Abstract
Gut microbiota disturbance and systemic inflammation have been implicated in the degeneration of dopaminergic neurons in Parkinson’s disease (PD). How the alteration of gut microbiota results in neuropathological events in PD remains elusive. In this study, we explored whether and how environmental insults caused early neuropathological events in the substantia nigra (SN) of a PD mouse model. Aged (12-month-old) mice were orally administered rotenone (6.25 mg·kg−1·d−1) 5 days per week for 2 months. We demonstrated that oral administration of rotenone to ageing mice was sufficient to establish a PD mouse model and that microglial activation and iron deposition selectively appeared in the SN of the mice prior to loss of motor coordination and dopaminergic neurons, and these events could be fully blocked by microglial elimination with a PLX5622-formulated diet. 16 S rDNA sequencing analysis showed that the gut microbiota in rotenone-treated mice was altered, and mice receiving faecal microbial transplantation (FMT) from ageing mice treated with rotenone for 2 months exhibited the same pathology in the SN. We demonstrated that C-X-C motif chemokine ligand-1 (CXCL1) was an essential molecule, as intravenous injection of CXCL1 mimicked almost all the pathology in serum and SN induced by oral rotenone and FMT. Using metabolomics and transcriptomics analyses, we identified the PPAR pathway as a key pathway involved in rotenone-induced neuronal damage. Inhibition of the PPARγ pathway was consistent in the above models, whereas its activation by linoleic acid (60 mg·kg−1·d−1, i.g. for 1 week) could block these pathological events in mice intravenously injected with CXCL1. Altogether, these results reveal that the altered gut microbiota resulted in neuroinflammation and iron deposition occurring early in the SN of ageing mice with oral administration of rotenone, much earlier than motor symptoms and dopaminergic neuron loss. We found that CXCL1 plays a crucial role in this process, possibly via PPARγ signalling inhibition. This study may pave the way for understanding the “brain-gut-microbiota” molecular regulatory networks in PD pathogenesis.

The aged C57BL/6 male mice with rotenone intragastric administration showed altered gut microbiota, which caused systemic inflammation, PPARγ signalling inhibition and neuroinflammation, brain iron deposition and ferroptosis, and eventually dopaminergic neurodegeneration in PD.
Keywords: Parkinson’s disease, inflammation, gut microbiota, CXCL1, PPAR, linoleic acid
Introduction
Parkinson’s disease (PD) is an irreversible chronic neurodegenerative disease characterised by the loss of dopaminergic neurons in the substantia nigra (SN). Although 5%-10% of PD patients are monogenic Mendelian, most cases are sporadic, and the mechanisms underlying dopaminergic neurodegeneration remain unclear. Environmental exposures and ageing play important roles in modulating the risk of PD [1–3]. In recent years, gut biology has been thought to be involved in the aetiology and progression of PD. Neuropathological hallmarks of PD, α-synuclein aggregates, can originate in the gut and be transmitted into the brain along the vagus nerve of the brain-gut axis [4]. As a recent review underscored, gut-brain connecting neurons have been extensively investigated in exploring the influence of gut biology on the brain [5]; however, the mechanisms by which environmental events cause neurodegeneration in PD have not been fully elucidated.
Gut microbiota alteration is thought to be involved in brain disorders via possible pathways involving either the vagus nerve or the bloodstream, known as the microbiota-gut-brain axis [6]. In PD patients, the abundance of the constituent microbiota is altered, including but not limited to an elevated abundance of Enterobacteriaceae [7], as well as decreased levels of Blautia [8]. In mouse models of α-synuclein overexpression, it was reported that gut microbiota was required for motor deficits, microglia activation, and α-synuclein pathology. More strikingly, microbiota from PD-affected patients enhanced physical impairments [9]. However, discussion is still lacking on how the alteration of gut microbiota is associated with neuropathological events in PD.
Neuroinflammation is a critical player in PD pathogenesis. Inflammatory responses were proven in affected brain regions of PD patients, while systemic inflammation and aberrant immune responses were also thought to be associated with the development of PD. In PD patients, plasma concentrations of interferon γ (IFN-γ) and tumour necrosis factor-α (TNF-α) were elevated, the gut microbiome was altered, and the latter then reduced the production of short-chain fatty acids and produced more endotoxins [10–12]. Endotoxin lipopolysaccharide (LPS) is the main component of the capsule of gram-negative bacteria, causing systemic inflammation by shedding into the blood and stimulating macrophages to secrete several cytokines, including C-X-C motif chemokine ligand-1 (CXCL1) [13]. In a PD mouse model, elevated circulating LPS led to dopaminergic neuron loss in the SN through the microbiota-gut-brain axis [12]. However, as LPS is a large molecule that hardly crosses the blood‒brain barrier, more exploration is needed to reveal how systemic inflammatory responses cause neurodegeneration in the SN. More recently, in cohorts of patients with idiopathic REM sleep behaviour disorder, changes in peripheral blood monocytes, CD4+ T cells, and plasma cytokines were reported to be associated with dopaminergic changes in PD [14–17]. These data suggest that inflammatory responses could be present in the prodromal stage of PD and reinforce the role of systemic inflammation in PD pathogenesis.
To further explore the possible mechanisms by which environmental insults are associated with early pathological damage in the SN, we developed mouse models with intragastric administration of rotenone. In contrast to systematically administered models, intragastrically administered models are considered to be suitable enteric or gut microbial origin models [12, 18]. A low dose of rotenone excludes the possibility of rotenone entering the brain through circulation, as rotenone could not be detected in the blood. This model was believed to trigger the chronic pathological process of PD [19–22]. Aged mice (12 months old) were chosen because age-related declines may promote susceptibility to insults [4]. We evaluated α-synuclein pathology and iron deposition in 7 brain regions and demonstrated that neuroinflammation occurred early in the SN-Str system accompanied by iron deposition prior to the loss of dopaminergic neurons. Altered gut microbiota was proven to be essential to trigger neuroinflammation and iron deposition in the SN, eventually leading to the pathological and behavioural changes observed in rotenone-administered mice. Using metabolomics and transcriptomics strategies, we identified the involvement of the PPAR signalling pathway, mediated by elevated CXCL1 in the circulation, a molecule crucial for proinflammatory responses [23]. These findings suggest that altered gut microbiota disturbed by environmental insults were potent in eliciting selective neurodegeneration in the SN by circulating cytokines. The CXCL1 and PPAR signalling pathways might have the potential for PD therapeutic strategies.
Materials and methods
Materials
Mouse CXCL1 (GRO-α), linoleic acid, and PLX5622 were purchased from MedChemExpress (NJ, USA). Specific information on the primary and secondary antibodies is shown in Table 1 of the Supplementary materials. Normal donkey serum was provided by Jackson ImmunoResearch (West Grove, PA, USA). All other chemicals were purchased from Sigma (St Louis, MO, USA).
Rotenone-induced PD mouse model
Seven-month-old male C57BL/6J mice were purchased from Beijing Vital River Laboratory Animal Technology (Beijing, China). The animals were acclimated to and maintained at 23 ± 2 °C under a 12-h light/dark cycle with 50% air humidity. Mice were housed in standard laboratory cages (one mouse per cage) and had free access to food and water. Experiments were conducted after feeding the mice for 12 months. Rotenone was dissolved in 4% carboxymethyl cellulose sodium salt with 1.25% chloroform (0.625 mg/mL). Twelve-month-old male mice were administered intragastrically with 55 mm gavage needles once daily (5 days per week) at a dose of 6.25 mg·kg−1·d−1 for 1 week, 2 weeks, 3 weeks, 1 month, 2 months, and 3 months. The mice in the control group received only the vehicle (4% carboxymethyl cellulose sodium salt and 1.25% chloroform) [19]. The daily weights of the mice during the administration period were recorded every day. The weight before dosing on the last day of each week was selected for statistical analysis. Mice were anaesthetised with sodium pentobarbital before sacrificing for sample collection.
To evaluate the role of microglia, 12-month-old male mice were free to access the PLX5622-formulated AIN-93G diet (1.2 g PLX5622 per kilogram of diet) or normal AIN-93G diet [24]. PLX5622 was customised by MedChemExpress (Monmouth Junction, NJ, USA), and then the formulated diet and control diet were provided by Xietong Pharmaceutical Bioengineering (Jiangsu, China). As reported, continuous feeding of a 1200 ppm PLX5622-formulated diet for 5 days eliminated 90% of the microglia in the mouse brain [25]. Rotenone or vehicle was administered intragastrically (6.25 mg·kg−1·d−1, 5 days per week) from the 8th day in mice fed the PLX5622-formulated AIN-93G diet or normal AIN-93G diet. Two weeks and two months after rotenone administration, brain tissues and sections of the SN were collected for further study.
Mice with faecal microbiota transplantation (FMT)
In FMT treatment, the protocol refers to studies that have been reported [26]. Twelve-month-old male mice were divided into five groups. Recipient mice were pretreated with a combination regimen of antibiotics [27]. Imipenem and cilastatin sodium, 50 mg each, were dissolved in 10 mL double distilled water. Mice were administered antibiotics intragastrically at a dose of 10 mL·kg−1·d−1 for 3 days. From the fourth day, the fresh faecal pellets of the vehicle and rotenone group mice (donor mice) were collected daily in sterile normal saline separately (2 faecal pellets/mL), vortexed, and then centrifuged at 800 × g and 25 °C for 3 min. The intraday supernatant was administered to recipient mice (Abx+FMTvehicle group and Abx+FMTrotenone group) intragastrically (100 μL/day) within 10 min after the excretion of faecal pellets from donor mice. A separate group of normal saline gavage after antibiotic treatment for 3 days was set up to analyse the effect of antibiotics on mice (Abx+NS group). Donor mice were intragastrically administered vehicle or rotenone after daily faecal pellet collection. The SN tissues and sections of mice were collected after 2 weeks and 2 months of continuous FMT for further testing.
