Abstract
Osteoarthritis (OA) is a painful, incurable disease affecting over 500 million people. The need for relieving OA pain is paramount but inadequately addressed, partly due to limited understandings of how pain signaling regulates non-neural tissues. Here we report that nerve growth factor receptor (NGFR) is upregulated in skeletal cells during OA and plays an essential role in the remodeling and repair of osteoarthritic joints. Specifically, NGFR is expressed in osteochondral cells but not in skeletal progenitor cells and induced by TNFα to attenuate NF-κB activation, maintaining proper BMP-SMAD1 signaling and suppressing RANKL expression. NGFR deficiency hyper-activates NF-κB in murine osteoarthritic joints, which impairs bone formation and enhances bone resorption as exemplified by a reduction in subchondral bone and osteophytes. In human OA cartilage, NGFR is also negatively associated with NF-κB activation. Together, this study uncovers a role of NGFR in limiting inflammation for repair of diseased skeletal tissues.
Introduction
Osteoarthritis (OA) is a painful, incurable disease affecting 500 million adults around the world 1. Pathological changes of OA embody multiple manifestations such as articular cartilage destruction, joint space narrowing, synovial hyperplasia, osteophyte formation, and subchondral bone sclerosis 2,3. The hallmark of OA is articular cartilage degradation, which can be induced by aging, injury, overloading, or abnormal inflammation 4–6. The bony changes like sclerosis in subchondral bone and osteophytes at the periphery or margin of joints are also prominent radiographic features of OA, indicative of the later stages of the disease 2,7. Both subchondral sclerosis and osteophytes are thought to be a spontaneous response of the diseased joint to mechanical overload due to the loss of cartilage 2,8 . In addition, modification of these bony remodeling processes could be used to treat OA, as antiresorptive agents were reported to offer beneficial effects on articular cartilage protection 2.
Pain is the most prominent complaint from OA patients and an overwhelmingly influential factor to cause disability 9. Nerve growth factor (NGF) was the first identified growth factor discovered to be essential for the growth and survival of neurons 10. As a member of the neurotrophin family, NGF is found to be significantly upregulated in the joints of OA patients 11, which is believed to be required for the sensitization of nociceptors, the sensory neurons and their endings that detect signals from peripheral tissues. To date, monoclonal antibodies against NGF including tanezumab have been tested in clinical trials, which demonstrated significantly greater efficacy in pain relief and physical function improvement, but showed more prevalent joint safety events compared with the non-steroidal anti-inflammatory drugs (NSAIDs) group 12,13. The majority of joint safety events were described as rapidly progressive osteoarthritis (RPOA), which shows accelerated loss of joint space width, or abnormal bone loss, destruction, or collapse. Therefore, the FDA deemed that the safety risk of tanezumab outweighs its benefit in improving pain and physical function and clinical development was discontinued. For further improvement of new analgesics represented by NGF inhibitors, it would be important to gain a clear understanding of the mechanism underlying RPOA associated with NGF inhibition, which has yet to be identified. It cannot be explained by tanezumab-induced pain relief, as analgesia in patients with or without RPOA were similar 12. Subchondral insufficiency fracture and atrophic OA (no osteophytes) may increase the risks of RPOA 14,15, suggesting that RPOA is associated with weakened bone formation.
To activate the NGF signaling pathway, NGF binds to its transmembrane receptors, TrkA (tropomyosin receptor kinase A), the high affinity catalytic receptor for NGF, or p75NTR, also known as nerve growth factor receptor (NGFR) or CD271, the one with a lower NGF-binding capacity 16. The binding of NGF to its receptors leads to the autophosphorylation of the receptors, initiating the downstream signaling cascades such as MAPK and PI3K-AKT, which are essential to the neuronal survival and growth, thereby sensitizing neurons and stimulating growth of axons and dendrites 17–19. Our previous results have demonstrated that NGF expression is significantly upregulated in periarticular tissues, especially in synovium and newly formed ectopic cartilage/bone, which may elicit neurite growth in the arthritic joint 20,21. Large-scale RNA-Seq studies revealed that TrkA, the main NGF receptor in sensory neurons, is restricted to peripheral nociceptors, suggesting its role could specifically limited to nociceptor innervation 22. In contrast, NGFR expression profile is more diverse than being restrictively neuronal. Particularly, its expression in myeloid cells could be stimulated in pathological or inflammatory circumstances 22. In regards to the NGFR expression in skeletal cells, previous reports suggest that NGFR is expressed in a subset of mesenchymal cells or bone marrow stromal cells that show greater capacities of self-renewal, ex vivo hematopoiesis support, and multipotent differentiation into osteoblasts, chondrocytes, or adipocytes 23–26. Interestingly, the generally viable and fertile phenotype of NGFR null mice 27,28, which do display abnormal reflexes or reduced innervation, seem to obscure if NGFR has an indispensable function in skeletal tissues.
In this study, we identified nerve growth factor receptor (NGFR) as a prominent receptor that responds to NGF, a major growth factor associated with pain, in osteochondral joint cells. Our results established that the NGFR signaling initiates anti-inflammatory and anabolic reactions to repair and stabilize osteoarthritic joints, an important yet unappreciated role of NGFR in regulating non-neuronal skeletal cells and tissues, which may represent a new example for the interaction between pain and skeletal pathophysiology.
Results
NGF induction is associated with bony remodeling and inflammation during OA pathogenesis and progression
To delineate the pathological course of OA, we generated a mouse model of posttraumatic OA through surgical induction of destabilization of the medial meniscus (DMM) 29. Two weeks after the DMM surgery, the joint displayed severe inflammation as represented by synovial hyperplasia and infiltration of monocytes (Fig. 1a), suggesting an acute response upon traumatic surgery. At the time point of 4 weeks post-surgery, synovial inflammation still persisted, albeit with reduced severity, and bony changes including subchondral sclerosis and synovium calcification became evident (Fig. 1b, c), which underscores synovial inflammation and bony remodeling in OA progression 30.
Fig. 1.
Inflammation, neurogenesis, and bony remodeling during OA pathogenesis and progression. a, b Representative histology images of osteoarthritic knee joint sections stained by hematoxylin and eosin. The joints were collected 2 (a) or 4 weeks (b) after the DMM surgery. Arrowheads, inflamed synovial tissues. c Representative histology images of osteoarthritic knee joint sections stained by alcian blue/hematoxylin & orange G. The joints were collected 4 weeks after the DMM surgery. Arrowheads, synovial hyperplasia and osteochondral formation. Scale bar, 100 μm. n = 6. d-h Representative immunohistochemistry (IHC) images of osteoarthritic knee joint sections stained by individual antibodies as shown. The joints were collected 4 weeks after the DMM surgery. Arrowheads, positively IHC signals. Scale bar, 100 μm. n = 5. ****p<0.0001.
Concomitantly, we also observed significant alterations related to neurite growth in osteoarthritic joints, as demonstrated by the increased levels of NGF (Fig. 1d) and βIII-tubulin, a specific neuronal marker in neurogenesis (Fig. 1e), particularly in hypertrophied synovium, similar to our previous reports 20,31. Largely overlapped with NGF expression in synovium and newly formed ectopic cartilage/bone, induction of RUNX2 and SMAD1, both pivotal transcription factors in osteogenesis 32, was remarkable in these osteochondral tissues (Fig. 1f–h). Thus, our results suggested that NGF induction is concurrent with multiple events including inflammation and bony remodeling during the course of OA progression.
Expressions of NGF receptors in skeletal cells
To clarify whether NGF induction has a direct role in skeletal pathophysiology, firstly we aimed to confirm whether there are significant expressions of NGF receptors, TrkA and NGFR, in the skeletal cells. Among the 11 cell lines we examined, the 5 cell lines thought to be mesenchymal stem cells or early skeletal progenitor cells, including C3H10T1/2 (mouse embryo fibroblast cell line) 33, ST2 (mouse bone marrow stromal cell line) 34, ATDC5 (mouse prechondrogenic stem cell line) 35, mouse CD45− bone marrow stromal cells (BMSCs) 20, and human mesenchymal stem cells (hMSCs), did not express a detectable level of NGFR protein (Fig. 2a, b). Interestingly, mouse E14.5 limb bud cells, mouse perinatal articular chondrocytes (AC), rat chondrosarcoma (RCS) cells, human osteoblastic cells lines hFOB1.19 and Saos-2, and mouse progenitor cell line C2C12, a pluripotent cell line that can differentiate into osteoblasts, have readily detectable levels of NGFR protein (Fig. 2a, b). CRISPR-mediated knockout or transcriptional activation (CRISPRa) 36 of Ngfr also validated the existence of both NGFR mRNAs and proteins in the cells (Fig. 2c, Supplementary Fig. 1a, b). We also compared NGFR proteins in dorsal root ganglions (DRG), hMSCs, and osteoblasts, and found that NGFR protein is abundant in DRG, suggesting that NGFR could be a major player for pain sensitization in DRG neurons besides being significant in osteochondral cells (Supplementary Fig. 2). In contrast, the NGF receptor with higher affinity, TrkA, also known as NTRK1, had indiscernible protein levels in all skeletal cells tested (Fig. 2d). In addition, pan Trk proteins, including TrkA, TrkB and TrkC, were not detectable in all of the skeletal cells. Thus, our results suggest that TrkA plays a specialized role in neurons while NGFR has more diverse functions, in neurons as well as in skeletal cells.
