock proteins, especially HspB4 and HspB5 are promising protectants in neurodegenerative diseases. Neurochem Int.May;115:69–79. doi: 10.1016/j.neuint.2018.02.006 [DOI] [PubMed] [Google Scholar]
- 48.Bakthisaran R., Tangirala R., Rao C. M., 2015. Small heat shock proteins: role in cellular functions and pathology. Biochim. Biophys. Acta 1854, 291–319. doi: 10.1016/j.bbapap.2014.12.019 [DOI] [PubMed] [Google Scholar]
- 49.Kirbach B.B., Golenhofen N., 2011. Differential expression and induction of small heat shock proteins in rat brain and cultured hippocampal neurons. J. Neurosci. Res 89:162–175. doi: 10.1002/jnr.22536 [DOI] [PubMed] [Google Scholar]
- 50.Head M.W., Corbin E., Goldman J.E., 1993. Overexpression and abnormal modification of the stress proteins αB-crystallin and hsp27 in Alexander disease. Am. J. Pathol., 143, 1743–175. [PMC free article] [PubMed] [Google Scholar]
- 51.Iwaki T., Iwaki A., Tateishi J., Sakaki Y., Goldman J.E., 1993. αB-crystallin and 27- kd heat shock protein are regulated by stress conditions in the central nervous system and accumulate in Rosenthal fibers Am. J. Pathol., 143, 487–495. [PMC free article] [PubMed] [Google Scholar]
- 52.Renkawek K., Voorter C.E.M., Bosman G.J., van Workum F.P., de Jong W., 1994. Expression of αB-crystallin in Alzheimers disease Acta Neuropathol., 87, 155–160. [DOI] [PubMed] [Google Scholar]
- 53.Alford K.A., Glennie S., Turrell B.R., Rawlinson L., Saklatvala J., Dean J.L., 2007. Heat shock protein 27 functions in inflammatory gene expression and transforming growth factor-β-activated kinase-1 (TAK1)-mediated signaling. J. Biol. Chem., 282, 6232–6241. doi: 10.1074/jbc.M610987200 [DOI] [PubMed] [Google Scholar]
- 54.Sur R., Lyte P.A., Southall M.D., 2008. Hsp27 regulates pro-inflammatory mediator release in keratinocytes by modulating NF-κB signaling. Journal of investigative dermatology 5, 1116–1122. doi: 10.1038/sj.jid.5701157 [DOI] [PubMed] [Google Scholar]
- 55.Brownell S.E., Becker R.A., Steinman L., 2012. The protective and therapeutic function of small heat shock proteins in neurological diseases. Front Immunol. 3, 1–10. doi: 10.3389/fimmu.2012.00074 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Banerjee A., Shelver W.L., 2021. Micro- and nanoplastic induced cellular toxicity in mammals: A review. Sci. Total Environ. 755,142518. doi: 10.1016/j.scitotenv.2020.142518 [DOI] [PubMed] [Google Scholar]
- 57.Bruey J.M, Ducasse C., Bonniaud P., et al., 2000. Hsp27/hspB1 negatively regulates cell death by interacting with cytochrome c. Nat Cell Biol 2, 645–52. doi: 10.1038/35023595 [DOI] [PubMed] [Google Scholar]
- 58.Garrido C., Bruey J.M., Fromentin A., Hammann A., Arrigo A.P., Solary E., 1999. HSP27/HSPB1 inhibits cytochrome c-dependent activation of procaspase-9. FASEB J. 13, 2061–70. doi: 10.1096/fasebj.13.14.2061 [DOI] [PubMed] [Google Scholar]
- 59.Liu J., Xu D., Chen Y., Zhao C., Liu L., Gu Y., et al. 2022. Adverse effects of dietary virgin (nano)microplastics on growth performance, immune response, and resistance to ammonia stress and pathogen challenge in juvenile sea cucumber Apostichopus japonicus (Selenka). Hazard Mater. 2022 Feb 5;423(Pt A):127038. doi: 10.1016/j.jhazmat.2021.127038 [DOI] [PubMed] [Google Scholar]
- 60.Joly A.L., Wettstein G., Mignot G., Ghiringhelli F., Garrido C., 2010. Dual role of heat shock proteins as regulators of apoptosis and innate immunity. J. Innate Immun. 2, 238–247. doi: 10.1159/000296508 [DOI] [PubMed] [Google Scholar]