Mice with CXCL1 intravenous injection
In experiments investigating the effects of CXCL1, 12-month-old male mice were divided into 2 groups (CXCL1 group and vehicle group). CXCL1 was dissolved in normal saline at a concentration of 10 µg/mL, divided, and stored at –20 °C. When used, it was diluted to 2 ng/mL with normal saline and injected into 12-month-old male mice through the tail vein at a dose of 20 ng·kg−1·d−1 for 3 consecutive days or 2 weeks (20 ng·kg−1·d−1, 5 days per week). The vehicle group received an equal volume of normal saline as a control. The SN tissues and sections of mice were collected for further testing. To further evaluate the mechanism of CXCL1-induced dopaminergic neuron loss, linoleic acid (60 mg·kg−1·d−1) was preadministered by daily gavage for 1 week and then continuously administered intragastrically daily during the period of intravenous injection with CXCL1 for 2 weeks. The configuration of linoleic acid refers to an existing report [28].
Motor behaviour test
The motor coordination of the mice was tested using the rotarod test or pole test. In the rotarod test, a rotarod apparatus (Med Associates, Inc. USA) was used. Mice were placed on the rotarod for 2 min to adapt. The rotarod began spinning at 4 rpm and then continuously accelerated to 40 rpm over 5 min. Each mouse was tested twice, and the mean latency to fall off the rotarod was recorded [29].
The pole test is a classical behavioural test to detect motor disorders in mice [30]. A metallic pole with a height of 50 cm and a diameter of 0.5 cm (wrapped with medical tape to prevent slipping) was placed vertically in a cage (40 cm× 60 cm) and covered with bedding in the cage to protect the mice from injury. A tape-covered rubber ball was glued on top of the pole. Mice were pretrained three times after acclimatisation, and the pole test was performed the next day. The timing was segmented between the time to turn around and the time it took for the mice to move from the top to the bottom after turning. The length of time, especially the time to turn, reflects a change in the motor coordination of the mice.
Perl’s iron staining and immunohistochemical (IHC) or immunofluorescence staining
Mice were deeply anaesthetised and transcardially perfused with normal saline followed by 4% paraformaldehyde in 0.1 M phosphate-buffered saline. Brains were postfixed in paraformaldehyde overnight and then stored in 30% sucrose (dissolved in 0.1 M phosphate buffered saline) in a 4 °C refrigerator. After embedding in tissue-tek O.C.T. (Sakura Finetek, Torrance, CA, USA), twenty-micron-thick coronal frozen mouse brain sections were taken at intervals of three. The mouse brain atlas (The Mouse Brain in Stereotaxic Coordinates Third Edition, edited by Keith B.J. Fraklin & George Paxinos in 2007) was referenced. Perl’s staining and IHC staining were used to detect the number of iron- and phosphorylated α-synuclein (phos-α-syn)-positive cells, respectively. Staining in seven brain regions, the dorsal vagus motor nucleus, raphe pallidus, locus coeruleus, SN, striatum, ventral tegmental area (VTA), and temporal association cortex, was detected to analyse the chronological and topographical relationship between iron and α-synuclein pathology.
Perl’s iron staining combined with 3,3’-diaminobenzidine enhancement was used to detect iron-positive cells [31]. For IHC staining, 5% donkey serum was used to block nonspecific binding sites. Primary antibodies were used at 4 °C overnight. Brain sections were then incubated in secondary antibodies for 2 h. The IHC sections were finally intensified using 3,3’-diaminobenzidine or alkaline phosphatase (Vector Laboratories, China, SK-5100). Perl staining, IHC staining with alkaline phosphatase, and Nissl staining were performed sequentially in multiple staining labelling. Details such as antibody dilution ratios are shown in the Supplementary materials (Table 1).
Pictures were taken using a digital pathological section scanning system (OLYMPUS, Japan, VS120). The total number of TH-positive cells in the unilateral SN and the average number of the other indicators were used to reflect the expression levels. An unbiased stereology protocol was used for cell counting, and the number of positive cells was counted by an experimenter blinded to the groups.
Western blotting
Mouse brains were quickly removed from the skulls, and the SN tissues were dissected out according to the mouse brain atlas. The protein supernatant was obtained by centrifugation after tissue lysis. The protein concentration was determined by a bicinchoninic acid assay (BCA) protein assay kit. Equal amounts of soluble protein (10 μg) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‒PAGE), and blots were developed using an ultrasensitive multichemiluminescence system (Fusion FX. EDGE, ILBER LOURMAT, France). Specific information on the primary and secondary antibodies is shown in Table 1 of the Supplementary materials. Quantitative densitometric analyses were performed on digitised images of immunoblots using the NIH programme ImageJ, and band densities were normalised relative to GAPDH.
Real-time polymerase chain reaction (PCR)
The SN tissues were separated as described above. Total RNA from the SN was isolated with TRIzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. The cDNA was synthesised from 2 μg of total RNA using transcriptase (QIAGEN, Germantown, MD, USA) to produce cDNAs by Thermal Cycler (S1000, Bio-Rad). The CD86 and CD206 genes were amplified from cDNA by PCR, with GAPDH as a control gene. TaqMan real-time PCRs were performed using TaqTM Hot Version (Takara Biotechnology Co., Ltd, R007A) by PCR Thermocycle Instrument (Eppendorf realplex4). A comparative threshold cycle (CT) method was used, and the PCR data were calculated by Equation 2−ΔΔCT. Each sample was conducted in duplicate. The primers were designed and synthesised by Takara Biotechnology Co., Ltd. The PCR primer sequences were as follows: CD86 forward primer 5′-TGCTCATCATTGTATGTC-3′, reverse primer 5′-GTTCCTTCAGGTTGATAG-3′, and probe 5′-(FAM) AGAAGCCGAATCAGCCTAGCA (TAMRA)-3′; CD206 forward primer 5′-GGACAAGGAGTTCATTATAC-3′, reverse primer 5′-CAGTCAGCATCTTCATAAG-3′, and probe 5′-(FAM) AGGCTACTTCTTCTTCCACCAGG (TAMRA)-3′; GAPDH forward primer 5′-CAATGTGTCCGTCGTGGATCT-3′, reverse primer 5′-GTCCTCAGTGTAGCCCAAGATG-3′, and probe 5′-(FAM) CGTGCCGCCTGGAGAAACCTGCC (TAMRA)-3′.
Electrochemiluminescence-based Meso Scale Discovery®
SN samples were collected as described above and lysed with lysis buffer (10 μL/mg) without detergent ingredients such as SDS or NP40 (absin, China). The harvested lysate was centrifuged at 12,000 × g for 20 min at 4 °C, and the supernatant was used for analysis. A Bicinchoninic Acid (BCA) Protein Assay Kit (CWBIO, China) was used to calculate the protein concentration. Twenty-five microlitres of supernatant were diluted with an equal volume of lysis buffer before testing. Ten inflammatory cytokines were tested using the electrochemiluminescence-based meso scale discovery® platform (Quick Plex SQ120). These cytokines are interleukin (IL)-12p70, KC/GRO (CXCL1), TNF-α, IFN-γ, IL-1β, IL-2, IL-4, IL-5, IL-6, and IL-10.
Liquid chromatography-tandem mass spectrometry (LC‒MS/MS)
Blood samples were collected from mice in tubes coated with heparin sodium, and then samples were transferred between the refrigerator at –80 °C and room temperature at 10-20 min intervals for two cycles. The samples were filtered and finally tested by LC‒MS/MS. Rotenone was dissolved in chromatography-grade methanol and then diluted to a standard curve. The limit of quantitation of rotenone was 5 ng/mL (0.005 ppm). An UltiMate 3000 RS chromatograph and TSQ Quantum Ultra mass spectrometer (Thermo Fisher Scientific, Shanghai, China) were used for the LC‒MS/MS test. The method was developed and validated by the Yantai Academy of Agricultural Sciences, which is a skilled organisation for pesticide residue testing.
Detection of the intestinal microbial respiratory chain
The contents of NAD+ and NADH in fresh mouse stool samples were tested using the NAD+/NADH assay kit (Colorimetric) (ab65348, Abcam, Abcam, Cambridge, UK), and the ratio of NAD+/NADH was calculated. Fresh stool samples of mice administered rotenone for 1 week were collected into sterilised EP tubes, and 10 μL/mg sterilised saline was added immediately after weighing. After full grinding and blending, samples were quickly transferred to the refrigerator at –80 °C for 20 min and then moved to room temperature for 10 min to melt. After two repeated cycles, the samples were swirled for 10 s. After centrifugation for 15 min at 4 °C and 14,000 r/min, the supernatant was transferred to a 10 kDa spin column (ab93349, Abcam) and centrifuged again for 10 min (4 °C and 10,000 × g). The liquid in the outer tube was transferred to ice, and these samples were tested according to the protocol in the NAD+/NADH assay kit.