Fig. 2.
NGFR is significantly upregulated in skeletal cells with committed osteochondral fates, compared to progenitor cells at earlier stages. a, b, Western results of NGFR in mouse cells (a) and in multiple human cell lines and RCS cells (b). n = 3. c Perturbations of NGFR validated the anti-NGFR antibody and confirmed NGFR proteins in C2C12. sg, single guide RNA for CRISPR to mutate Ngfr. CRISPRa indicates CRISPR-mediated transcriptional activation of Ngfr. Control is the empty vector for CRISPRa. Note that sg1 targeting the promoter increased NGFR expression. n = 3. d TrkA had no detectable protein levels in skeletal cells. * denotes non-specific bands detected. n = 3. e Ngfr mRNAs were markedly increased in mouse articular chondrocytes (AC), E14.5 limb bud cells, and C2C12 cells, compared to C3H10T1/2, ATDC5, and CD45− BMSCs. n = 3. f, g, NGFR mRNAs were significantly higher in human osteoblastic cell lines (hFOB1.19 and Saos-2) than in human mesenchymal stem cells (hMSC), whereas TrkA levels are significantly lower than NGFR in all examined cells. h, i, NGFR proteins decreased with the dedifferentiation of committed skeletal cells induced by repeated passages. n = 3. **p<0.01, ****p<0.0001.
We also examined the mRNA expression of NGF receptors. Generally, the mouse skeletal cells with a committed osteochondral fate, such as mouse ACs, E14.5 limb bud cells, and C2C12 cells, had higher expression of Ngfr, compared to those early stage cells including BMSCs and C3H10T1/2, which had negligible expression of Ngfr mRNAs (Fig. 2e). The mRNA levels of TrkA in all of these mouse cells were not detectable (data not shown). In the RCS cells, TrkA expression was also minimal and Ngfr mRNA level was about 50 times higher (Supplementary Fig. 1c). NGFR was barely detectable in human MSCs, but much more conspicuous in hFOB1.19 and Saos-2. The comparison between NGFR and TrkA showed that NGFR was much more abundant than TrkA (note their ratios to β-actin) in osteoblastic cells (Fig. 2f, g). Further, we examined NGFR protein levels in cultured articular chondrocytes and E14.5 limb bud cells with different passage numbers. Generally, repeated passages will lead to dedifferentiation of the cells, losing their chondrocytic or osteoblastic phenotype 37. Our data demonstrated that NGFR protein levels were significantly reduced in dedifferentiated chondrocytes or limb bud cells (Fig. 2h, i), further confirming that NGFR is more predominantly expressed in the cells with committed osteochondral fates.
In addition, we utilized a published single cell RNA-Seq (scRNA-Seq) dataset of human embryonic skeletogenesis 38 for analyses of gene expressions of NGFR and several skeletal cell markers. Clustering and visualization of the scRNA-Seq data demonstrated that cells from human limb bud at Carnegie stage (CS) 13 that is about 5 weeks post conception (WPC) and human long bone at CS22 (about 8 WPC) can be clustered into 11 groups in an integrative analysis (Fig. 3a). Notably, both CS13 and CS22 samples exhibited low frequencies (<5%) of non-skeletal cells (Fig. 3b), such as EPCAM+ epithelial cells (cluster 8) in limb buds, SOX10+ Schwann cells (cluster 11) in long bone, and some shared cell types in both samples such as MYOG+ SIX1+ myoprogenitors/myocytes (clusters 5 and 9), GYPA+ erythrocytes (cluster 6), CDH5+ endothelial cells (cluster 7), and CD68+ PTPRC+ macrophages (cluster 10) 38. In contrast, most of the cells in both samples could be classified into skeletal cells (Clusters 0–4), as they expressed high levels of PRRX1 and PDGFRA, two skeletal progenitor cell markers 38,39. In addition, these skeletal cells appeared to have extensive communications between different populations (Fig. 3c). The collective expression of NGFR in these skeletal cells was significantly upregulated in the sample of CS22 compared to that in CS13, while PRRX1 expression was similar between the two samples (Fig. 3d). Indeed, Cluster 2 that represents chondroblasts and chondrocytes expressing SOX9 and ACAN was exclusively detected in CS22 (Fig. 3b, e), suggesting that chondrogenesis did not occur in CS13, which expressed a minimal level of NGFR. Further, in each cluster of those skeletal progenitor populations (Clusters 0, 1, 3, 4) shared by the two samples, NGFR induction in CS22 was consistent (Fig. 3e). Thus, our analysis suggested that NGFR is upregulated during the osteochondral differentiation of skeletal progenitor cells.
Fig. 3.
NGFR is positively associated in osteochondral differentiation of human skeletal progenitor cells. a, The UMAP plot of 5 weeks post conception (Carnegie stage 13) human limb bud and 8 WPC (CS22) human long bone. b The dot plots showing expressions of representative genes in each cluster. Clusters 0–4 can be grouped as skeletal lineage cells based on their expression of PRRX1 and PDGFRA. c The circle plot showing aggregated cell-cell communication network and the total interaction strength (weights) between any two skeletal cell clusters. d Violin plots showing the cumulative expression of NGFR and PRRX1 in skeletal lineage cells of CS13 limb bud and CS22 long bone. e Characterization of the expression of NGFR, SOX9, RUNX2, and ACAN in each cluster of skeletal lineage cells, split by the groups of CS13 limb bud and CS22 long bone.
To confirm the in vivo expression of NGFR, we performed immunohistochemistry (IHC) to analyze the protein levels of NGFR in osteoarthritic joints. Interestingly, the NGFR protein level increased in osteoarthritic joints compared to that in naïve joints, especially in the newly formed ectopic osteochondrophytes (Supplementary Fig. 3a, b). Together, our results suggest that TrkA plays a specialized role in neurons, while NGFR has a non-neuronal role in cells with osteochondral commitment that responds to OA pathogenesis.
Exploring the role of osteochondral NGFR
It has been established that skeletal cells expressing aggrecan give rise to not only chondrocytes but also the majority of osteoblasts and osteocytes during endochondral bone formation 40,41. In addition, our scRNA-Seq analysis demonstrated that Aggrecan has significant expressions in skeletal progenitor cells (Fig. 3e). Therefore, Acan-CreER could be useful for comprehensive analysis of osteochondral formation in the joint, a complex organ comprising multiple types of skeletal cells. Thus, we generated NgfrAcan-CreER (hereafter KO) mice, in which NGFR deficiency was induced through tamoxifen injection for 5 consecutive days when the mice were 15 days old. After five months, we collected the knee joints of the control and NgfrAcan-CreER mice for radiographic and histologic analyses. Surprisingly, we did not find overtly appreciable differences in joint architectures comprising articular cartilage, subchondral bone, synovium, and meniscus between the two groups (Supplementary Fig. 4a–c), suggesting that tamoxifen pulsed at the age of two weeks did not fundamentally alter joint structure and homeostasis that were analyzed 5 months later, or the essentiality of NGFR may not be absolute for normal joint development and homeostasis.
To further investigate if NGFR is required by non-neuronal joint cells during OA, we injected the 15-day-old mice with tamoxifen for 5 consecutive days, and performed DMM to induce OA pathogenesis when they reached the age of 3 months. As expected, the DMM surgery profoundly altered joint architecture in both control and KO groups, as shown by articular cartilage abrasion, synovial hyperplasia, osteophyte outgrowth and subchondral sclerosis, typical pathological features of OA (Supplementary Fig. 5a–e). Nevertheless, progression of OA in the NGFR deficient mice appeared indistinguishable if compared with that in the control mice, through Osteoarthritis Research Society International (OARSI) scoring and quantification of subchondral and ectopic bone formation (Supplementary Fig. 5b, e). Therefore, our results suggested that loss-of-function of NGFR in osteochondral cells induced in pre-adulthood may not have significant effects in joint pathophysiology, even when OA is inflicted in adulthood.