- 61.Wang X., Chen M., Zhou J., Zhang X., 2014. HSP27/HSPB1, 70 and 90, anti-apoptotic proteins, in clinical cancer therapy (Review). Int. J. Oncol. 45, 18–30. doi: 10.3892/ijo.2014.2399 [DOI] [PubMed] [Google Scholar]
- 62.Radli M., and Rüdiger S. G. D. (2018) Dancing with the diva: Hsp90–client interactions. J. Mol. Biol. 430, 3029–3040 doi: 10.1016/j.jmb.2018.05.026 [DOI] [PubMed] [Google Scholar]
- 63.Liu Z., Yu P., Cai M., Wu D., Zhang M., Huang Y., et al. 2019. Polystyrene nanoplastic exposure induces immobilization, reproduction, and stress defense in the freshwater cladoceran Daphnia pulex. Chemosphere. 215,74–81. doi: 10.1016/j.chemosphere.2018.09.176 [DOI] [PubMed] [Google Scholar]
- 64.Zhang Y., Tekobo S., Tu Y., Zhou Q., Jin X., Dergunov S.A., et al. 2012. Permission to enter cell by shape: nanodisk vs nanosphere. ACS Appl. Mater. Interfaces 4,4099–4105. doi: 10.1021/am300840p [DOI] [PubMed] [Google Scholar]
- 65.Qiao R., Sheng C., Lu Y., Zhang Y., Ren H., Lemos B., 2019. Microplastics induce intestinal inflammation, oxidative stress, and disorders of metabolome and microbiome in zebrafish. Sci. Total Environ. 662, 246–253. 10.1016/j.scitotenv.2019.01.245 [DOI] [PubMed] [Google Scholar]
- 66.Ferrante M.C., Monnolo A., Del Piano F., Mattace Raso G., Meli R., 2022. The Pressing Issue of Micro- and Nanoplastic Contamination: Profiling the Reproductive Alterations Mediated by Oxidative Stress Antioxidants (Basel) 19;11(2): 193. doi: 10.3390/antiox11020193 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Zucker B., Hanusch J., Bauer G., 1997. Glutathione depletion in fibroblasts is the basis for apoptosis-induction by endogenous reactive oxygen species. Cell Death Differ. 4, 388–395. doi: 10.1038/sj.cdd.4400258 [DOI] [PubMed] [Google Scholar]
- 68.Wang F., Bexiga M.G., Anguissola S., Boya P., Simpson J.C., Salvati A., et al. 2013. Time resolved study of cell death mechanisms induced by amine-modified polystyrene nanoparticles. Nanoscale 5 (22), 10868. 10.1039/c3nr03249c [DOI] [PubMed] [Google Scholar]
- 69.Poma A., Vecchiotti G., Colafarina S., Zarivi O., Aloisi M., Arrizza L., et al. 2019. In vitro genotoxicity of polystyrene nanoparticles on the human fibroblast Hs27 cell line. Nanomaterials 9 (9), 1299. doi: 10.3390/nano9091299 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Cortés C., Domenech J., Salazar M., Pastor S., Marcos R., Hernández A., 2020. Nanoplastics as a potential environmental health factor: effects of polystyrene nanoparticles on human intestinal epithelial Caco-2 cells. Environ. Sci.: Nano 7 (1), 272–285. 10.1039/C9EN00523D [DOI] [Google Scholar]
- 71.Livingstone D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms, Mar. Pollut. Bull. 42 (8) (2001) 656–666. doi: 10.1016/s0025-326x(01)00060-1 [DOI] [PubMed] [Google Scholar]
- 72.Zelko I.N, Mariani T.J, Folz R.J., 2002. Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD(SOD3) gene structures, evolution, and expression. Free Radic Biol Med 33:337–349. doi: 10.1016/s0891-5849(02)00905-x [DOI] [PubMed] [Google Scholar]
- 73.Winston G.W., 1991. Oxidants and antioxidants in aquatic animals. Comp. Biochem. Physiol. C Comp. Pharmacol. Toxicol. 100:173. doi: 10.1016/0742-8413(91)90148-m [DOI] [PubMed] [Google Scholar]
- 74.He Y., Li J., Chen J., Wei Y., 2020. Cytotoxic effects of polystyrene nanoplastics with different surface functionalization on human HepG2 cells. Science of The Total Environment 723, 138180. doi: 10.1016/j.scitotenv.2020.138180 [DOI] [PubMed] [Google Scholar]