16S rDNA sequencing
Colon samples of mice after 1 week of administration were collected into RNase-free collection tubes (Axygen, CA, USA) and quickly frozen with liquid nitrogen. Then, these samples were immediately transferred to −80 °C. Samples were sealed in dry ice and delivered to Majorbio company (Shanghai, China), which was commissioned to extract and sequence the 16S rDNA. The amplified region was 338F_806R, the forward primer sequence was 5′-ACTCCTACGGGAGGCAGCAG-3′, and the reverse primer sequence was 5′-GGACTACHVGGGTWTCTAAT-3′.
Enzyme-linked immunosorbent assay (ELISA)
Blood samples were collected from mice in tubes and serum was obtained by centrifugation at 3000 r/min after clotting at room temperature. The upper serum samples were transferred to new tubes and stored at –80 °C. The ELISA test for LPS and CXCL1 was performed according to the protocol in the instructions. Detailed information on the ELISA kits is shown in Table 1 of the Supplementary materials.
Serum metabolomics and SN transcriptomics
Serum samples and SN tissues of mice administered rotenone for 2 weeks were collected as described above. All samples were collected into RNase-free collection tubes, quickly frozen with liquid nitrogen, and then immediately transferred to −80 °C. Samples were stored on dry ice and delivered to Majorbio company (Shanghai, China) for untargeted metabolomics of serum samples and transcriptome analysis of SN samples.
High-performance liquid chromatography (HPLC)
Mouse brains were quickly removed from the skulls, and the striatum tissues were separated according to the mouse brain atlas. After weighing the striatum tissues, 120 μL of liquid A (0.4 M HClO4) was added to each EP tube. The fully ground tissue samples that had been statically left on ice for 1 h were centrifuged (4 °C, 12,000 r/min, 30 min). Then, 80 μL of supernatant was transferred to empty EP tubes, and 40 μL of liquid B (1.6 g C6H5K3O7, 13.06 g K2HPO4, and 0.185 g EDTA·2Na dissolved in 250 mL double distilled water) was added. We left the well-mixed samples on ice for 1 h and then centrifuged them again. The supernatant was filtered and finally analysed by HPLC (instrument number: Thermo Scientific, UltiMate 3000). Standards of dopamine hydrochloride (DA, PHR1090-1G), homovanillic acid (HVA, 69673-25MG), and 3,4-dihydroxyphenylacetic acid (DOPAC, 11569-25MG) were all purchased from Sigma (St Louis, MO, USA).
Statistical analysis
The results were expressed as the mean ± standard error of the mean (±SEM) and were analysed by SPSS 23.0 statistical software. The comparison of the two groups was analysed by independent sample t-test. The comparison of multiple groups was analysed by one-way ANOVA, and then Student-Newman‒Keuls was used to perform a comparison between the means of the two groups. The Pearson correlation coefficient was used to analyse the correlation between different change indicators. Fisher’s exact test and Benjamini and Hochberg correction were applied for the metabolomics and transcriptomics analyses. P < 0.05 indicated that the results were significant.
Results
Microglial activation and iron deposition occur earlier than dopaminergic neuron loss in the SN of the rotenone-induced PD mouse model
We first evaluated whether intragastrically administered rotenone can induce dopaminergic neurodegeneration in the SN. As expected, ageing C57BL/6 mice (12 months) administered rotenone for 2 months exhibited a loss of TH-immunopositive cells in the SN. Loss of dopaminergic neurons was persistent in the SN of mice with rotenone administration for 3 months (Fig. 1a, b), consistent with the impairment of motor coordination at the corresponding time points (Fig. 1c), suggesting that intragastric rotenone administration to ageing mice is sufficient to establish a PD mouse model. No changes were observed in either neuronal survival or behaviour at the early time points (1 week, 2 weeks, 3 weeks, 1 month). We then tested α-synuclein aggregation in different brain regions. The results showed that the number of phos-α-syn immunoreactive cells increased in the dorsal vagus motor nucleus, raphe pallidus, and locus coeruleus at 3 weeks (Fig. S1c–h) and in the temporal association cortex at 3 months (Fig. S1i, j). However, there was an obvious increase in phos-α-syn-positive cells in the SN of mice administered rotenone for 2 weeks (Fig. S1a, b), a pioneer part of all the detected regions, although the midbrain is not usually supposed to be affected early in PD patients. No changes were found in the VTA (Fig. S1k, l). This led us to further investigate the events that occurred in the nigrostriatal system. We observed strong microglial activation in the SN of rotenone-treated mice, as indicated by the 31.4% increase in the number of microglia in the SN as early as 1 week (Fig. 1d, e), while microglial activation was not found in the VTA (Fig. S2a, b). Despite the absence of inflammation-related cytokine changes in the first week, the levels of CXCL1 and IL-12p70 were significantly increased in the SN of mice administered rotenone for 2 weeks and sustained until 1 month (Fig. 1f, g), although the levels of the other 8 inflammation-related factors were unchanged (Fig. S2c–j).
Fig. 1. Neuroinflammation and iron deposition prior to dopaminergic neurodegeneration in the SN of rotenone-induced PD mice model.
a, b Immunohistochemistry staining of TH in the SN of mice with rotenone administration at different time points (n = 5–6). c The rotarod test is used for the assessment of motor coordination (n = 10–13). d, e Immunohistochemistry staining of Iba-1 in the SN of mice with rotenone administration for 1 week (n = 5). Electrochemiluminescence-based Meso Scale Discovery® is used to detect the concentration of CXCL1 (f), IL-12p70 (g) in the SN of mice with rotenone administration for 1 week, 2 weeks, and 1 month (n = 5–9). Perl’s staining of iron-positive cells in the SN (h, i) and striatum (j, k) of mice with rotenone administration at different time points (n = 5–6). l–o Western blotting images and analysis of DMT1, ferritin light chain (L-ferritin), and FPN1 in the SN of mice with rotenone administration for 2 weeks (n = 5–6). (*P < 0.05, **P < 0.01, ***P < 0.001, bar = 200 μm). Two-tailed Student’s t-test was applied and data were presented as mean ± SEM.
Considering the links between neuroinflammation and iron deposition, we then tested regional iron levels using Perl’s staining. The results showed that iron deposition occurred first in the SN (Fig. 1h, i) and striatum (Fig. 1j, k) of aged mice with rotenone administration, which was observed at the end of 2 weeks and sustained until 3 months. Upregulation of iron importer-divalent metal transporter 1 (DMT1) and downregulation of iron exporter-ferroportin 1 (FPN1) were observed in this region at 2 weeks, suggesting that dysregulation of iron transporters might be involved in nigral iron deposition, which is also demonstrated by the high levels of ferritin light chain (Fig. 1l–o). The number of iron-positive cells in the lower brainstem increased later, that is, in the locus coeruleus (2 months), dorsal vagus motor nucleus (3 months), and raphe pallidus (3 months) (Fig. S3a–f). In parallel with phos-α-syn, iron deposits in the temporal association cortex were observed at the final time point we measured (3 months) (Fig. S3g, h). No iron deposition was observed in the VTA at any of the analysed time points (Fig. S3i, j). Early iron deposition in the nigrostrial system was also observed in 10-week-old C57BL/6 mice administered 30 mg·kg−1·d−1 rotenone for 1 week (Fig. S4a–d). These data suggested that microglial activation and iron deposition are early events in the SN of the rotenone-induced PD mouse model.
Microglial activation contributes to iron deposition and nigral neurodegeneration in a rotenone-induced PD mouse model
To distinguish the cell type of iron deposition, IHC staining with alkaline phosphatase and Perl’s iron staining was applied in the SN of rotenone-treated mice, and the results showed that there was limited or no overlap of iron-positive staining in TH-, GFAP- or oligo-2-immunopositive cells, suggesting that iron deposition did not appear to occur in dopaminergic neurons, astrocytes or oligodendrocytes. There were quite a few microglia (Iba-1 positive) positive for iron staining, suggesting that microglia were positive for iron deposition in the SN of mice within 2 weeks of rotenone administration (Fig. 2a).
Fig. 2. Depletion of microglia by PLX5622 prevents iron deposition and nigral neurodegeneration in rotenone-induced PD mice model.
a Perls’ staining (dark brown) of iron-positive cells together with TH, GFAP, olig2, or Iba-1 immunohistochemical staining with alkaline phosphatase (pink); Nissl’s staining (blue) in the SN. Immunohistochemistry staining of Iba-1 (red) and TH (green) (b–d), Perls’ staining of iron-positive cells (e, f) in the SN of mice with rotenone administration for 2 weeks with or without PLX5622-formulated diet. Immunofluorescence staining of Iba-1 (red) and TH (green) in the SN of mice with rotenone administration for 2 months (g–i) with or without PLX5622-formulated diet. (bar = 200 μm). Western blotting images and analysis of GPX4 (j, k) in the SN of mice with rotenone administration for 2 months with or without PLX5622-formulated diet. Changes in body weight (l) and chow intake (m) of mice are evaluated. (n = 5–6, *P < 0.05, **P < 0.01, ***P < 0.001). One-way ANOVA with Newman–Keuls multiple-comparison test was applied and data were presented as mean ± SEM.