Osteoarthritic joints require NGFR for bony remodeling and repair
We recognized that tamoxifen administration at young ages may not target all of the osteochondral joint cells at a later stage, because osteochondral cells are incessantly differentiated from progenitor cells and some of them are produced after tamoxifen injection, leaving the Ngfr gene untargeted. In fact, our IHC results confirmed that NGFR loss-of-function was not substantially achieved (only ~29% decrease) in the KO mice receiving tamoxifen at young ages (Supplementary Fig. 5f, g). In order to ascertain whether NGFR has an indispensable role during OA progression, we went on to perform the DMM surgery on a new cohort of 3-month-old mice and changed the method of tamoxifen administration. We tested weekly injection of tamoxifen on the Acan-CreER; Ai9 reporter mice and found that this new method efficiently targeted extensive types of osteochondral cells in the entire osteoarthritic joints, including those in articular cartilage, meniscus, subchondral bone, synovium and newly formed ectopic bone (Fig. 4a). It is notable that the targeted cells in the unoperated, healthy knee joints were primarily located in the cartilaginous tissues of articular cartilage and meniscus (Supplementary Fig. 6), suggesting that osteochondral remodeling in diseased joints is significantly more active than that in healthy joints and confirming that Acan-CreER is a useful tool for studying bone remodeling in osteoarthritic joints. Thus, we injected the NgfrAcan-CreER mice with tamoxifen weekly, which lasted until we collected the knee joints 3 months after DMM. The IHC results confirmed an efficient ablation (90% decrease) of NGFR in the KO joints, whereas NGF remained induced in osteoarthritic joints (Fig. 4b, Supplementary Fig. 3b–d). Remarkably, both histology and micro-computed tomography (μCT) results demonstrated significant reductions in both ectopic and subchondral bones when Ngfr was continuously ablated (Fig. 4c–f). Quantitative analysis confirmed that volume of ectopic bone/osteophytes was decreased by 36%, and medial subchondral bone volume fraction (BV/TV) was decreased by 21% in NGFR KO joints (Fig. 4e, f). It is notable that femoral trabecular bone volume fraction was not affected by NGFR deficiency in both female and male mice (Supplementary Fig. 7a, b), suggesting that NGFR loss-of-function mainly affected those skeletal cells close to the lesion, which is in line with our observation that sham joints did not show obvious phenotypic changes. In addition, articular cartilage degradation and synovitis in the KO mice were similar to those in the control mice (Fig. 4c, Supplementary Fig. 7c, d). Thus, our data collectively suggested that NGFR deficiency at this stage predominantly dysregulates skeletal cells recruited for bone remodeling in the joint. Intriguingly, bone loss or destruction was also observed in some OA patients receiving anti-NGF therapies, a significant adverse event 12. Thus, we speculated that blockade of NGF-NGFR signaling may detrimentally downregulate bony remodeling of osteoarthritic joints, the spontaneous responses for joint repair.
Fig. 4.
NGFR deficiency substantially reduces subchondral bone thickening and ectopic bone formation in osteoarthritic joints. a Aggrecan-CreER efficiently targets multiple osteochondral tissues in the osteoarthritic joints, including articular cartilage (AC), subchondral area (SC), and meniscus (m). ). Arrowhead, targeted cells in SC. Scale bar, 100 μm. b NGFR was induced in osteoarthritic joints. Both control (Ngfr floxed) and KO (NgfrAcan-CreER) mice were injected with tamoxifen weekly to ablate Ngfr, starting from 10 days after the DMM surgery. Arrowheads: NGFR+ osteochondral cells. Scale bar, 100 μm. n = 5. c NGFR loss downregulated subchondral and ectopic bone formation (arrowheads) in osteoarthritic joints. Scale bar, 200 μm. n = 12. d Representative μCT 3D images of control and KO joints with OA. Arrowheads, ectopic bone. e Representative μCT 3D images of ectopic bone growth around cartilage, meniscus and synovium as well as quantification of ectopic BV. f Representative μCT 2D images of subchondral bone and BV/TV quantification of subchondral bone underneath medial tibial plateau (inside the red circles). #, ectopic bone outside subchondral area. Scale bars: 1 mm. n = 12. **p<0.01, ****p<0.0001.
NGFR deficiency deteriorates inflammation-induced downregulation of osteogenesis
Because inflammatory cytokines including tumor necrosis factor-α (TNF-α) and interleukin-1β can be detected in OA joint tissues 42,43 , and inflammatory cytokines could lead to the inhibition of bone formation 44,45, we were interested to determine whether NGFR loss-of-function alters osteogenesis in skeletal cells in the context of inflammation. Thus, we cultured C2C12 cells with CRISPR-mediated deletion of Ngfr with osteogenic medium and stained the cells to examine the alkaline phosphatase (ALP) activity, a marker for osteogenesis. Our results showed that inflammatory cytokines caused a more striking reduction of ALP activity in NGFR KO cells (Fig. 5a). Therefore, our results suggested that NGFR may serve a resistant role to inflammation-induced impairment of osteogenesis in skeletal cells. Next, we performed western blot, and found that the BMP-SMAD1 pathway was significantly downregulated in the NGFR KO cells under the circumstance of inflammatory cytokines, as displayed by the decrease of both phosphorylated and total SMAD1 proteins (Fig. 5b). As well, BMP-SMAD1 signaling was significantly upregulated in the CRISPRa cells treated with inflammatory cytokines, as evidenced by higher levels of SMAD1 and p-SMAD1 (Fig. 5c). The mRNA expressions of marker genes downstream to the BMP-SMAD1 pathway, including Id1, Id2, and the osteogenic master transcription factor Runx2, were all markedly reduced in the NGFR null cells (Fig. 5d–f). We also induced NGFR gain-of-function by CRISPRa in the mouse CD45− BMSCs 20, which are early stage progenitor cells and do not express significant amounts of NGFR (Fig. 2a), and found that NGFR significantly upregulated osteochondral genes, (Supplementary Fig. 8), further establishing a role of NGFR in promoting osteochondrogenesis.
Fig. 5.
Loss of NGFR impairs bone formation in the context of inflammation. a NGFR ablation exacerbated the decrease of alkaline phosphatase activity induced by inflammatory cytokines. Vec, empty vector; sg2, CRISPR vector expressing single guide RNA 2 to mediate Ngfr deletion. n = 3. b, c NGFR perturbation altered SMAD1 and RANKL in TNF-α-treated cells. CRISPRa, CRISPR-mediated activation of Ngfr. n = 3. d-f NGFR deletion downregulated the marker gene expression in BMP-SMAD1 signaling. g-i OA-induced upregulations of SMAD1 and p-SMAD1 were significantly attenuated by NGFR deficiency in OA joints. j, k NGFR deletion downregulated RUNX2 protein level in OA joints. n = 5. Scale bar: 100 μm. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
To confirm whether the BMP-SMAD1 signaling was also repressed in the osteoarthritic joint of NGFR-deficient mice, we performed IHC to determine the levels of both SMAD1 and p-SMAD1. In the control knee joint subjected to the DMM surgery, both SMAD1 and p-SMAD1 were evidently upregulated in those areas expected to have ectopic ossification, such as hypertrophied synovium, calcified meniscus, and osteophytes (Fig. 5g–i), suggesting that OA generally stimulates anabolic responses in bone remodeling of osteoarthritic joints. Compared with these control joints, however, the NGFR KO joints showed significantly reduced levels of both SMAD1 and p-SMAD1, confirming that NGFR deficiency compromises the BMP signaling and thus downregulates bone formation that should have been induced to stabilize the diseased joints (Fig. 5g–i). Examination of RUNX2 also confirmed an impaired bone-forming response in osteoarthritic joints with NGFR deficiency (Fig. 5j, k). Together, our data demonstrated that NGFR deficiency impairs bony stabilization of osteoarthritic joints.
NGFR deters bone resorption and destruction in osteoarthritic joints
In order to investigate if NGFR perturbation has effects on osteoclast formation and bone resorption, we also checked the expression levels of RANKL and osteoprotegerin (OPG), the cytokine and its soluble decoy receptor, which are secreted by osteoblasts and other types of skeletal cells to regulate osteoclastogenesis. Interestingly, the Rankl mRNA level was significantly upregulated in the NGFR KO cells (Fig. 6a). Western blot also confirmed that the NGFR loss-of-function increases RANKL protein levels (Fig. 5b). Although Opg expression increased moderately in NGFR-null cells, the Rankl/Opg ratio was negatively associated with NGFR under the treatment of inflammatory cytokines, suggesting that NGFR represses the induction of osteoclastogenesis by inflammation (Fig. 6b, c). Next, we treated control and NGFR KO cells with TNF and used supernatant medium from these cells to treat RAW 264.7 cells. Staining of tartrate-resistant acid phosphatase (TRAP), the enzyme responsible for bone resorption and established as an osteoclast marker, demonstrated that the medium conditioned by NGFR-deficient cells induced significantly stronger osteoclast differentiation than the medium conditioned by control cells (Fig. 6d, e), suggesting that NGFR loss-of-function may induce skeletal cells to produce higher levels of RANKL that enhance osteoclastogenesis.