- 75.Rahman A.; Sarkar A.; Yadav O.P.; Achari G.; Slobodnik J., 2021.Potential human health risks due to environmental exposure to nano- and microplastics and knowledge gaps: A scoping review. Sci. Total Environ. 757, 143872. 10.1016/j.scitotenv.2020.143872 [DOI] [PubMed] [Google Scholar]
- 76.Gonçalves J.M., Sousa V.S., Teixeira M.R., Bebianno M.J., 2022. Chronic toxicity of polystyrene nanoparticles in the marine mussel Mytilus galloprovincialis. Chemosphere 287, 132356. 10.1016/j.chemosphere.2021.132356 [DOI] [PubMed] [Google Scholar]
- 77.Guimaraes A.T.B., Estrela F.N., Rodrigues A.S. de L., Chagas T.Q., Pereira P.S., et al. 2021. Nanopolystyrene particles at environmentally relevant concentrations causes behavioral and biochemical changes in juvenile grass carp (Ctenopharyngodon idella). J. Hazard Mater. 403, 123864. 10.1016/j.jhazmat.2020.123864 [DOI] [PubMed] [Google Scholar]
- 78.Estrela F.N., Batista Guimaraes A.T., Silva F.G., Marinho da Luz T., Silva A.M., Pereira P.S., et al. 2021. Effects of polystyrene nanoplastics on Ctenopharyngodon idella (grass carp) after individual and combined exposure with zinc oxide nanoparticles. J. Hazard Mater. 403, 123879. 10.1016/j.jhazmat.2020.123879 [DOI] [PubMed] [Google Scholar]
- 79.Brandts I., Teles M., Gonçalves A.P., Barreto A., Franco-Martinez L., Tvarijonaviciute A., et al. 2018. Effects of nanoplastics on Mytilus galloprovincialis after individual and combined exposure with carbamazepine. Sci. Total Environ. 643, 775–784. 10.1016/j.scitotenv.2018.06.257 [DOI] [PubMed] [Google Scholar]
- 80.Brandts I., Barría C., Martins M.A., Franco-Martínez L., Barreto A., Tvarijonaviciute A., et al. 2021. Waterborne exposure of gilthead seabream (Sparus aurata) to polymethylmethacrylate nanoplastics causes effects at cellular and molecular levels. J. Hazard Mater. 403, 123590. 10.1016/j.jhazmat.2020.123590 [DOI] [PubMed] [Google Scholar]
- 81.Ballesteros S., Domenech J., Barguilla I., Cortés C., Marcos R., Hernández A., 2020. Genotoxic and immunomodulatory effects in human white blood cells after ex vivo exposure to polystyrene nanoplastics. Environ Sci Nano 7, 3431–3446. doi: 10.1039/d0en00748j [DOI] [Google Scholar]
- 82.Gopinath P.M., Saranya V., Vijayakumar S., Mythili Meera M., Ruprekha S., Kunal R., et al. 2019. Assessment on interactive prospectives of nanoplastics with plasma proteins and the toxicological impacts of virgin, coronated and environmentally released-nanoplastics. Sci. Rep. 9, 8860. doi: 10.1038/s41598-019-45139-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Salvador J.M., Brown-Clay J.D., Fornace A.J Jr., 2013. Gadd45 in stress signalling, cell cycle control, and apoptosis. Adv Exp Med Biol. 793,1–19. doi: 10.1007/978-1-4614-8289-5_1 [DOI] [PubMed] [Google Scholar]
- 84.Bonilla B., Hengel SR., Grundy MK., Bernstein KA., 2020. RAD51 Gene Family Structure and Function Annu Rev Genet. 54, 25–46. https://dx.doi.org/10.1146%2Fannurev-genet-021920-092410 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Abbotts R and Wilson DM., 2017. Coordination of DNA single strand break repair. Free Radic Biol Med 107,228–244. doi: 10.1016/j.freeradbiomed.2016.11.039 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Liu Z., Huang Y., Jiao Y., Chen Q., Wu D., Yu P., et al. 2020. Polystyrene nanoplastic induces ROS production and affects the MAPK-HIF-1/NFkBmediated antioxidant system in Daphnia pulex. Aquat. Toxicol. 220, 105420. doi: 10.1016/j.aquatox.2020.105420 [DOI] [PubMed] [Google Scholar]
