Sequence Analysis of Tn10 Insertion Sites in a Collection of Escherichia coli Strains Used for Genetic Mapping and Strain Construction

Abstract

The chromosomal insertion sites of Tn10-containing Escherichia coli strains were amplified by inverse PCR, and the nucleotide sequences of the junctions were determined. In 95 strains analyzed, 88 unique Tn10 positions were determined and matched to the E. coli chromosome sequence. Two gaps in insertion site positions were noted, one including the terminus of DNA replication and another bounded by recombination hot spots RhsA and RhsB.

A collection of Escherichia coli strains with Tn10 insertions located at approximately 1-min intervals around the chromosome was reported in 1989 (12) and has been used in many laboratories for strain construction and genetic mapping. The versatility of this collection of strains is based on its regularity of map positions around the chromosome and its combination of Tn10 and positionally equivalent Tn10kan members. To clarify an occasional inconsistency in map position in certain members of the collection in our laboratory, we developed an inverse PCR scheme to allow determination of the precise positions of the Tn10 insertion sites by DNA sequence analysis. We have determined the nucleotide positions of nearly all of the Tn10 insertion sites in the collection of strains originally reported by Singer et al. (12) and subsequently catalogued by Berlyn et al. (2).

Strains used in this study were obtained either from the Carol Gross laboratory or from the E. coli Genetic Stock Center. DNA preparations were done by a modification of standard methods (10, 13). Cells from 5 ml of an overnight culture grown in Luria broth-tetracycline (10 μg/ml) were harvested by centrifugation and resuspended in 2.5 ml of lysis solution (25 mM Tris-HCl [pH 7.4], 50 mM glucose, 10 mM EDTA, 2-μg/ml lysozyme). Cells were lysed by the addition of 0.25 ml of 10% sodium dodecyl sulfate, and DNA was extracted once with an equal volume of phenol saturated with 0.3 M sodium acetate (NaOAc). The aqueous phase was retained and made 0.3 M in NaOAc by addition of 0.1 volume of 3 M NaOAc, and DNA was precipitated by addition of 2.5 volumes of ethanol. The precipitate was transferred to 0.5 ml of 70% ethanol by using a Pasteur pipette. Following a brief centrifugation (30 s at 13,000 × g), the supernatant was removed and the DNA was resuspended in 0.25 ml of 10 mM Tris-HCl (pH 7.4)–0.1 mM EDTA. Chromosomal DNA was digested with HpaII and circularized with DNA ligase preparatory to inverse PCR (8).

Inverse PCR was performed as described by Ochman et al. (8) by using Platinum Taq DNA Polymerase (Life Technologies). The PCR primers (Integrated DNA Technologies) were designed from the Tn10 sequence (5, 7, 9, 11) and are illustrated in Fig. 1. The product of the first PCR using primers 1 and 2 was diluted 1/10, and 1 μl was used as the template for a second round of PCR using primers 3 and 4. The sequences of the primers were as follows: primer 1, ACATGAAGGTCATCGATAGCAGGA; primer 2, GGCTGTTGAGTTGAGGTTGACGAA; primer 3, AACAGTAATGGGCCAATAACACCG; primer 4, CGAGTTCGCACATCTTGTTGTCTG.

FIG. 1.

Map of a portion of Tn10 including tetA and IS10R. Open reading frames (orfs) are indicated, as are the positions of the PCR primers (pris) used in this study. The single HpaII site in this region is also shown.

PCR products were sequenced by using a PCR sequencing kit (Amersham). The sequencing primer was a 19-mer situated at positions −62 to −53 relative to the end of IS10R. Twenty- to 40-nucleotide-long sequences at the junction of IS10R were determined, and the positions were identified by a BLAST search (1) of the E. coli genome sequence (3).

Of 95 strains analyzed, 88 yielded sufficient sequences for confident definition of positions on the E. coli chromosome (Table 1 and Fig. 2). Two strains (CAG18463 and CAG12099) yielded short sequences that occurred twice in the genome sequence, once within 0.5 min of the reported map position and once distant. The site near the reported map position was taken as the site of insertion for these strains. The sequence derived from the junction of CAG18491 was very short, but inspection of the sequence near metE showed only two identities, one in the metR-metE intergenic region and one downstream from the metE coding region. We presumed that the intergenic insertion was more likely to yield a metE phenotype and placed the insertion site at that position. One additional sequence (from CAG18429 zjh-6::Tn10) was too short for unambiguous assignment, and no phenotype was available to assist in placement. The remaining five strains yielded sequences identical to others in the collection. These duplicate strains were CAG12074 = CAG18465, CAG12159 = CAG18459 = CAG12151, CAG18483 = CAG12080, CAG18498 = CAG18499, and CAG18709 = CAG18456. Each duplicate sequence was confirmed by analysis of strains obtained from the E. coli Genetic Stock Center.