Fig. 6.
NGFR loss-of-function further heightens inflammation-induced bone resorption. a-c NGFR deletion induced the Rankl/Opg mRNA ratio in TNF-treated cells. Vec, empty vector; sg2, CRISPR vector expressing single guide RNA 2 to mediate Ngfr deletion. d, e TRAP staining and quantification of RAW264.7 cells cultured with medium conditioned by empty vector-infected or CRISPR-mediated Ngfr deletion cells. Scale bar: 80 μm. n = 3. f, g TRAP staining and quantification of subchondral area in control and KO joints with OA. The lower edge of subchondral area is marked by the blue curves. The bottom panels are the enlargements of the upper images as indicated by the box, in order to show subchondral area in higher resolution. Arrowheads, positive TRAP staining in subchondral area. Scale bar: 100 μm. n = 7. h, i IHC of RANKL in the osteoarthritic joints with NGFR deficiency. Scale bar: 100 μm. n = 5. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
Further, we performed TRAP staining on osteoarthritic NGFR-deficient joints to quantify osteoclast formation in subchondral and ectopic bone areas. Our results demonstrated that NGFR KO joints retained more TRAP-positive cells than the control joints, particularly in subchondral areas, suggesting that NGFR deficiency in osteochondral cells significantly upregulated osteoclastogenesis (Fig. 6f, g). Moreover, we performed IHC to quantify the protein levels of RANKL and OPG in the joint tissues and found that NGFR-deficiency resulted in significant elevation of RANKL but not OPG proteins (Fig. 6h, i; Supplementary Fig. 9), suggesting that NGFR attenuated RANKL induction in osteoarthritic joints. Together, our results suggested a combinatory role of NGFR in both promoting bone formation and suppressing bone resorption to favor the bone-forming events including ectopic bone/osteophyte outgrowth and subchondral sclerosis during OA pathogenesis.
Negative correlation between NGFR and NF-κB activation
NGFR-intact and NGFR-KO joints appeared to display a stark contrast in bone remodeling when they developed OA, suggesting that OA may underlie abnormal bone turnover in NGFR-deficient joints. Our IHC results demonstrated that the majority of p65 46 translocated to the nucleus in the murine osteoarthritic joints, suggesting that OA generates an inflammatory milieu within the joints (Fig. 7a, b). Importantly, NGFR loss-of-function aggravated the inflammation as demonstrated by significantly increased nuclear localization of p65 in the osteoarthritic KO joints, especially in the joint tissues that underwent bone remodeling, such as synovium and meniscus (Fig. 7c, d). Thus, our results suggested that NGFR negatively regulates NF-κB activation in murine osteoarthritic joints.
Fig. 7.
NGFR attenuates NF-κB activation in skeletal tissues during OA. a, b OA induces nuclear translocation of p65 in joint cells as shown by p65 IHC and quantification. Hollow arrowheads, cytoplasmic p65. Solid arrowheads, nuclear p65. Scale bar: 50 μm. n = 5. ****p<0.0001. c, d Nuclear translocation of p65 in the joint cells induced by OA was exacerbated by NGFR deficiency. Hollow arrowheads, cytoplasmic p65. Solid arrowheads, nuclear p65. Scale bar: 50 μm. n = 5. e, g, IHC of NGFR and p65 in human articular cartilage. OA 1 and OA 2 indicate different samples. f, h, Quantification of IHC results of NGFR or nuclear p65. **p<0.01.
As our data showed that NGFR is induced in the cells treated with TNFα and in the murine osteoarthritic joints, we were also interested to investigate whether NGFR undergoes a perturbation in non-neuronal joint cells during human OA pathogenesis. The IHC results of NGFR demonstrated that the NGFR protein levels in different specimens of human osteoarthritic cartilage could be varied, but they were consistently higher than those in non-OA cartilage (Fig. 7e, f), suggesting that OA upregulates NGFR in human cartilage. We also performed IHC to detect p65 and found that the OA specimens exhibited greater frequencies of nuclear p65 than non-OA cartilage (Fig. 7g, h), confirming elevated NF-κB activity in human cartilage during OA. Interestingly, among different OA cartilage specimens, NGFR appeared to be negatively associated with the nuclear translocation of p65 in the samples we examined (Fig. 7g). Together, our results suggested that the induction of NGFR could serve as a negative feedback mechanism in response to inflammation during human OA pathogenesis.
NGF-NGFR signaling restricts inflammatory reaction through attenuating NF-κB activation
To examine how NGFR regulates the TNF/NF-κB signaling, we generated C2C12 cells with NGFR ablation by lentiviral transduction of 4 individual CRISPR sgRNAs, which was expected to exclude off-targeting effects. Western blot results showed that the sgRNAs effectively induced NGFR loss-of-function (Fig. 8a). More importantly, they all consistently increased TNF-induced activation of NF-κB (Fig. 8a), suggesting that NGFR ablation exacerbates the inflammatory reactions. It is notable that the hyper-activation of NF-κB by NGFR deficiency occurred at the same time point when activation of TNF/ NF-κB reached the climax (Supplementary Fig. 10). To further explore whether NGF is also involved in this process, we treated the cells with TNF, NGF, or a combination of TNF and NGF. Interestingly, NGFR-deficient cells appeared to exhibit higher levels of p-p65 than NGFR-intact cells when treated with NGF (Fig. 8b, Supplementary Fig. 11), suggesting that NGF plays an anti-inflammatory role that requires NGFR. Further, the simultaneous treatment of TNF and NGF resulted in weaker phosphorylation of p65 than that of TNF alone in control cells, whereas NGFR-KO cells still showed strong p-p65, further confirming the potent TNF-blocking effects of NGF and NGFR (Fig. 8b). Remarkably, the total IKK level appeared to be elevated in the NGFR-deficient cells (Fig. 8b, Supplementary Fig. 10), pointing to a possible mechanistic clue by which NGFR modulates NF-κB signaling. To further test whether NGFR overexpression could decrease inflammatory response, we stably transfected C2C12 cells with NGFR-RFP or RFP, and treated the cells with TNF. Our western blot results demonstrated that NGFR overexpression suppressed phosphorylation of p65 and IκBα (Fig. 8c), suggesting that NGFR can restrict NF-κB activation induced by inflammatory cytokines. We were also interested in clarifying whether the inflammation-limiting role of NGFR could exist in non-skeletal cells. Thus, we transfected HEK293 cells with NGFR-RFP for NGFR overexpression and found that NGFR overexpression in HEK293 cells also restricted inflammation induced by TNF (Fig. 8d). In fact, when we treated HEK293 cells with TNF, NGF, or both, we found that NGF could decrease the NF-κB signaling activated by TNF (Fig. 8e), a result similar to that we observed in C2C12 cells. Together, our results suggested that this new role of NGF-NGFR signaling could be widespread in various types of tissues and cells, which may reveal a novel example regarding how pain-associated molecules also modulates the pain-affected non-neuronal tissues.
Fig. 8.
NGF-NGFR restricts the TNF/NF-κB signaling. a NGFR deletion enhanced TNF-induced phosphorylation of p65. v, empty vector; 2–8, different sgRNAs targeting Ngfr. b NGF reduced TNF-induced p-p65, which required NGFR. v, vehicle. T, TNF. N, NGF. T+N, TNF + NGF. Cells were treated with indicated growth factor/cytokine for 15 min. sgRNA #2 was used to generate NGFR KO. n = 3. c NGFR overexpression reduced p-p65 and p-IκBα in C2C12 cells treated with TNF for 24 h. R, RFP. N, hNGFR-RFP. n = 3. d NGFR overexpression decreased p-p65 and p-IκBα induced by TNF treatment in non-skeletal HEK293 cells. n = 3. e NGF treatment decreased NF-κB activation induced by TNF in HEK293 cells. n = 3.