To further explore the role of early microglial activation in nigral dopaminergic neuron damage, we took advantage of the PLX5622-formulated diet (1200 ppm) to ask whether dopaminergic neuron loss in the rotenone-induced PD mouse model could be blocked with the elimination of microglia. PLX5622 was believed to be capable of specific microglial elimination as a highly selective brain-penetrant CSF1R inhibitor [24]. As the immunofluorescence data showed, 83.4% of microglia were eliminated in the SN after 1 week of PLX5622-formulated food intake (Fig. S5). We observed that Iba-1-positive cells in the SN were dramatically less activated in rotenone-treated mice fed the PLX5622-formulated diet (Fig. 2b, c, g, h). Accordingly, iron deposition induced by intragastric administration of rotenone was fully blocked (Fig. 2e, f). Rotenone-induced loss of dopaminergic neurons in the SN was also blocked (Fig. 2b, d, g, i). The protein levels of glutathione peroxidase 4 (GPX4) were downregulated in the SN of rotenone models, consistent with iron deposition in this region. As expected, the PLX5622-formulated diet fully restored GPX4 levels (Fig. 2j, k). The daily intake of chow and the weekly weight of mice were recorded and analysed. No significant difference was found in the different groups (Fig. 2l, m). These findings show that activated microglia are required to induce iron deposition, ferroptosis, and dopaminergic neuron loss in this rotenone-induced PD model.
Altered gut microbiota induced by rotenone contributes to nigral neuroinflammation, iron deposition, and eventually dopaminergic neuron loss
ELISA data showed that the LPS content was elevated in both the faeces and serum samples (Fig. 3a, b). Rotenone levels were out of the limit both in the blood and faecal samples detected by LC‒MS/MS (Fig. S6e, f). Recently, increasing evidence has been reported that gut microbiota alteration is involved in PD pathogenesis [12, 32]. As the gastrointestinal tract is the first barrier to rotenone, we hypothesised that intragastric rotenone administration altered the gut microbiota. We first detected the content of NAD+ and NADH in the faeces, considering that rotenone is an inhibitor of mitochondrial complex I. The data showed that the ratio of NAD+/NADH in the faecal samples of mice with rotenone administration for 1 week was significantly decreased (Fig. 3c–e), indicating that rotenone efficiently inhibited the respiratory chain of gut microbiota. The microbiota diversity analysis based on 16 S rDNA sequencing showed that rotenone changed the gut microbiota significantly compared to the vehicle group (beta diversity) (Fig. 3g), although the richness of the microbiota (alpha diversity) was not affected (Fig. 3f). The Wilcoxon rank-sum test at the genus level showed that rotenone reduced the abundance of Erysipelotrichaceae and increased the abundance of Citrobacter (Fig. 3h). The LEfSe analysis (Fig. 3i) showed that a variety of bacteria belonging to the phylum Proteobacteria, including the family Enterobacteriaceae, were enriched in the colon of rotenone-treated mice. As Proteobacteria are gram-negative bacteria, the elevated content of LPS, the major component of the capsule of gram-negative bacteria, was consistent with the 16S rDNA sequencing results.
Fig. 3. Altered gut microbiota induced by rotenone contributes to microglia activation, iron deposition, and dopaminergic neuron loss in the SN of C57BL/6 mice.
ELISA data of LPS levels in the faeces (a) and serum (b) of mice with rotenone administration for 1 week (n = 5–6, *P < 0.05). c–e The colorimetric test of NAD+, NADH, and NAD/NADH in the faecal samples of mice with rotenone administration for 1 week (n = 3,4). Analysis of the sobs index of OTU level (f), β-diversity analysis (g, stress=0.095), Wilcoxon rank-sum test bar plot on genus level (h), and LEfSe analysis (i) in 16S rDNA sequencing of colon microbiota in mice with rotenone administration for 1 week (n = 5). Immunohistochemistry staining of Iba-1 (j, k), immunofluorescence of TH (l, m), and Perl’s staining of iron (n, o) in the SN of mice 2 months after faecal microbiota transplant (FMT) (n = 6–8, bar = 200 μm). Correlation analysis of the number of Iba-1 and iron-positive cells in the SN of mice 2 months after FMT (p, r = 0.42, P < 0.05); correlation analysis of the number of iron and TH-positive cells (q, r = –0.48, P < 0.05). The rotarod test (r, s), pole test (t, u) of mice with FMT for 2 months (n = 6–8). (*P < 0.05, **P < 0.01, ***P < 0.001). Two-tailed Student’s t-test, one-way ANOVA with Newman–Keuls multiple-comparison test, Pearson correlation test was applied and data were presented as mean ± SEM.
We further validated whether altered gut microbiota is sufficient to trigger lesions in the SN. We established mouse models via FMT experiments. The faecal pellets from vehicle and rotenone group mice were collected daily and transplanted. Two months after FMT, microglial activation in the SN (Fig. 3j, k), nigral dopaminergic neuron loss (Fig. 3l, m), and abnormal iron deposition in the SN (Fig. 3n, o) were observed in mice 2 months after FMT from the rotenone group; however, these effects were not observed in mice with FMT from the vehicle group. Pearson correlation analysis showed that there was a positive correlation between the number of Iba-1-positive cells and the number of iron-positive cells in the SN (Fig. 3p), while there was a negative correlation between the number of iron- and TH-positive cells (Fig. 3q). Accordingly, motor incoordination, as indicated by the decreased mean latency to fall off the rotarod and the prolonged time to turn around at the top of the pole, was found (Fig. 3r–u). No significant difference was found in weight among all groups (Fig. S6g). More importantly, FMT-induced microglial activation and iron deposition were observed as early as 2 weeks after FMT (Fig. S6a–d), indicating that altered gut microbiota from rotenone models could replicate the pathological and behavioural features induced by rotenone. Rotenone was undetected in the transplanted faecal supernatant by LC‒MS/MS (Fig. S6h), indicating that the events were unrelated to residual rotenone.
CXCL1 potently induces microglial activation, iron deposition, and ferroptosis in the SN
As CXCL1 was dramatically elevated in the SN of rotenone-induced mice (Fig. 1f), we wondered about CXCL1 levels in the blood. The ELISA data showed that the levels of CXCL1 were elevated in the serum of mice after 2 weeks of rotenone administration (Fig. 4a). This elevation was consistently observed in the serum of mice with 2 months of rotenone administration (Fig. 4b). Two months after FMT, we also found that the recipient mice (Abx+FMTrotenone group) treated with FMTrotenone showed a significant elevation of CXCL1 in the serum when compared to those treated with FMTvehicle (Abx+FMTvehicle group) (Fig. 4b). Unexpectedly, a marked elevation (up to 79.4 pg/ml, Fig. 4b) in serum CXCL1 levels was displayed in Abx-treated mice without FMT (Abx+saline group). Pearson correlation analysis showed that there was a positive correlation between the content of CXCL1 in mouse serum and the number of Iba-1-positive cells in the SN of FMT mice (Fig. 4c), while there was a negative correlation between CXCL1 levels and the number of dopaminergic neurons (Fig. 4d), suggesting that elevated CXCL1 in the serum might be a key mediator of central injury caused by altered microbiota. To investigate the effects of serum CXCL1 on the SN, we tested several events related to neuroinflammation, iron deposition, and ferroptosis after intravenous injection of CXCL1 for 3 consecutive days. CXCL1 levels in the serum after CXCL1 injection (the average was 43.2 pg/ml, Fig. 4e) were comparable to those in rotenone-induced PD model mice (the average was 59.8 pg/ml at 2 weeks and 63.3 pg/ml at 2 months). As expected, elevated CXCL1 almost replicated the pathological features observed in rotenone-induced mouse models. Microglia in the SN were significantly activated after intravenous injection of CXCL1 (Fig. 4f, g). The number of iron-positive cells was more obvious, as well as more DMT1-positive cells and fewer FPN1-positive cells (Fig. 4h–m). Accordingly, the number of GPX4-positive cells in the SN decreased significantly (Fig. 4n, o), suggesting the occurrence of ferroptosis in the SN of mice with high levels of serum CXCL1. CXCL1 administration for 3 consecutive days did not affect motor coordination or dopaminergic neuron survival (data not shown). We then established mouse models with CXCL1 administration for 14 consecutive days. As expected, CXCL1 administration for 14 consecutive days induced consistent microglial activation (Fig. 6c, d) and iron deposition in the SN (Fig. 6e, f). A loss of TH-immunopositive cells was also observed (Fig. 6g, h). HPLC analysis showed that the dopamine content in the striatum was reduced, while the dopamine metabolites DOPAC and HVA, as well as the turnover rate of dopamine, increased, suggesting inadequate dopamine release in the striatum of CXCL1-administered mice (Fig. 6i–l). Accordingly, the pole test showed that the time to turn was prolonged, suggesting that serum CXCL1 elevation was able to cause motor incoordination (Fig. 6m–o), and no difference was found in weight between CXCL1- and saline-administered mice (Fig. 6p).