TABLE 1.

Locations of Tn10 insertion sites

Strain	Genotypea	Map position (min)		Nucleotide position	Dd	Gene	Accession no.	Position (bp)	Flanking sequence
		Reportedb	Calculatedc
CAG18442	thr-34::Tn10	0.0	0.0	425	<	thrA	AE000111	425	TGCCTGGCATTGCTTTCCAG
CAG12093	car-96::Tn10	0.7	0.7	33,963	<	carB	AE000113	13,304	GGCAAAGCCGCCGTTGAGGG
CAG12095	zab-3051::Tn10	1.9	1.8	84,350	<	leuO	AE000118	805	CACTTAACTCCCTTTCCCTT
CAG12025	zad-220::Tn10	3.2	3.2	150,100	>	yadC	AE000123	472	GGTGAAGCGCCATTTTTAAT
CAG18436	zae-502::Tn10	4.4	5.0	230,099	>	yafC	AE000129	10,075	CACTTTATCTGCCATTAACT
CAG18447	proAB81::Tn10	5.7	5.6	261,286	>	proA	AE000132	8,002	TGCTGCGTATGGATAAATAC
CAG18439	lacI42::Tn10	7.9	7.9	365,945	>	lacI	AE000141	9,129	CGCGCAGCCCGG
CAG12080	zah-281::Tn10	7.5	8.0	371,180	>	b0349	AE000142	3,414	CGCTTTGTGCCGATGGATGC
CAG18091	zaj-3053::Tn10	9.0	8.5	393,633	>	b0374	AE000144	4,231	TACCTGGTAATATTCTTCAC
CAG12148	tsx-247::Tn10	9.3	9.3	430,667	<	tsx	AE000147	9,036	TACTTTGTGCCGATTACCGA
CAG12017	zba-3054::Tn10	10.1	9.9	461,486	>	b0441	AE000150	7,331	GGTTAAACAGGCGATTTTCG
CAG12154	zba-3055::Tn10	10.9	10.8	500,025	>	gsk	AE000154	782	CGCTGGGCACCAAGTTTGTC
CAG12171	purE79::Tn10	11.9	11.9	551,279	<	purK	AE000158	5,564	CGCATAACCTGCATCAGGAC
CAG12149	zbe-601::Tn10	14.3	13.7	637,765	>	b0604	AE000166	1,930	AGCAGAGCCAGTAAAAGTAT
CAG12077	zbe-280::Tn10	14.7	14.1	655,952	<	ybeG	AE000167	4,670	TGCCAGGTGATGGCAGGAAT
CAG18433	zbf-3057::Tn10	15.9	15.1	698,404	<	asnB	AE000171	1,888	GGTTATGTGTTCAATTTTTG
CAG12147	nadA57::Tn10	16.9	16.8	781,532	>	nadA	AE000177	8,094	TGCAAAGCATCCCGCTTCTA
CAG18493	zbi-29::Tn10	18.0	17.7	819,871	>	ig,e b0786-b0787	AE000181	3,833	CACTTAACAAGTACCAGGTA
CAG12034	zbi-3058::Tn10	18.7	19.3	897,129	<	potI	AE000187	9,890	TGTCGCGTATCCGCTGTTTT
CAG18478	zbj-1230::Tn10	19.8	20.4	946,252	>	ig, ycaD-b0899	AE000192	1,345	AGCAGAGTGTGAACTTACTG
CAG12094	zcb-3059::Tn10	21.1	21.6	1,000,952	<	b0940	AE000196	4,074	AGCTTCGCCCCAGCGCACGC
CAG18466	zcc-282::Tn10	22.6	22.9	1,064,111	<	yccE	AE000202	2,444	TACTCTGCCCCTGAATTTGG
CAG12078	zce-726::Tn10	24.6	24.9	1,154,216	>	yceG	AE000210	6,298	TGCTGCGCATCCGG
CAG18463	zcf-117::Tn10	25.5	26.1	1,211,084	>	b1160	AE000215	1,599	GACTTAACCGG
CAG18497	fadR13::Tn10	26.6	26.6	1,234,734	<	fadR	AE000217	2,438	AGCCCAGCGCCAGACTGCGC
CAG12016	zch-3060::Tn10	28.0	27.4	1,269,233	<	ig, kdsA-cha	AE000220	156	GACGTAGTATCCACACCAAG
CAG12169	zci-506::Tn10	28.0	28.1	1,302,475	>	oppC	AE000223	1,625	ATCGGGCATTGTTATTCGCC