DISCUSSION
A prominent phenotype observed from the NGFR deficient mice with surgically-induced OA was the significant decrease of OA-related bone growth, such as subchondral sclerosis and ectopic bone/osteophyte outgrowth. This may be reminiscent of atrophic OA, which is suggested as a risk factor of RPOA. Generally, OA induces bone anabolism, while rheumatoid arthritis (RA) causes bone destruction due to significantly more severe inflammation 47–49. Thus, the repair mechanism in joints affected by RA is more devastatingly impaired. In contrast, osteoarthritic joints usually have active bony remodeling, which is thought to be a necessary pathophysiologic response to counteract joint failure and to prevent more catastrophic consequences, especially when the trauma or degeneration of the joint is so severe that cartilage degradation is not reversible and cartilage cannot be repaired any more. Without a proper stimulation of such a bone-anabolic response, arthritic joints could demonstrate accelerated bone loss and collapse. Thus, the phenotype in the NGFR KO mice could imply a mechanism underlying NGF inhibition-induced RPOA. Moreover, restriction of inflammation and upregulation of bone anabolism as suggested by the role of NGFR may implicate potential therapeutic options for RPOA, or other bone-destructive rheumatic diseases.
The induction of NGFR in committed skeletal cells but not in early-stage stem cells suggests an important role of NGFR in skeletal biology. Intriguingly, the generally viable and fertile phenotype of NGFR null mice 27,28, which does display abnormal reflexes or reduced innervation, seems to obscure if NGFR has an indispensable function in skeletal development and homeostasis. Our analysis of the mice with conditional NGFR deficiency, which was induced at the age of two weeks, did not reveal overt skeletal phenotype in both healthy and osteoarthritic joints. While this result may suggest that NGFR is not absolutely essential for skeletal cells, we speculated that it could represent a technical challenge in inducing genetic deficiency in those dynamically differentiated cells recruited to repair osteoarthritic joints. Since osteochondral cells are incessantly derived from progenitor cells, it is anticipated that the cells produced after tamoxifen injection would not have their Ngfr gene deleted. Therefore, we developed a new strategy of inducible gene KO, by injecting tamoxifen weekly, in order to induce Ngfr deletion in continuously-derived osteochondral cells. Indeed, we found significant reductions of bony remodeling in NGFR-null joints (Fig. 4c–f). Thus, our results demonstrated that this new and dynamic strategy for inducible genetic deficiency could be useful, especially for those processes involving dynamic cell differentiation. Moreover, we anticipate there would be a lot more application scenarios for this strategy in addition to OA, like facture healing in the skeletal field, and many other chronic pathologic conditions. It is also recognized that tamoxifen treatment may increase bone formation in mice 50,51. Thus, this side effect of tamoxifen as a reagent to induce conditional KO should be taken into account when designing the experiments and interpreting the results. With inclusion of appropriate controls and considerations of the side effect, the strategy of long-term tamoxifen administration is expected to generate useful information for studying the chronic or dynamic conditions.
To date, available studies of NGF signaling in skeletal biology were mostly focused on peripheral neuropathy that indirectly regulates skeletal tissues through vascular ingrowth, or paracrine growth factors 52–54, while a recent report identified the role of NGF-NGFR signaling in coordinating skeltal cell migration 55. Therefore, it remains understudied whether NGF directly regulates skeletal pathophysiology. Here our results established an important role of NGF-NGFR signaling in regulating non-neuronal skeletal cells and tissues, which may represent a new example of the interactions between pain and skeletal pathophysiology. OA and other musculoskeletal diseases involve extensive tissue damages, which elicit nociceptive pain through activating inflammatory reactions 9,56, therefore pain acts as an alarm signal against noxious stimuli. The protective properties of pain could be further supplemented by the induction of pain-related factors including NGF-NGFR in the damaged tissues, which may facilitate non-neuronal cells to restrict inflammation and facilitate tissue remodeling and repair as demonstrated by this study. Thus, it would be interesting to investigate if this inflammation-limiting role of NGF-NGFR can be extrapolated to numerous other painful musculoskeletal conditions, including multiple rheumatic diseases, bone fractures, and back pain, which would be instrumental to the successful development of safe, effective analgesics.
The lack of highly effective, low-risk pain therapy has caused an opioid crisis in the United States. NGF antagonism had aroused hopes for its potential effectiveness and lower risk from misuse. In 2004, the tanezumab application was submitted to FDA, but it ended up with a disappointing result due to its adverse events in 2021. Therefore, it would be significant if this therapy can be improved regarding its adverse effects of RPOA. As our results demonstrated that inhibition of NGF-NGFR leads to impaired bony remodeling of osteoarthritic joints, it could be promising to repurpose approved therapies targeting bone resorption or boosting bone formation to prevent or reduce the occurrence of RPOA. In addition, a prescreening of certain biomarkers to evaluate inflammation, bone anabolism, or NGFR expression may help identify patients with higher RPOA risk. Together, more in-depth understanding of the role of NGF-NGFR in skeletal cells will improve development of new efficacious and safer pain therapies that help stem the opioid epidemic.
Methods
Human tissue acquisition.
Adult human knee joint cartilage tissues were obtained from the patients who underwent total knee arthroplasty as a result of OA, or from human adult donors (cadavers) with no sign of cartilage degeneration, within 24 h of death from donors via the Gift of Hope Organ and Tissue Donor Network (Elmhurst, IL), with approval by the local ethics committee and informed consent obtained from the families. No subjects have been recruited for the proposed project. The samples were obtained with a code number. Samples were de-identified prior to use in this study to protect the individual’s privacy and the investigator cannot determine the patient’s identity based on the coded sample.
Animal studies.
The animal protocol of this study has been approved by the Institutional Animal Care and Use Committee (IACUC) of the Rush University Medical Center and all experimental methods and procedures were carried out in accordance with the approved guidelines. The Ngfr conditional knockout mice used in this study had heterozygous (a single copy) Acan-CreER 57 and homozygous floxed Ngfr (JAX Strain # 031162) 28. Their Cre-negative littermates were used as the control mice. Sex-matched control and NGFR KO mice were used. We performed DMM surgery on the right knee of the 3-month-old mice to induce OA as previously described 20,31. Two strategies of tamoxifen injection (1 mg/10g body weight, i.p. injection) were used respectively: 5-day injections when the mice are 15 days old; or weekly injections starting from 10 days after DMM until sample harvest. Both the control mice and the NGFR KO mice received tamoxifen injection. Acan-CreER mice were crossed to Ai9 (Rosa-CAG-LSL-tdTomato-WPRE, Jackson Strain # 007909) 58 to generate the Acan-CreER reporter mice, namely Ai9;Acan-CreER. Weekly injection of tamoxifen started from 10 days after DMM on 3-month-old male Ai9;Acan-CreER or Ai9 mice (n = 3), until the samples were collected two months later.
Cell isolation and culture.
Mouse articular chondrocytes were isolated according to a published protocol and cultured 37. Mouse bone marrow cells were isolated from long bones and cultured for 5 days in α-minimal essential medium (α-MEM) (Life Technologies, Grand Island, NY, USA) with 20% fetal bovine serum (FBS) (Life Technologies, Grand Island, NY, USA) and then in α-MEM with 10% FBS for a longer duration. CD45− BMSC purification was performed as previously reported 59. E14.5 Limb bud cells were isolated by dissecting limb buds from mouse embryos, and incubating the tissue in 0.1% Trypsin/EDTA for 30 min at 37 °C. The limb buds were further dissociated by gentle pipetting and the cell suspension was filtered through a 40-μM strainer and centrifuged. Then the cell pellets were resuspended and plated on culture dishes. To induce osteoblast differentiation, cells were cultured in α-MEM supplemented with 10% FBS, 10 nM dexamethasone, 50 μg/ml ascorbic acid, and 10 mM β-glycerophosphate. Alkaline phosphatase (ALP) was performed as previously described 20. We treated NGFR-null or control C2C12 cells with 1 ng/ml TNF for 32 hours for the collection of supernatant medium. The medium was then supplemented with 50 ng/ml M-CSF and used to treat RAW264.7 cells seeded in the 96-well plates for a week. Then we performed TRAP staining as described previously 60.
PCR, CRISPR, and plasmids.