Fig. 4. CXCL1 induces microglia activation, and iron deposition in the SN of C57BL/6 mice.
a ELISA data of CXCL1 levels in the serum of mice with rotenone administration for 2 weeks (n = 5, *P < 0.05, student’s t-test was applied). b ELISA data of CXCL1 levels in the serum of mice with FMT for 2 months (n = 6–8, *P < 0.05, **P < 0.01, ***P < 0.001, one-way ANOVA with Newman–Keuls multiple-comparison test was applied). Correlation analysis between the level of CXCL1 in the serum and the number of Iba-1 positive cells in the SN of mice 2 months after FMT (c, r = 0.45, *P < 0.05); correlation analysis between the level of CXCL1 in the serum and the number of TH-positive cells in the SN of mice (d, r = –0.46, *P < 0.05), Pearson correlation test was applied. e ELISA data of CXCL1 levels in the serum of mice with CXCL1 intravenous injection (20 ng·kg−1·d−1) for 3 days (n = 5, **P < 0.01, student’s t-test was applied). Immunofluorescence staining of Iba-1 (f, g), Perls’ staining of iron (h, i), immunofluorescence staining of DMT1 (j, k), immunohistochemistry staining of FPN1 (l, m) and GPX4 (n, o) in the SN of mice with CXCL1 intravenous injection (20 ng·kg−1·d−1) for 3 days (n = 5, *P < 0.05, **P < 0.01, ***P < 0.001, bar = 200 μm, Student’s t-test was applied). Data were presented as mean ± SEM.
Fig. 6. PPARγ activation rescued microglia activation, iron deposition, and nigral dopaminergic neurodegeneration in mice with CXCL1 intravenous injection.
Immunofluorescence staining of PPARγ positive cells (a, b), Iba-1 positive cells (c, d), Perls’ staining of iron (e, f) and immunofluorescence of TH (g, h) in the SN of mice with CXCL1 intravenous injection for 2 weeks with or without intragastric linoleic acid treatment (bar = 200 μm); HPLC analysis of dopamine (DA, i), 3,4-Dihydroxyphenylacetic acid (DOPAC, j), homovanillic acid (HVA, k) and dopamine turnover rate ((DOPAC + HVA)/DA, l) in the striatum; the pole test (m–o) and body weight (p) of mice with CXCL1 intravenous injection for 2 weeks with or without intragastric linoleic acid treatment. (n = 6–8, *P < 0.05, **P < 0.01, ***P < 0.001). One-way ANOVA with Newman–Keuls multiple-comparison test was applied, and data were presented as mean ± SEM.
The peroxisome proliferator-activated receptor (PPAR) signalling pathway is inhibited in rotenone-induced PD mice
To explore the pathways associated with the events in both the blood and the brain, we analysed the metabolomics of the serum and transcriptomics of the nigral tissue from mice within 2 weeks of rotenone administration. We identified the digestive system and nervous system, which contained more than ten compounds of change based on the Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analysis of metabolomics (Fig. 5a). As the volcano diagram shows, we identified 555 differentially expressed genes based on the transcriptomics of the SN, of which 304 genes were downregulated and 251 genes were upregulated (Fig. 5b). The Venn diagram demonstrated that 7 KEGG pathways were common between the transcriptome and metabolome (Fig. 5c). Further exploration of the transcriptome and metabolome data revealed that the 5 KEGG signalling pathways with the largest number of transcripts/metabolites in the 7 KEGG pathways shown in the Venn diagram were linoleic acid metabolism, retrograde endocannabinoid signalling, arachidonic acid metabolism, purine metabolism and PPAR signalling pathways (Fig. 5d). P-value analysis was performed on the above 7 pathways in both the transcriptome and metabolome and the logarithm of the P-value was used to draw a histogram for visualisation (–log10(0.05) = 1.3). The results showed that only the linoleic acid metabolism pathway showed statistical significance (–log10(0.05) > 1.3) in both the transcriptome and metabolome (Fig. 5e). Considering that linoleic acid and arachidonic acid are ligands of the PPAR pathway, we speculated that the PPAR pathway could be a key pathway involved in rotenone-induced neuronal damage. We then demonstrated a reduction in the number of PPARγ immunopositive cells in the SN of mice with rotenone administration for 2 months and in the SN of mice with FMTrotenone treatment for 2 months (Fig. 5f, h). The proportion of PPARγ-positive microglia was obviously decreased (Fig. 5f, i), as the PPARγ-positive number was decreased while the total number of microglia was increased. However, the proportion of PPARγ-positive dopaminergic neurons was unchanged (Fig. 5g, j) since both the PPARγ-positive number and total number of dopaminergic neurons were decreased. These results indicated that PPARγ signalling was predominantly inhibited in microglia. We then investigated the involvement of PPARγ in CXCL1-injected mice. Immunofluorescence showed that staining of PPARγ-positive cells was reduced in the SN of mice with consecutive intravenous injections of CXCL1 for 2 weeks, suggesting that CXCL1 could inhibit the PPAR pathway (Fig. 6a, b). These data consistently indicated that inhibition of the PPAR pathway is a pivotal event in rotenone-induced PD mice.
Fig. 5. Identification of PPARγ signalling pathway.
The serum from the mice with rotenone administration for 2 weeks was subjected to metabolomics analysis, the KEGG enrichment analysis of metabolomics (a) reveals that most changes in metabolites are related to the digestive system and nervous system. The SN was subjected to transcriptomics analysis, and the volcano map of differential genes (b) reveals that 304 genes were downregulated (green) and 251 genes were upregulated (red). Conjoint analysis was performed to analyse the most affected pathways in both transcriptome and metabolome (c–e, metabolomics was shown in orange, transcriptomics was shown in blue), and the exclusively overlapped pathway was PPAR signalling pathway (n = 5). Fisher exact test, Benjamini and Hochberg correction were applied. Immunofluorescence staining of Iba-1/TH (green) and PPARγ (red) positive cells in the SN of mice with rotenone administration for 2 months after FMT (f–j, n = 6–8, *P < 0.05, **P < 0.01, ***P < 0.001, bar = 200 μm). One-way ANOVA with Newman–Keuls multiple-comparison test was applied, and data were presented as mean ± SEM.
PPARγ activation rescued microglial activation, iron deposition, and nigral dopaminergic neurodegeneration in mice intravenously injected with CXCL1
The ligand of PPAR, linolenic acid, was applied to further explore the possible role of the PPAR pathway in dopaminergic neurodegeneration. Linolenic acid (60 mg·kg−1·d−1) was preadministered for 1 week to activate the PPAR signalling pathway, and intragastric administration continued during the period of consecutive intravenous injection of CXCL1 for 2 weeks. The results of the number of PPARγ immune-positive cells in the SN of mice showed that linoleic acid reversed the inhibition of the PPAR pathway induced by CXCL1 (Fig. 6a, b). As predicted, LA also blocked microglial activation (Fig. 6c, d), iron deposition (Fig. 6e, f), and dopaminergic neuron loss (Fig. 6g, h) induced by CXCL1 in the SN. As the HPLC results showed, linoleic acid also blocked the changes in DA, DOPAC, HVA, and the turnover rate of dopamine induced by CXCL1 in the Str (Fig. 6i–l). The results of the pole test correspondingly showed that LA effectively reversed the decreased motor coordination induced by CXCL1 (Fig. 6m–o). Linoleic acid had no effect on mouse weight (Fig. 6p).
Discussion
Here, we investigated for the first time the spatial and temporal distribution of iron deposition and α-syn pathology in various brain regions in a rotenone-induced PD mouse model. To our knowledge, this is the first report using aged (12-month) mice to mimic the neurotoxicity of rotenone. Notably, neuroinflammation first occurred in the SN-Str system along with iron deposition prior to the loss of dopaminergic neurons. We found that the altered gut microbiota in rotenone models was responsible for inducing these pathological features via the proinflammatory cytokine CXCL1. Finally, we identified the PPAR signalling pathway as a credible therapeutic target for PD.
As a coexisting factor with α-syn in LBs, iron staining was most pronounced in the LB cores of the remaining dopaminergic neurons of the SNpc [33]. Excessive iron in the SN, coupled with dopamine, could produce hydroxyl radicals through the Fenton reaction, leading to the peroxidation of membrane lipids, DNA damage, and α-syn aggregation, as well as the newly identified iron-dependent ferroptosis cell death pathway, eventually leading to neuronal damage [34–37]. More recently, iron deposits were detected in the SN by quantitative susceptibility mapping in idiopathic rapid eye movement sleep behaviour disorder, which is a prodromal stage of PD [38]. However, how iron deposition is distributed in specific brain regions of PD mouse models has not been investigated. Here, we showed that α-syn pathology (as indicated by phos-α-syn) starts in the lower brainstem and progresses into the central nervous system, similar to the regional distribution described in Braak staging. We observed earlier iron deposition at 2 weeks, at least no later than the occurrence of phos-α-syn in the SN. This phenomenon was validated in 10-week-old mice with acute rotenone administration for 2 weeks. The results above support the notion that early nigral iron deposition might be an important and early event in rotenone-induced PD.
Although there is substantial evidence suggesting that iron changes in the SN are a potential biomarker for early-stage PD [39, 40], why iron was elevated first in the SN is unclear. More abundant in the SN than in other brain regions, microglia are closely related to neuroinflammation, which leads to the region-specific susceptibility of neurons [41, 42]. We observed quite early microglial activation (as early as 1 week after rotenone administration) before iron deposition (2 weeks after rotenone administration) in the SN. Our laboratory previously reported that activation of microglia by LPS or the neurotoxin MPP+ could be aggravated by intracellular iron overload, as indicated by an enhanced release of IL-1β and TNF-α. These proinflammatory cytokines are then able to exacerbate neuronal iron accumulation via iron transporter modulation [43]. Microglia preferentially acquire iron, as reported both in vitro [44] and in vivo [45], thus reinforcing the vicious cycle between activated microglia and iron deposits [46, 47]. We demonstrated that microglia were positive for iron deposition, and more strikingly, eliminating microglia by a PLX5622-formulated diet in rotenone models was able to fully abolish nigral iron accumulation. Accordingly, microglia removal fully blocked ferroptosis and the loss of dopaminergic neurons. Therefore, an important role of microglial activation and neuroinflammation may be related to the ability to induce iron deposition and damage to neuronal survival in the SN of rotenone models.