- 87.Lu Y., Zhang Y., Deng Y., Jiang W., Zhao Y., Geng J., et al. 2016. Uptake and accumulation of polystyrene microplastics in zebrafish (Danio rerio) and toxic effects in liver. Environ. Sci. Technol. 50, 4054–4060. doi: 10.1021/acs.est.6b00183 [DOI] [PubMed] [Google Scholar]
- 88.Yu P., Liu Z., Wu D., Chen M., Lv W., Zhao Y., 2018. Accumulation of polystyrene microplastics in juvenile Eriocheir sinensis and oxidative stress effects in the liver. Aquat Toxicol. 200, 28–36. doi: 10.1016/j.aquatox.2018.04.015 [DOI] [PubMed] [Google Scholar]
- 89.Romdhani I., De Marco G., Cappello T., Ibala S., Zitouni N., Boughattas I., et al. 2022. Impact of environmental microplastics alone and mixed with benzo[a]pyrene on cellular and molecular responses of Mytilus galloprovincialis. J Hazard Mater. 435:128952. doi: 10.1016/j.jhazmat.2022.128952 [DOI] [PubMed] [Google Scholar]
- 90.Lee Y., Katyal S., Li Y., El-Khamisy S.F., Russell H.R., Caldecott K.W. et al. 2009. The genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1 Nat. Neurosci., 12, 973–980. 10.1038/nn.2375 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Yoon G., Caldecott K. W., 2018. Nonsyndromic cerebellar ataxias associated with disorders of DNA single-strand break repair. Handb. Clin. Neurol. 155, 105–115. doi: 10.1016/B978-0-444-64189-2.00007-X [DOI] [PubMed] [Google Scholar]
- 92.McKinnon P. J., 2017. Genome integrity and disease prevention in the nervous system. Genes Dev. 31, 1180–1194. 10.1016/B978-0-444-64189-2.00007-X [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Maity S, Guchhait R, De S, Pramanick K., 2023. High doses of nano-polystyrene aggravate the oxidative stress, DNA damage, and the cell death in onions. Environ Pollut. 316(Pt 2):120611. doi: 10.1016/j.envpol.2022.120611 [DOI] [PubMed] [Google Scholar]
- 94.Umamaheswari S., Priyadarshinee S., Kadirvelu K., Ramesh M., 2021. Polystyrene microplastics induce apoptosis via ROS-mediated p53 signaling pathway in zebrafish. Chem Biol Interact. 345, 109550. doi: 10.1016/j.cbi.2021.109550 [DOI] [PubMed] [Google Scholar]
- 95.Lebordais M., Gutierrez-Villagomez J.M, Gigault J., Baudrimont M., Langlois V.S., 2021. Molecular impacts of dietary exposure to nanoplastics combined with arsenic in Canadian oysters (Crassostrea virginica) and bioaccumulation comparison with Caribbean oysters (Isognomon alatus). Chemosphere 277,130331. doi: 10.1016/j.chemosphere.2021.130331 [DOI] [PubMed] [Google Scholar]
- 96.Bergami E.; Krupinski Emerenciano A.; González-Aravena M.; Cárdenas C.A.; Hernández P.; Silva J.R.M.C.; et al. 2019. Polystyrene nanoparticles affect the innate immune system of the Antarctic Sea urchin Sterechinus neumayeri. Polar Biol., 42, 743–757. https://link.springer.com/article/10.1007/s00300-019-02468-6 [Google Scholar]
- 97.Spead O., Verreet T., Donelson CJ., Poulain FE., 2018. Characterization of the caspase family in zebrafish. PLoS One. 13(5), e0197966. doi: 10.1371/journal.pone.0197966 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98.Li J., Liu H., Paul Chen J., 2018. Microplastics in freshwater systems: a review on occurrence, environmental effects, and methods for microplastics detection, Water Res. 137, 362–374. 10.1016/j.watres.2017.12.056 [DOI] [PubMed] [Google Scholar]
- 99.Liou G.Y., Storz P., 2010. Reactive oxygen species in cancer, Free Radic. Res. 44 (5) 479–496. doi: 10.3109/10715761003667554 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Qiang L., Cheng J., 2019. Exposure to microplastics decreases swimming competence inlarval zebrafish (Danio rerio). Ecotoxicol. Environ. Saf. 176, 226–233. doi: 10.1016/j.ecoenv.2019.03.088 [DOI] [PubMed] [Google Scholar]