We extracted RNA with genomic DNA digested, and designed quantitative PCR primers that span over a large (>2 kbp) intron for human or rodent NGFR and TrkA genes, which aims to avoid the interference of genomic DNA in the quantification of the mRNA levels. Quantitative RT-PCR was performed as described previously 20 , using the primer pairs for mouse Ngfr (5’- CCGCTGACAACCTCATTCCT-3’ and 5’- TGTCGCTGTGCAGTTTCTCT-3’), rat Ngfr (5’- GGCCTTGTGGCCTATATTGC -;3’ and 5’- CTGTCGCTGTGCAGTTTCTC -3’ ), human NGFR (5’-CAGGACAAGCAGAACACCGT -3’ and 5’-GGTGTGGACCGTGTAATCCA-3’), mouse TrkA (5’-GCCTAACCATCGTGAAGAGTG-3’ and 5’- CCAACGCATTGGAGGACAGAT-3’), rat TrkA (5’-ATGGGGACCTCAACCGTTTC -3’ and 5’-CAAAGGACCAGGAGCCACAT -3’), and human TrkA (5’-GGTACCAGCTCTCCAACACG-3’ and 5’-CGCATGATGGCGTAGACCTC -3’), Smad1 (5’- GCTTCGTGAAGGGTTGGGG-3’ and 5’- CGGATGAAATAGGATTGTGGGG-3’), Runx2 (5’-CAAGAAGGCTCTGGCGTTTA-3’ and 5’-TGCAGCCTTAAATGACTCGG-3’), Id1 (5’- CCTAGCTGTTCGCTGAAGGC-3’ and 5’- CTCCGACAGACCAAGTACCAC-3’), Id2 (5’- ATGAAAGCCTTCAGTCCGGTG-3’ and 5’- AGCAGACTCATCGGGTCGT-3’), Rankl (5’- CAGCATCGCTCTGTTCCTGTA-3’ and 5’- CTGCGTTTTCATGGAGTCTCA-3’), Opg (5’- ACCCAGAAACTGGTCATCAGC-3’ and 5’- CTGCAATACACACACTCATCACT-3’), and β-actin (5’-GGCTGTATTCCCCTCCATCG-3’ and 5’-CCAGTTGGTAACAATGCCATGT-3’). To knockout Ngfr in the cultured cells, the vector of lentiCRISPR v2 (Addgene plasmid # 52961), a gift from Feng Zhang 61, was used for cloning of individual sgRNAs. The sgRNA sequences for mouse NGFR KO are listed as follows: sg2, CTCAGATGAAGCCAACCACG; sg6, ACAGGCATGTACACCCACAG; sg7, TGGAGCAATAGACAGGAATG; and sg8, TATAGACTCCTTTACCCACG. For CRISPRa, we constructed Lenti-SpdCas9-VP64, a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62, and Lenti-EGFP-dual-gRNA, a vector constructed in our lab to express two gRNA scaffolds for SgCas9 and SaCas9 respectively. Multiple Ngfr promoter-targeting sgRNAs were cloned into Lenti-EGFP-dual-gRNA for generation of efficient CRISPRa, which include: sg1, GCAGTCAAGTGAGGCGTGAG; sg3, AGCATAACCGGAGGTGCCCT; sg4, GCGGTTCCGGAGGGGTTggg; and sg5, CCCACTGAGAAGCCACAGCG. NGFR-RFP was a gift from Moses Chao (Addgene plasmid # 24092).
Western Blot.
Western blot analysis was performed as described previously 63, using the following antibodies: anti-NGFR, Cell Signaling, catalog # 8238S; anti-phospho-NF-κB p65 (Ser536), Cell Signaling, catalog #3033; anti-NF-κB p65 (D14E12), Cell Signaling, catalog #8242; anti-phospho-IκBα (Ser32), Cell Signaling, catalog # 2859; anti-IκBα, Novus Biologicals, catalog # NB100–56507; anti-p-SMAD1, Cell Signaling, catalog # 9516S; anti-SMAD1, abcam, catalog # ab63356; anti- Phospho-IKKα (Ser176)/IKKβ (Ser177), Cell Signaling, catalog #2078; anti-IKKβ, Cell Signaling, catalog #2678; anti-β-actin, Sigma-Aldrich, catalog # A5441; anti-RANKL, Novus Biologicals, Clone 12A668.
Micro-CT, histology, and immunohistochemistry.
We used a Scanco μCT35 scanner (Scanco Medical, Brüttisellen, Switzerland) with 55 kVp source and 145 μAmp current for formalin-fixed mouse legs with a resolution of 10 μm as previously described.64,65 The scanned images from each group were evaluated at the same thresholds to allow 3-dimensional structural rendering of each sample. The start and end positions of the scan region are the mid-points of the femur and tibia respectively. For evaluation of the joint, the Volume of Interest (VOI) was chosen by contouring the scan regions that include the knee joint as well as partial femur and tibia. For evaluation of the subchondral bone, the VOI was chosen by drawing contours inside the medial side of the joint counterclockwise to include subchondral bone. For evaluation of ectopic bones, the VOI was chosen by drawing contours around the entire tissue counterclockwise and also drawing contours around the epiphysis clockwise. For evaluation of the trabecular bone, the VOI was selected by drawing contours inside the metaphyseal cortical bone counterclockwise and the femoral trabecular bone volume fraction (BV/TV) were measured. When the automatic contour function was used for multiple slices, we scrolled through each slice to check for accuracy. For evaluation of the whole joint, subchondral bone, and trabecular bone, a lower threshold of 220 and the upper threshold of 1000 were chosen for all the groups. The 3D image of the joint, ectopic bone, and the 2D image of subchondral bone were generated, and ectopic bone volume and medial subchondral bone volume fraction BV/TV were measured. For histology and immunohistochemistry (IHC), tissues were fixed in 10% formalin, decalcified, and embedded in paraffin. Serial sagittal sections of knee joints were cut every 3 μm from the medial compartments. The sections were stained with Alcian blue/hematoxylin & orange G (AB/H&OG) for histological analysis 66. OARSI scoring was performed to evaluate knee joint AC destruction essentially as previously described 20. Specifically, both medial femoral condyle and medial tibial plateau were analyzed through three-level sections of the joints and the severity of OA is expressed as the summed scores for the entire joint. Synovitis was semi-quantified by the enlargement of the synovial lining cell layer according to a scheme as previously described 67. For TRAP staining, the sections were incubated in the TRAP staining solution as described previously 60. IHC was performed essentially as described 66. Specifically, 3 μm paraffin sections were heated at 95°C in Antigen Unmasking Solution (Vector Laboratories, Burlingame, CA, USA) for 10–15 minutes, and then sequentially treated with 0.5% Triton X-100, Avidin/Biotin Blocking Kit (Invitrogen, Carlsbad, CA, USA). After blocking with 10% normal goat serum (Vector Laboratories, Burlingame, CA, USA) for 1 hour, sections were treated with 1/100 anti-NGFR antibody (Cell Signaling, catalog # 8238S), 1/200 anti-RUNX2 antibody (MBL, catalog # D130–3), 1/200 NGF antibody (abcam, catalog # ab6199), 1/100 anti-p-SMAD1 (Cell Signaling, catalog # 9516S), 1/200 anti-SMAD1 (abcam, catalog # ab63356); 1/100 anti-p65 antibody (Cell Signaling, catalog #8242), 1/200 anti-RANKL (Novus Biologicals, Clone 12A668), 1/500 anti-osteoprotegerin (Novus Biologicals, Clone 98A1071), 1/200 anti-βIII-tubulin antibody (R&D Systems, catalog # MAB1195 ) overnight at 4°C and incubated with secondary antibody conjugated to Alexa Fluor 488 (Thermo Fisher) for 30 minutes. Alternatively, we also used 1/400 secondary biotinylated goat anti-rabbit or anti-mouse antibody, biotinylated anti-streptavidin, and DyLight 488 streptavidin (Vector Laboratories) for fluorescence labeling and detection. For frozen sectioning of the knee joints of the Acan-CreER reporter mice, the dissected limbs were fixed in 4% Paraformaldehyde (PFA) for 3 days and decalcified in 14% EDTA for 2 weeks. The tissues were cryoprotected in 30% sucrose overnight before embedding in OCT and sectioning. Images of histology, IHC and frozen sections were captured using CellSens Imaging Software (Olympus) on an Olympus BX43 microscope, or a Zeiss LSM700 confocal microscope.
Single cell RNA-seq data analysis.
A scRNA-Seq dataset of human embryonic skeletogenesis was downloaded from Gene Expression Omnibus (GEO) under the accession number of (GSE143753) 38 . The expression matrix of two samples, CS13 limbbud and CS22 long bone respectively, were extracted and processed by the Seurat package (Version: 4.9.9.9060) 68. We excluded low-quality cells in the analysis by filtering out those with a number of expressed genes less than 500 or greater than 6000, with a number of molecules detected less than 500 or greater than 40,000, or with a proportion of mitochondrial genes greater than 6%. After data normalization, 2000 highly variable features (genes) were identified and scaled. Then we performed principal component analysis (PCA) to reduce the dimensionality of the data. For an integrative analysis of the data from CS13 limbbud and CS22 long bone, we used the reciprocal PCA (RPCA) method to identify integration anchors and create an integrated data assay for clustering of the dataset and UMAP-based visualization. Specific marker genes were identified based on the procedures reported in the original publication of the dataset 38. Gene expression data of cells and their cluster information were used to create a CellChat object for analyses of cell-cell communication networks according to the published protocol 69.