Different from other systematic administration models, the mouse model with low-dose intragastric administration of rotenone was a gastrointestinal local irritation model [19]. The entry of rotenone into circulation (as shown in this study by LC‒MS/MS) and the possible effects of its metabolites were not necessarily considered [48]. Therefore, the question is how neuroinflammation in the SN could arise by systemically administered rotenone. The gut microbiome is believed to be perturbed by environmental and genetic factors and participates in the development of inflammatory disease [49]. Since the “brain-gut-enteric microbiota axis” was first proposed in 2009 [50], the influence of gut microbiota on central immunity has been widely studied. There is evidence supporting the role of the gut microbiome in the pathogenesis of Alzheimer’s disease with a focus on neuroinflammation [51]. In PD, alterations in the human microbiome were thought to represent risk factors for PD and were further supported by a recent report using metagenome-wide association studies [9, 52, 53]. Here, the faeces and colon samples of mice showed that rotenone disturbed gut microbiome homoeostasis by blocking the respiratory chain of intestinal flora, with an increase in the abundance of Proteobacteria, including Enterobacteriaceae, consistent with those displayed in PD patients [7]. Subsequent FMT experiments proved that rotenone-induced disturbance of intestinal bacteria caused a series of PD-like pathologies, including microglial activation, iron deposition, damage to dopaminergic neurons in the SN, and associated motor disorders in mice. To interpret the unexpected results of the marked elevation of serum CXCL1 in the Abx+saline group, the status of the gut microbiota after antibiotic treatment needs to be discussed. The effect of antibiotics on the gut microbiota is a double-edged sword [54, 55]. More importantly, the altered gut microbiota cannot spontaneously recover to pretreatment levels without autologous FMT after antibiotic treatment [56]. Our data suggested that gut microbiota homoeostasis was completely recovered in the Abx+FMTvehicle group, as indicated by the elevation of serum CXCL1 being fully restored. Serum CXCL1 in the Abx+FMTrotenone group was also lower than that in the Abx+saline group, suggesting that gut microbiota homoeostasis was partially recovered even when the transplanted faecal supernatant was from the rotenone group. Therefore, we speculated that gut microbiota homoeostasis could be severely disrupted during antibiotic therapy, indicating the necessity of maintaining microbiota homoeostasis.
To further explore the molecular mechanism of inflammation from the peripheral to the central nervous system, we examined the proinflammatory cytokines involved in rotenone-induced neurotoxicity. In PD patients, IL-8 (CXCL1) in the CSF and circulating levels were increased, and the IL-8 level in the CSF correlated with disease severity (Hoehn & Yahr) [57, 58]. CXCL1, also called KC/GRO in rodents and IL-8-related protein in humans, is a proinflammatory cytokine mediating the infiltration of neutrophils and monocytes or macrophages. We observed CXCL1 elevation in the serum and the SN, while a much more dramatic upregulation was observed in the serum. However, elevated CXCL1 in the SN could hardly come from the blood, considering the difficulty of CXCL1 to cross the BBB. More recently, it was reported that CXCL1 expression was not colocalized with Iba-1 but was colocalized with GFAP [59], although microglia were reported to robustly express cytokines and chemokines [60]. Therefore, we suppose that the relatively small changes in CXCL1 levels in the SN occurred along with microglial activation and were not necessarily the primary causes of microglial activation. This is further supported by the fact that microglial activation occurred at 1 week with rotenone administration, while CXCL1 levels were slightly elevated at 2 weeks. We believe that the elevation of CXCL1 levels in serum contributes to microglial activation and subsequent dopaminergic cell loss. As our results showed that the CXCL1 concentration in serum, rather than that in the SN, was positively correlated with Iba-1-positive microglia in the SN. The present findings suggest that CXCL1 in serum is worth further investigation, although CXCL1 in the SN was also slightly elevated. Furthermore, our results are the first to show that CXCL1 administered intravenously (at a dosage comparable to that in the serum of the rotenone model) mimics almost all the pathological features and manifestations in rotenone-treated mice, including but not limited to microglial activation, iron deposition, ferroptosis, dopaminergic neuron loss, and impaired motor coordination.
Combined analysis of the metabolomics of the serum and transcriptomics of the nigral tissue of rotenone-administered mice identified the PPAR signalling pathway. The PPAR signalling pathway is a lipid metabolic pathway associated with ferroptosis and inflammation, as well as neuroprotection [61, 62]. PPARα agonists have been reported to induce autophagy and reverse memory deficits and anxiety symptoms in mouse models of Alzheimer’s disease [63]. PPARγ activation inhibited ferroptosis through interaction with the Nrf2 pathway and promoted the recovery of neural function after intracerebral haemorrhage [64]. We were interested in PPARγ, one of the three subtypes of PPAR (α, β/δ, γ), since PPARγ was consistently reported to be associated with anti-inflammatory action [62, 65–67]. In the present study, a significant loss of PPARγ-positive cells was found in the SN of rotenone models, FMT models, and CXCL1-injected models, suggesting that PPARγ signalling was inhibited. Furthermore, we demonstrated that the proportion of PPARγ-positive dopaminergic neurons was unchanged since both the PPARγ-positive number and total number of dopaminergic neurons were decreased. However, the proportion of PPARγ-positive microglia was obviously decreased, as the PPARγ-positive number was decreased while the total number of microglia was increased. The results indicated that PPARγ signalling was predominantly inhibited in microglia. We then observed that the activation of the PPAR signalling pathway by linoleic acid could effectively block CXCL1-mediated injuries in the SN. Overall, the PPAR pathway is the key pathway involved in PD-like damage caused by CXCL1.
Overall, our study, based on an intragastric rotenone-administered chronic mouse model of PD, links a sequential order of gut microbiota disturbance: systemic inflammation (CXCL1 elevation in the serum), PPARγ signalling inhibition and neuroinflammation (microglia activation), brain iron deposition (as well as ferroptosis), and eventually dopaminergic neurodegeneration in the SN (Graphical abstract). We explored the potentially critical role of CXCL1 in PD and demonstrated that intragastric LA successfully abrogated neuronal damage induced by CXCL1. These findings may pave the way for further understanding the “brain-gut-microbiota” molecular regulatory networks and have potential implications for the prevention and treatment of PD.
Supplementary information
Acknowledgements
This work was supported by grants from the National Natural Science Foundation of China (32170984, 31871049), the Excellent Innovative Team of Shandong Province and the Taishan Scholars Construction Project, and the Natural Science Foundation of Shandong Province (ZR2023QH110, ZR2020YQ23, and ZR2021MC116).
Author contributions
XZM performed experiments and composed the first draft, NS guided the experiment, polished, and finalised the article, JW and LLC guided the experiment, LQ and HL performed experiments, JXX conceived and directed the project. All authors read and approved the final manuscript.
Data availability
The data that support the findings of this study are available from the corresponding authors upon reasonable request.
Materials availability
The materials that support the findings of this study are available from the corresponding authors upon reasonable request.
Competing interests
The authors declare no competing interests.
Ethics approval and consent to participate
The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Ethics Committee of the Medical College of Qingdao University (QDU-AEC-2022116, March 1, 2022).
Contributor Information
Ning Song, Email: ningsong@qdu.edu.cn.
Jun-xia Xie, Email: jxiaxie@public.qd.sd.cn.
Supplementary information
The online version contains supplementary material available at 10.1038/s41401-023-01147-x.