- 101.Zhai X., Wang L., Xu C., Hou Q., Zhang L., Li Z., et al. 2019. Triptolide preserves glomerular barrier function via the inhibition of p53-mediated increase of GADD45B. Arch. Biochem. Biophys. 671, 210–217. doi: 10.1016/j.abb.2019.07.012 [DOI] [PubMed] [Google Scholar]
- 102.Park S., Lee J.Y., Park H., Song G., Lim W., 2020. Bifenthrin induces developmental immunotoxicity and vascular malformation during zebrafish embryogenesis, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 228, 108671. doi: 10.1016/j.cbpc.2019.108671 [DOI] [PubMed] [Google Scholar]
- 103.Bhagat J., Zang L., Nishimura N., Shimada Y., 2020. Zebrafish: an emerging model to study microplastic and nanoplastic toxicity. Sci. Total Environ. 728, 138707. doi: 10.1016/j.scitotenv.2020.138707 [DOI] [PubMed] [Google Scholar]
- 104.Schett G., Redlich K., Xu Q., Bizan P., Gröger I. M., Tohidast-Akrad M., et al. 1998. Enhanced Expression of Heat Shock Protein 70 (hsp70/hspA5) and Heat Shock Factor 1 (HSF1) Activation in Rheumatoid Arthritis Synovial Tissue Differential Regulation of hsp70/hspA5 Expression and HSF1 Activation in Synovial Fibroblasts by Proinflammatory Cytokines, Shear Stress, and Antiinflammatory Drugs. J. Clin. Invest. 102(2), 302–311. doi: 10.1172/JCI2465 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Gong Y.Y, Liu Y.Y., Li J., Su L., Yu S., Zhu X.N., et al. 2014. Hypermethylation of Cox5a promoter is associated with mitochondrial dysfunction in skeletal muscle of high fat diet-induced insulin resistant rats, PLoS One 9, e113784, doi: 10.1371/journal.pone.0113784 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Baertling F., Al-Murshedi F., Sanchez-Caballero L., Al-Senaidi K., Joshi NP., Venselaar H., et al. 2017. Mutation in mitochondrial complex IV subunit COX5A causes pulmonary arterial hypertension, lactic acidemia, and failure to thrive, Hum. Mutat. 38, 692–703, doi: 10.1002/humu.23210 [DOI] [PubMed] [Google Scholar]
- 107.Little A.G., Kocha K.M., Lougheed S.C., Moyes C.D., 2010. Evolution of the nuclear-encoded cytochrome oxidase subunits in vertebrates. Physiol Genomics. 42(1), 76–84. doi: 10.1152/physiolgenomics.00015.2010 [DOI] [PubMed] [Google Scholar]
- 108.Chandran K., Aggarwal D., Migrino R.Q., Joseph J., McAllister D., Konorev E.A., et al. 2009. Doxorubicin inactivates myocardial cytochrome c oxidase in rats: cardioprotection by Mito-Q. Biophys. J. 96,1388–1398. doi: 10.1016/j.bpj.2008.10.042 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 109.Srinivasan S., Avadhani N., 2012. Cytochrome c Oxidase Dysfunction in Oxidative Stress. Free Radic Biol Med. 53(6), 1252–1263. doi: 10.1016/j.freeradbiomed.2012.07.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110.Trevisan R., Voy C., Chen S., Di Giulio R.T., 2019. Nanoplastics decrease the toxicity of a complex PAH mixture but impair mitochondrial energy production in developing zebrafish. Environ. Sci. Technol. 53, 8405–8415. doi: 10.1021/acs.est.9b02003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 111.Trevisan R., Uzochukwu D., Di Giulio R.T., 2020. PAH sorption to nanoplastics and the trojan horse effect as drivers of mitochondrial toxicity and PAH localization in zebrafish. Front. Environ. Sci. doi: 10.3389/fenvs.2020.00078 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All Results NPs cells files are available from the Dryad repository (doi:10.5061/dryad.zpc866tf9).