Statistical analyses.
All the data were expressed as mean ± s.d, as indicated in the Fig. legends. Statistical analyses (two-sided) were completed with GraphPad Prism. Unpaired Student’s t-test (for two groups) and one-way ANOVA (for multiple groups) were used followed by the Tukey-Kramer test. P < 0.05 was considered statistically significant.
Supplementary Material
Acknowledgments
We thank Jun Li for his technical expertise. This work was supported by Grants R01AR070222 and R01AR070222-04S1 of National Institutes of Health.
Footnotes
Competing interests: The authors declare no competing interests.
Data availability
The data that support the findings of this study are available within the article and its supplementary Information files or from the corresponding author upon reasonable request. The dataset analyzed in this study from Ref. 38 is available from the Gene Expression Omnibus (GEO) repository under the following accession number GSE143753.
References
- 1.Hunter D. J., March L. & Chew M. Osteoarthritis in 2020 and beyond: a Lancet Commission. Lancet 396, 1711–1712, doi: 10.1016/s0140-6736(20)32230-3 (2020). [DOI] [PubMed] [Google Scholar]
- 2.Goldring S. R. & Goldring M. B. Changes in the osteochondral unit during osteoarthritis: structure, function and cartilage-bone crosstalk. Nat Rev Rheumatol 12, 632–644, doi: 10.1038/nrrheum.2016.148 (2016). [DOI] [PubMed] [Google Scholar]
- 3.Loeser R. F., Goldring S. R., Scanzello C. R. & Goldring M. B. Osteoarthritis: a disease of the joint as an organ. Arthritis and rheumatism 64, 1697–1707, doi: 10.1002/art.34453 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Pitsillides A. A. & Beier F. Cartilage biology in osteoarthritis--lessons from developmental biology. Nat Rev Rheumatol 7, 654–663, doi: 10.1038/nrrheum.2011.129 (2011). [DOI] [PubMed] [Google Scholar]
- 5.Pap T. & Korb-Pap A. Cartilage damage in osteoarthritis and rheumatoid arthritis--two unequal siblings. Nat Rev Rheumatol 11, 606–615, doi: 10.1038/nrrheum.2015.95 (2015). [DOI] [PubMed] [Google Scholar]
- 6.Berenbaum F., Griffin T. M. & Liu-Bryan R. Review: Metabolic Regulation of Inflammation in Osteoarthritis. Arthritis & rheumatology (Hoboken, N.J.) 69, 9–21, doi: 10.1002/art.39842 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Burr D. B. & Gallant M. A. Bone remodelling in osteoarthritis. Nat Rev Rheumatol 8, 665–673, doi: 10.1038/nrrheum.2012.130 (2012). [DOI] [PubMed] [Google Scholar]
- 8.van der Kraan P. M. & van den Berg W. B. Osteophytes: relevance and biology. Osteoarthritis and cartilage 15, 237–244, doi: 10.1016/j.joca.2006.11.006 (2007). [DOI] [PubMed] [Google Scholar]
- 9.Malfait A. M. & Schnitzer T. J. Towards a mechanism-based approach to pain management in osteoarthritis. Nat Rev Rheumatol 9, 654–664, doi: 10.1038/nrrheum.2013.138 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Aloe L. Rita Levi-Montalcini: the discovery of nerve growth factor and modern neurobiology. Trends in cell biology 14, 395–399, doi: 10.1016/j.tcb.2004.05.011 (2004). [DOI] [PubMed] [Google Scholar]
- 11.Iannone F. et al. Increased expression of nerve growth factor (NGF) and high affinity NGF receptor (p140 TrkA) in human osteoarthritic chondrocytes. Rheumatology (Oxford, England) 41, 1413–1418 (2002). [DOI] [PubMed] [Google Scholar]
- 12.Hochberg M. C. et al. Long-Term Safety and Efficacy of Subcutaneous Tanezumab Versus Nonsteroidal Antiinflammatory Drugs for Hip or Knee Osteoarthritis: A Randomized Trial. Arthritis & rheumatology (Hoboken, N.J.) 73, 1167–1177, doi: 10.1002/art.41674 (2021). [DOI] [PubMed] [Google Scholar]
- 13.Wise B. L., Seidel M. F. & Lane N. E. The evolution of nerve growth factor inhibition in clinical medicine. Nat Rev Rheumatol 17, 34–46, doi: 10.1038/s41584-020-00528-4 (2021). [DOI] [PubMed] [Google Scholar]
- 14.Hochberg M. C. et al. When Is Osteonecrosis Not Osteonecrosis?: Adjudication of Reported Serious Adverse Joint Events in the Tanezumab Clinical Development Program. Arthritis & rheumatology (Hoboken, N.J.) 68, 382–391, doi: 10.1002/art.39492 (2016). [DOI] [PubMed] [Google Scholar]
- 15.Lievense A. M., Bierma-Zeinstra S. M., Verhagen A. P., Verhaar J. A. & Koes B. W. Prognostic factors of progress of hip osteoarthritis: a systematic review. Arthritis and rheumatism 47, 556–562, doi: 10.1002/art.10660 (2002). [DOI] [PubMed] [Google Scholar]
- 16.Shu X. Q. & Mendell L. M. Neurotrophins and hyperalgesia. Proc Natl Acad Sci U S A 96, 7693–7696 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kaplan D. R., Hempstead B. L., Martin-Zanca D., Chao M. V. & Parada L. F. The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 252, 554–558 (1991). [DOI] [PubMed] [Google Scholar]
- 18.Verdi J. M. et al. p75LNGFR regulates Trk signal transduction and NGF-induced neuronal differentiation in MAH cells. Neuron 12, 733–745 (1994). [DOI] [PubMed] [Google Scholar]
- 19.Huang J., Zhao L. & Chen D. Growth factor signalling in osteoarthritis. Growth Factors 36, 187–195, doi: 10.1080/08977194.2018.1548444 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Huang J. et al. The microRNAs miR-204 and miR-211 maintain joint homeostasis and protect against osteoarthritis progression. Nat Commun 10, 2876, doi: 10.1038/s41467-019-10753-5 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Liao L. et al. Acute Synovitis after Trauma Precedes and is Associated with Osteoarthritis Onset and Progression. International journal of biological sciences 16, 970–980, doi: 10.7150/ijbs.39015 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Denk F., Bennett D. L. & McMahon S. B. Nerve Growth Factor and Pain Mechanisms. Annual review of neuroscience 40, 307–325, doi: 10.1146/annurev-neuro-072116-031121 (2017). [DOI] [PubMed] [Google Scholar]
- 23.Quirici N. et al. Isolation of bone marrow mesenchymal stem cells by anti-nerve growth factor receptor antibodies. Experimental hematology 30, 783–791, doi: 10.1016/s0301-472x(02)00812-3 (2002). [DOI] [PubMed] [Google Scholar]
- 24.Tormin A. et al. CD146 expression on primary nonhematopoietic bone marrow stem cells is correlated with in situ localization. Blood 117, 5067–5077, doi: 10.1182/blood-2010-08-304287 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mabuchi Y. et al. LNGFR(+)THY-1(+)VCAM-1(hi+) cells reveal functionally distinct subpopulations in mesenchymal stem cells. Stem cell reports 1, 152–165, doi: 10.1016/j.stemcr.2013.06.001 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Severe N. et al. Stress-Induced Changes in Bone Marrow Stromal Cell Populations Revealed through Single-Cell Protein Expression Mapping. Cell stem cell 25, 570–583.e577, doi: 10.1016/j.stem.2019.06.003 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lee K. F. et al. Targeted mutation of the gene encoding the low affinity NGF receptor p75 leads to deficits in the peripheral sensory nervous system. Cell 69, 737–749, doi: 10.1016/0092-8674(92)90286-l (1992). [DOI] [PubMed] [Google Scholar]
- 28.Bogenmann E. et al. Generation of mice with a conditional allele for the p75(NTR) neurotrophin receptor gene. Genesis 49, 862–869, doi: 10.1002/dvg.20747 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Glasson S. S., Blanchet T. J. & Morris E. A. The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthritis Cartilage 15, 1061–1069, doi: S1063-4584(07)00110-0 [pii] 10.1016/j.joca.2007.03.006 (2007). [DOI] [PubMed] [Google Scholar]
- 30.Sanchez-Lopez E., Coras R., Torres A., Lane N. E. & Guma M. Synovial inflammation in osteoarthritis progression. Nat Rev Rheumatol 18, 258–275, doi: 10.1038/s41584-022-00749-9 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Zhao L. et al. Exploration of CRISPR/Cas9-based gene editing as therapy for osteoarthritis. Ann Rheum Dis 78, 676–682, doi: 10.1136/annrheumdis-2018-214724 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wu M., Chen G. & Li Y. P. TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone research 4, 16009, doi: 10.1038/boneres.2016.9 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Reznikoff C. A., Brankow D. W. & Heidelberger C. Establishment and characterization of a cloned line of C3H mouse embryo cells sensitive to postconfluence inhibition of division. Cancer research 33, 3231–3238 (1973). [PubMed] [Google Scholar]