References
- 1.Deng H, Wang P, Jankovic J. The genetics of Parkinson disease. Ageing Res Rev. 2018;42:72–85. doi: 10.1016/j.arr.2017.12.007. [DOI] [PubMed] [Google Scholar]
- 2.Marras C, Canning CG, Goldman SM. Environment, lifestyle, and Parkinson’s disease: implications for prevention in the next decade. Mov Disord. 2019;34:801–11. doi: 10.1002/mds.27720. [DOI] [PubMed] [Google Scholar]
- 3.Mattson MP, Arumugam TV. Hallmarks of brain aging: adaptive and pathological modification by metabolic states. Cell Metab. 2018;27:1176–99. doi: 10.1016/j.cmet.2018.05.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Challis C, Hori A, Sampson TR, Yoo BB, Challis RC, Hamilton AM, et al. Gut-seeded alpha-synuclein fibrils promote gut dysfunction and brain pathology specifically in aged mice. Nat Neurosci. 2020;23:327–36. doi: 10.1038/s41593-020-0589-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Singh A, Dawson TM, Kulkarni S. Neurodegenerative disorders and gut-brain interactions. J Clin Invest. 2021;131:e143775. doi: 10.1172/JCI143775. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Willyard C. How gut microbes could drive brain disorders. Nature. 2021;590:22–5. doi: 10.1038/d41586-021-00260-3. [DOI] [PubMed] [Google Scholar]
- 7.Unger MM, Spiegel J, Dillmann KU, Grundmann D, Philippeit H, Burmann J, et al. Short chain fatty acids and gut microbiota differ between patients with Parkinson’s disease and age-matched controls. Parkinsonism Relat Disord. 2016;32:66–72. doi: 10.1016/j.parkreldis.2016.08.019. [DOI] [PubMed] [Google Scholar]
- 8.Li W, Wu X, Hu X, Wang T, Liang S, Duan Y, et al. Structural changes of gut microbiota in Parkinson’s disease and its correlation with clinical features. Sci China Life Sci. 2017;60:1223–33. doi: 10.1007/s11427-016-9001-4. [DOI] [PubMed] [Google Scholar]
- 9.Sampson TR, Debelius JW, Thron T, Janssen S, Shastri GG, Ilhan ZE, et al. Gut microbiota regulate motor deficits and neuroinflammation in a model of Parkinson’s disease. Cell. 2016;167:1469–80.e1412. doi: 10.1016/j.cell.2016.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lin CH, Chen CC, Chiang HL, Liou JM, Chang CM, Lu TP, et al. Altered gut microbiota and inflammatory cytokine responses in patients with Parkinson’s disease. J Neuroinflammation. 2019;16:129. doi: 10.1186/s12974-019-1528-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Aho VTE, Houser MC, Pereira PAB, Chang J, Rudi K, Paulin L, et al. Relationships of gut microbiota, short-chain fatty acids, inflammation, and the gut barrier in Parkinson’s disease. Mol Neurodegener. 2021;16:6. doi: 10.1186/s13024-021-00427-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhao Z, Ning J, Bao XQ, Shang M, Ma J, Li G, et al. Fecal microbiota transplantation protects rotenone-induced Parkinson’s disease mice via suppressing inflammation mediated by the lipopolysaccharide-TLR4 signaling pathway through the microbiota-gut-brain axis. Microbiome. 2021;9:226. doi: 10.1186/s40168-021-01107-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.De Filippo K, Dudeck A, Hasenberg M, Nye E, van Rooijen N, Hartmann K, et al. Mast cell and macrophage chemokines CXCL1/CXCL2 control the early stage of neutrophil recruitment during tissue inflammation. Blood. 2013;121:4930–7. doi: 10.1182/blood-2013-02-486217. [DOI] [PubMed] [Google Scholar]
- 14.Farmen K, Nissen SK, Stokholm MG, Iranzo A, Ostergaard K, Serradell M, et al. Monocyte markers correlate with immune and neuronal brain changes in REM sleep behavior disorder. Proc Natl Acad Sci USA. 2021;118:e2020858118. doi: 10.1073/pnas.2020858118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.De Francesco E, Terzaghi M, Storelli E, Magistrelli L, Comi C, Legnaro M, et al. CD4+ T-cell transcription factors in idiopathic REM sleep behavior disorder and Parkinson’s disease. Mov Disord. 2021;36:225–9. doi: 10.1002/mds.28137. [DOI] [PubMed] [Google Scholar]
- 16.Zhang H, Wang T, Li Y, Mao W, Hao S, Huang Z, et al. Plasma immune markers in an idiopathic REM sleep behavior disorder cohort. Parkinsonism Relat Disord. 2020;78:145–50. doi: 10.1016/j.parkreldis.2020.07.017. [DOI] [PubMed] [Google Scholar]
- 17.Terkelsen MH, Klaestrup IH, Hvingelby V, Lauritsen J, Pavese N, Romero-Ramos M. Neuroinflammation and immune changes in prodromal Parkinson’s disease and other synucleinopathies. J Parkinsons Dis. 2022;12:S149–63. doi: 10.3233/JPD-223245. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bhattarai Y, Si J, Pu M, Ross OA, McLean PJ, Till L, et al. Role of gut microbiota in regulating gastrointestinal dysfunction and motor symptoms in a mouse model of Parkinson’s disease. Gut Microbes. 2021;13:1866974. doi: 10.1080/19490976.2020.1866974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Pan-Montojo F, Anichtchik O, Dening Y, Knels L, Pursche S, Jung R, et al. Progression of Parkinson’s disease pathology is reproduced by intragastric administration of rotenone in mice. PLoS One. 2010;5:e8762. doi: 10.1371/journal.pone.0008762. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Thirugnanam T, Santhakumar K. Chemically induced models of Parkinson’s disease. Comp Biochem Physiol C Toxicol Pharmacol. 2022;252:109213. doi: 10.1016/j.cbpc.2021.109213. [DOI] [PubMed] [Google Scholar]
- 21.Johnson ME, Bobrovskaya L. An update on the rotenone models of Parkinson’s disease: their ability to reproduce the features of clinical disease and model gene-environment interactions. Neurotoxicology. 2015;46:101–16. doi: 10.1016/j.neuro.2014.12.002. [DOI] [PubMed] [Google Scholar]
- 22.Taguchi T, Ikuno M, Yamakado H, Takahashi R. Animal model for prodromal Parkinson’s disease. Int J Mol Sci. 2020;21:1961. doi: 10.3390/ijms21061961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wang N, Liu W, Zheng Y, Wang S, Yang B, Li M, et al. CXCL1 derived from tumor-associated macrophages promotes breast cancer metastasis via activating NF-kappaB/SOX4 signaling. Cell Death Dis. 2018;9:880. doi: 10.1038/s41419-018-0876-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Huang Y, Xu Z, Xiong S, Sun F, Qin G, Hu G, et al. Repopulated microglia are solely derived from the proliferation of residual microglia after acute depletion. Nat Neurosci. 2018;21:530–40. doi: 10.1038/s41593-018-0090-8. [DOI] [PubMed] [Google Scholar]
- 25.Spangenberg E, Severson PL, Hohsfield LA, Crapser J, Zhang J, Burton EA, et al. Sustained microglial depletion with CSF1R inhibitor impairs parenchymal plaque development in an Alzheimer’s disease model. Nat Commun. 2019;10:3758. doi: 10.1038/s41467-019-11674-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Schuijt TJ, Lankelma JM, Scicluna BP, de Sousa e Melo F, Roelofs JJ, de Boer JD, et al. The gut microbiota plays a protective role in the host defence against pneumococcal pneumonia. Gut. 2016;65:575–83. doi: 10.1136/gutjnl-2015-309728. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zheng X, Zhao A, Xie G, Chi Y, Zhao L, Li H, et al. Melamine-induced renal toxicity is mediated by the gut microbiota. Sci Transl Med. 2013;5:172ra122. doi: 10.1126/scitranslmed.3005114. [DOI] [PubMed] [Google Scholar]
- 28.Ali W, Ikram M, Park HY, Jo MG, Ullah R, Ahmad S, et al. Oral administration of alpha linoleic acid rescues abeta-induced glia-mediated neuroinflammation and cognitive dysfunction in C57BL/6N mice. Cells. 2020;9:667. doi: 10.3390/cells9030667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Matias M, Silvestre S, Falcao A, Alves G. Considerations and pitfalls in selecting the drug vehicles for evaluation of new drug candidates: focus on in vivo pharmaco-toxicological assays based on the rotarod performance test. J Pharm Pharm Sci. 2018;21:110–8. doi: 10.18433/jpps29656. [DOI] [PubMed] [Google Scholar]
- 30.Zhang QS, Heng Y, Mou Z, Huang JY, Yuan YH, Chen NH. Reassessment of subacute MPTP-treated mice as animal model of Parkinson’s disease. Acta Pharmacol Sin. 2017;38:1317–28. doi: 10.1038/aps.2017.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wang Z, Zeng YN, Yang P, Jin LQ, Xiong WC, Zhu MZ, et al. Axonal iron transport in the brain modulates anxiety-related behaviors. Nat Chem Biol. 2019;15:1214–22. doi: 10.1038/s41589-019-0371-x. [DOI] [PubMed] [Google Scholar]
- 32.Fung TC, Olson CA, Hsiao EY. Interactions between the microbiota, immune and nervous systems in health and disease. Nat Neurosci. 2017;20:145–55. doi: 10.1038/nn.4476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Castellani RJ, Siedlak SL, Perry G, Smith MA. Sequestration of iron by Lewy bodies in Parkinson’s disease. Acta Neuropathol. 2000;100:111–4. doi: 10.1007/s004010050001. [DOI] [PubMed] [Google Scholar]
- 34.Hare DJ, Double KL. Iron and dopamine: a toxic couple. Brain. 2016;139:1026–35. doi: 10.1093/brain/aww022. [DOI] [PubMed] [Google Scholar]
- 35.Xu YY, Wan WP, Zhao S, Ma ZG. L-type calcium channels are involved in iron-induced neurotoxicity in primary cultured ventral mesencephalon neurons of rats. Neurosci Bull. 2020;36:165–73. doi: 10.1007/s12264-019-00424-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Abeyawardhane DL, Lucas HR. Iron redox chemistry and implications in the Parkinson’s disease brain. Oxid Med Cell Longev. 2019;2019:4609702. doi: 10.1155/2019/4609702. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Guiney SJ, Adlard PA, Bush AI, Finkelstein DI, Ayton S. Ferroptosis and cell death mechanisms in Parkinson’s disease. Neurochem Int. 2017;104:34–48. doi: 10.1016/j.neuint.2017.01.004. [DOI] [PubMed] [Google Scholar]
- 38.Sun J, Lai Z, Ma J, Gao L, Chen M, Chen J, et al. Quantitative evaluation of iron content in idiopathic rapid eye movement sleep behavior disorder. Mov Disord. 2020;35:478–85. doi: 10.1002/mds.27929. [DOI] [PubMed] [Google Scholar]
- 39.Rong Y, Xu Z, Zhu Y, Zhang X, Lai L, Sun S, et al. Combination of quantitative susceptibility mapping and diffusion Kurtosis imaging provides potential biomarkers for early-stage Parkinson’s disease. ACS Chem Neurosci. 2022;13:2699–708. doi: 10.1021/acschemneuro.2c00321. [DOI] [PubMed] [Google Scholar]
- 40.He N, Chen Y, LeWitt PA, Yan F, Haacke EM. Application of neuromelanin MR imaging in Parkinson disease. J Magn Reson Imaging. 2022;57:337–52. doi: 10.1002/jmri.28414. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Kim WG, Mohney RP, Wilson B, Jeohn GH, Liu B, Hong JS. Regional difference in susceptibility to lipopolysaccharide-induced neurotoxicity in the rat brain: role of microglia. J Neurosci. 2000;20:6309–16. doi: 10.1523/JNEUROSCI.20-16-06309.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Qian ZM, Ke Y. Brain iron transport. Biol Rev Camb Philos Soc. 2019;94:1672–84. doi: 10.1111/brv.12521. [DOI] [PubMed] [Google Scholar]
- 43.Wang J, Song N, Jiang H, Wang J, Xie J. Pro-inflammatory cytokines modulate iron regulatory protein 1 expression and iron transportation through reactive oxygen/nitrogen species production in ventral mesencephalic neurons. Biochim Biophys Acta. 2013;1832:618–25. doi: 10.1016/j.bbadis.2013.01.021. [DOI] [PubMed] [Google Scholar]
- 44.McCarthy RC, Sosa JC, Gardeck AM, Baez AS, Lee CH, Wessling-Resnick M. Inflammation-induced iron transport and metabolism by brain microglia. J Biol Chem. 2018;293:7853–63. doi: 10.1074/jbc.RA118.001949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Guo JJ, Yue F, Song DY, Bousset L, Liang X, Tang J, et al. Intranasal administration of alpha-synuclein preformed fibrils triggers microglial iron deposition in the substantia nigra of Macaca fascicularis. Cell Death Dis. 2021;12:81. doi: 10.1038/s41419-020-03369-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Rathnasamy G, Ling EA, Kaur C. Consequences of iron accumulation in microglia and its implications in neuropathological conditions. CNS Neurol Disord Drug Targets. 2013;12:785–98. doi: 10.2174/18715273113126660169. [DOI] [PubMed] [Google Scholar]
- 47.Song N, Wang J, Jiang H, Xie J. Astroglial and microglial contributions to iron metabolism disturbance in Parkinson’s disease. Biochim Biophys Acta Mol Basis Dis. 2018;1864:967–73. doi: 10.1016/j.bbadis.2018.01.008. [DOI] [PubMed] [Google Scholar]
- 48.Caboni P, Sherer TB, Zhang N, Taylor G, Na HM, Greenamyre JT, et al. Rotenone, deguelin, their metabolites, and the rat model of Parkinson’s disease. Chem Res Toxicol. 2004;17:1540–8. doi: 10.1021/tx049867r. [DOI] [PubMed] [Google Scholar]
- 49.Pickard JM, Zeng MY, Caruso R, Nunez G. Gut microbiota: Role in pathogen colonization, immune responses, and inflammatory disease. Immunol Rev. 2017;279:70–89. doi: 10.1111/imr.12567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Rhee SH, Pothoulakis C, Mayer EA. Principles and clinical implications of the brain-gut-enteric microbiota axis. Nat Rev Gastroenterol Hepatol. 2009;6:306–14. doi: 10.1038/nrgastro.2009.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Bairamian D, Sha S, Rolhion N, Sokol H, Dorothee G, Lemere CA, et al. Microbiota in neuroinflammation and synaptic dysfunction: a focus on Alzheimer’s disease. Mol Neurodegener. 2022;17:19. doi: 10.1186/s13024-022-00522-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Wallen ZD, Demirkan A, Twa G, Cohen G, Dean MN, Standaert DG, et al. Metagenomics of Parkinson’s disease implicates the gut microbiome in multiple disease mechanisms. Nat Commun. 2022;13:6958. doi: 10.1038/s41467-022-34667-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Zhu X, Li B, Lou P, Dai T, Chen Y, Zhuge A, et al. The relationship between the gut microbiome and neurodegenerative diseases. Neurosci Bull. 2021;37:1510–22. doi: 10.1007/s12264-021-00730-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Ianiro G, Tilg H, Gasbarrini A. Antibiotics as deep modulators of gut microbiota: between good and evil. Gut. 2016;65:1906–15. doi: 10.1136/gutjnl-2016-312297. [DOI] [PubMed] [Google Scholar]
- 55.Ramirez J, Guarner F, Bustos Fernandez L, Maruy A, Sdepanian VL, Cohen H. Antibiotics as major disruptors of gut microbiota. Front Cell Infect Microbiol. 2020;10:572912. doi: 10.3389/fcimb.2020.572912. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Suez J, Zmora N, Zilberman-Schapira G, Mor U, Dori-Bachash M, Bashiardes S, et al. Post-antibiotic gut mucosal microbiome reconstitution is impaired by probiotics and improved by autologous FMT. Cell. 2018;174:1406–23.e1416. doi: 10.1016/j.cell.2018.08.047. [DOI] [PubMed] [Google Scholar]
- 57.Hall S, Janelidze S, Surova Y, Widner H, Zetterberg H, Hansson O. Cerebrospinal fluid concentrations of inflammatory markers in Parkinson’s disease and atypical parkinsonian disorders. Sci Rep. 2018;8:13276. doi: 10.1038/s41598-018-31517-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Calvani R, Picca A, Landi G, Marini F, Biancolillo A, Coelho-Junior HJ, et al. A novel multi-marker discovery approach identifies new serum biomarkers for Parkinson’s disease in older people: an EXosomes in PArkiNson Disease (EXPAND) ancillary study. Geroscience. 2020;42:1323–34. doi: 10.1007/s11357-020-00192-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Huang X, Guo M, Zhang Y, Xie J, Huang R, Zuo Z, et al. Microglial IL-1RA ameliorates brain injury after ischemic stroke by inhibiting astrocytic CXCL1-mediated neutrophil recruitment and microvessel occlusion. Glia. 2023;71:1607–25. doi: 10.1002/glia.24359. [DOI] [PubMed] [Google Scholar]
- 60.Ransohoff RM. A polarizing question: do M1 and M2 microglia exist? Nat Neurosci. 2016;19:987–91. doi: 10.1038/nn.4338. [DOI] [PubMed] [Google Scholar]
- 61.Liang H, Tang T, Huang H, Li T, Gao C, Han Y, et al. Peroxisome proliferator-activated receptor-gamma ameliorates neuronal ferroptosis after traumatic brain injury in mice by inhibiting cyclooxygenase-2. Exp Neurol. 2022;354:114100. doi: 10.1016/j.expneurol.2022.114100. [DOI] [PubMed] [Google Scholar]
- 62.Machado MMF, Bassani TB, Coppola-Segovia V, Moura ELR, Zanata SM, Andreatini R, et al. PPAR-gamma agonist pioglitazone reduces microglial proliferation and NF-kappaB activation in the substantia nigra in the 6-hydroxydopamine model of Parkinson’s disease. Pharmacol Rep. 2019;71:556–64. doi: 10.1016/j.pharep.2018.11.005. [DOI] [PubMed] [Google Scholar]
- 63.Luo R, Su LY, Li G, Yang J, Liu Q, Yang LX, et al. Activation of PPARA-mediated autophagy reduces Alzheimer disease-like pathology and cognitive decline in a murine model. Autophagy. 2020;16:52–69. doi: 10.1080/15548627.2019.1596488. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Duan C, Jiao D, Wang H, Wu Q, Men W, Yan H, et al. Activation of the PPARgamma prevents ferroptosis-induced neuronal loss in response to intracerebral hemorrhage through synergistic actions with the Nrf2. Front Pharmacol. 2022;13:869300. doi: 10.3389/fphar.2022.869300. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Vetuschi A, Pompili S, Gaudio E, Latella G, Sferra R. PPAR-gamma with its anti-inflammatory and anti-fibrotic action could be an effective therapeutic target in IBD. Eur Rev Med Pharmacol Sci. 2018;22:8839–48. doi: 10.26355/eurrev_201812_16652. [DOI] [PubMed] [Google Scholar]
- 66.Luo W, Xu Q, Wang Q, Wu H, Hua J. Effect of modulation of PPAR-gamma activity on Kupffer cells M1/M2 polarization in the development of non-alcoholic fatty liver disease. Sci Rep. 2017;7:44612. doi: 10.1038/srep44612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Marion-Letellier R, Savoye G, Ghosh S. Fatty acids, eicosanoids and PPAR gamma. Eur J Pharmacol. 2016;785:44–9. doi: 10.1016/j.ejphar.2015.11.004. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data that support the findings of this study are available from the corresponding authors upon reasonable request.
The materials that support the findings of this study are available from the corresponding authors upon reasonable request.