- 34.Ogawa M. et al. B cell ontogeny in murine embryo studied by a culture system with the monolayer of a stromal cell clone, ST2: B cell progenitor develops first in the embryonal body rather than in the yolk sac. The EMBO journal 7, 1337–1343, doi: 10.1002/j.1460-2075.1988.tb02949.x (1988). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Atsumi T., Miwa Y., Kimata K. & Ikawa Y. A chondrogenic cell line derived from a differentiating culture of AT805 teratocarcinoma cells. Cell differentiation and development : the official journal of the International Society of Developmental Biologists 30, 109–116, doi: 10.1016/0922-3371(90)90079-c (1990). [DOI] [PubMed] [Google Scholar]
- 36.Konermann S. et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 517, 583–588, doi: 10.1038/nature14136 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Gosset M., Berenbaum F., Thirion S. & Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc 3, 1253–1260, doi: 10.1038/nprot.2008.95 nprot.2008.95 [pii] (2008). [DOI] [PubMed] [Google Scholar]
- 38.He J. et al. Dissecting human embryonic skeletal stem cell ontogeny by single-cell transcriptomic and functional analyses. Cell research 31, 742–757, doi: 10.1038/s41422-021-00467-z (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Duchamp de Lageneste O. et al. Periosteum contains skeletal stem cells with high bone regenerative potential controlled by Periostin. Nature communications 9, 773, doi: 10.1038/s41467-018-03124-z (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zhou X. et al. Chondrocytes transdifferentiate into osteoblasts in endochondral bone during development, postnatal growth and fracture healing in mice. PLoS genetics 10, e1004820, doi: 10.1371/journal.pgen.1004820 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Ono N., Ono W., Nagasawa T. & Kronenberg H. M. A subset of chondrogenic cells provides early mesenchymal progenitors in growing bones. Nature cell biology 16, 1157–1167, doi: 10.1038/ncb3067 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Scanzello C. R. et al. Local cytokine profiles in knee osteoarthritis: elevated synovial fluid interleukin-15 differentiates early from end-stage disease. Osteoarthritis and cartilage 17, 1040–1048, doi: 10.1016/j.joca.2009.02.011 (2009). [DOI] [PubMed] [Google Scholar]
- 43.Berenbaum F. Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). Osteoarthritis and cartilage 21, 16–21, doi: 10.1016/j.joca.2012.11.012 (2013). [DOI] [PubMed] [Google Scholar]
- 44.Zhao B. TNF and Bone Remodeling. Current osteoporosis reports 15, 126–134, doi: 10.1007/s11914-017-0358-z (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Zhao L. et al. Tumor necrosis factor inhibits mesenchymal stem cell differentiation into osteoblasts via the ubiquitin E3 ligase Wwp1. Stem Cells 29, 1601–1610, doi: 10.1002/stem.703 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Zhang Q., Lenardo M. J. & Baltimore D. 30 Years of NF-κB: A Blossoming of Relevance to Human Pathobiology. Cell 168, 37–57, doi: 10.1016/j.cell.2016.12.012 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Diarra D. et al. Dickkopf-1 is a master regulator of joint remodeling. Nat Med 13, 156–163, doi: 10.1038/nm1538 (2007). [DOI] [PubMed] [Google Scholar]
- 48.Wei J. L. et al. Role of ADAMTS-12 in Protecting Against Inflammatory Arthritis in Mice By Interacting With and Inactivating Proinflammatory Connective Tissue Growth Factor. Arthritis & rheumatology (Hoboken, N.J.) 70, 1745–1756, doi: 10.1002/art.40552 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Bouta E. M. et al. Brief Report: Treatment of Tumor Necrosis Factor-Transgenic Mice With Anti-Tumor Necrosis Factor Restores Lymphatic Contractions, Repairs Lymphatic Vessels, and May Increase Monocyte/Macrophage Egress. Arthritis & rheumatology (Hoboken, N.J.) 69, 1187–1193, doi: 10.1002/art.40047 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Perry M. J., Gujra S., Whitworth T. & Tobias J. H. Tamoxifen stimulates cancellous bone formation in long bones of female mice. Endocrinology 146, 1060–1065, doi: 10.1210/en.2004-1114 (2005). [DOI] [PubMed] [Google Scholar]
- 51.Zhang Z. et al. Estrogen receptor alpha in the brain mediates tamoxifen-induced changes in physiology in mice. eLife 10, doi: 10.7554/eLife.63333 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Tomlinson R. E. et al. NGF-TrkA signaling in sensory nerves is required for skeletal adaptation to mechanical loads in mice. Proc Natl Acad Sci U S A 114, E3632–e3641, doi: 10.1073/pnas.1701054114 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Li Z. et al. Fracture repair requires TrkA signaling by skeletal sensory nerves. J Clin Invest 129, 5137–5150, doi: 10.1172/jci128428 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Lee S. et al. NGF-TrkA signaling dictates neural ingrowth and aberrant osteochondral differentiation after soft tissue trauma. Nat Commun 12, 4939, doi: 10.1038/s41467-021-25143-z (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Xu J. et al. NGF-p75 signaling coordinates skeletal cell migration during bone repair. Science advances 8, eabl5716, doi: 10.1126/sciadv.abl5716 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Conaghan P. G., Cook A. D., Hamilton J. A. & Tak P. P. Therapeutic options for targeting inflammatory osteoarthritis pain. Nat Rev Rheumatol 15, 355–363, doi: 10.1038/s41584-019-0221-y (2019). [DOI] [PubMed] [Google Scholar]
- 57.Henry S. P. et al. Generation of aggrecan-CreERT2 knockin mice for inducible Cre activity in adult cartilage. Genesis 47, 805–814, doi: 10.1002/dvg.20564 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Madisen L. et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nature neuroscience 13, 133–140, doi: 10.1038/nn.2467 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Zhao L. et al. Smurf1 inhibits mesenchymal stem cell proliferation and differentiation into osteoblasts through JunB degradation. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 25, 1246–1256, doi: 10.1002/jbmr.28 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Cao H. et al. Activating transcription factor 4 regulates osteoclast differentiation in mice. J Clin Invest 120, 2755–2766, doi: 10.1172/jci42106 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Sanjana N. E., Shalem O. & Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 11, 783–784, doi: 10.1038/nmeth.3047 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Matharu N. et al. CRISPR-mediated activation of a promoter or enhancer rescues obesity caused by haploinsufficiency. Science 363, doi: 10.1126/science.aau0629 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Huang J., Zhao L., Xing L. & Chen D. MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation. Stem Cells 28, 357–364, doi: 10.1002/stem.288 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Huang J., Lai Y., Li J. & Zhao L. Loss of miR-204 and miR-211 shifts osteochondral balance and causes temporomandibular joint osteoarthritis. J Cell Physiol, doi: 10.1002/jcp.31120 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Fan Y. et al. Serum miRNAs are potential biomarkers for the detection of disc degeneration, among which miR-26a-5p suppresses Smad1 to regulate disc homeostasis. Journal of cellular and molecular medicine 23, 6679–6689, doi: 10.1111/jcmm.14544 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Fan Y., Zhao L., Lai Y., Lu K. & Huang J. CRISPR-Cas9-mediated loss of function of β-catenin attenuates intervertebral disc degeneration. Molecular therapy. Nucleic acids 28, 387–396, doi: 10.1016/j.omtn.2022.03.024 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Krenn V. et al. Synovitis score: discrimination between chronic low-grade and high-grade synovitis. Histopathology 49, 358–364, doi: 10.1111/j.1365-2559.2006.02508.x (2006). [DOI] [PubMed] [Google Scholar]
- 68.Hao Y. et al. Dictionary learning for integrative, multimodal and scalable single-cell analysis. Nature biotechnology, doi: 10.1038/s41587-023-01767-y (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Jin S. et al. Inference and analysis of cell-cell communication using CellChat. Nature communications 12, 1088, doi: 10.1038/s41467-021-21246-9 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available within the article and its supplementary Information files or from the corresponding author upon reasonable request. The dataset analyzed in this study from Ref. 38 is available from the Gene Expression Omnibus (GEO) repository under the following accession number GSE143753.