CAG18455f	trpB83::Tn10	28.3	28.4	1,317,596	<	trpC	AE000224	5,761	CGCATTGCCGCCATTTATAA
CAG12028f	zcj-233::Tn10	29.0	29.5	1,368,905	>	b1309	AE000229	1,260	TGCTGAGTATGTCCGCCTGG
CAG12179f	mg1-500::Tn10	48.2	30.2	1,399,003	>	ydaH	AE000231	9,081	TGCTATGCGTAAACCAAAAC
CAG12081	zda-3061::Tn10	30.4	30.4	1,412,228	<	recT	AE000232	9,574	TGCGCAGCCTGAGTAAAGCT
CAG18640f	zhj-3076::Tn10	79.7	30.9	1,434,058	>	b1377	AE000234	8,385	TACTGTGCAGTGACTTCAAA
CAG12026	trg-2::Tn10	32.1	32.2	1,491,930	<	trg	AE000239	6,837	CGTTATGCCTCTACTTTGTT
CAG18461	zdd-235::Tn10	33.3	33.1	1,533,652	<	yddE	AE000243	5,163	AGCTGCGCACTATGTACGTG
CAG12151	zdi-925::Tn10	38.6	38.3	1,776,386	<	ig, b1695-b1696	AE000264	9,608	TGCGCCGCCTGCAGATTATT
CAG18464	zdj-276::Tn10	39.4	39.5	1,834,488	<	b1754	AE000270	4,289	AGCTGTGTGTCGACATAGCG
CAG18465	zea-225::Tn10	40.3	40.3	1,869,535	>	b1785	AE000273	8,941	GACATCGTGTGGGTGATAAA
CAG12068	zeb-3190::Tn10	41.3	41.0	1,903,614	<	ig, b1820-b1821	AE000276	7,274	GGCATAGCGATTGATGTGCA
CAG18486	eda-51::Tn10	41.6	41.6	1,930,416	<	eda	AE000279	1,608	TGCTGGGTATGGACTACGGT
CAG12156	uvrC279::Tn10	43.0	42.9	1,991,244	>	uvrC	AE000284	5,249	CGCCAAGTAGCAGCGGATGA
CAG18451	zed-3069::Tn10	43.9	43.9	2,038,762	<	b1972	AE000288	8,420	GGCAAAGCACCATAATCCTA
CAG12099	zef-3129::Tn10	45.4	44.9	2,085,192	>	ig, yeeF-b2015	AE000293	1,586	TACGAAGCCCGG
CAG12163f	zib-207::Tn10	81.8	46.9	2,173,967	>	gatZ	AE000298	10,901	CGCATCAAGATGAATTTTAC
CAG12021f	zbd-3105::Tn10	13.1	46.9	2,175,213	>	gatY	AE000298	12,147	TACCACGTACATTTTCATAT
CAG12098	zei-722::Tn10	48.3	49.6	2,299,610	<	napA	AE000309	11,314	CAACCTGCACCTGCTGACCG
CAG12177	zej-298::Tn10	49.6	50.0	2,318,294	>	atoS	AE000311	3,377	ATCCGCGCATTAAATGCAGA
CAG12178	zfa-723::Tn10	50.4	50.5	2,341,772	<	yfaL	AE000313	4,289	GGCGCAATCTATTCTTCTGG
CAG18484	zfb-223::Tn10	51.5	51.5	2,387,022	<	b2274	AE000317	5,073	TGCTCCGTATCTTCTGACCA
CAG18467	zfd-1::Tn10	53.4	53.7	2,491,451	<	ig, b2374-b2375	AE000325	12,877	TACTTACCATGCAGAAAGGA
CAG18468	nupC510::Tn10	54.1	54.1	2,511,317	>	nupC	AE000327	4,976	GGCCTGGCATTCTTCTTCCT
CAG18470	purC80::Tn10	55.7	55.9	2,595,619	>	purC	AE000334	10,116	AACTCAGCTTGCTTTTGCAT
CAG18481	zfh-208::Tn10	57.5	57.4	2,665,159	>	b2536	AE000340	2,865	GGCCGAGTAGCCAGCTGCCT
CAG18480	nadB51::Tn10	58.2	58.4	2,708,518	<	nadB	AE000344	312	GGCGTAGCGCCAGTGAAAGT
CAG12158	pheA18::Tn10	58.9	59.0	2,736,076	<	pheA	AE000346	3,848	TGCTGAGTGCGGATTAATTT
CAG18642	zfi-3131::Tn10	59.4	60.9	2,826,375	<	srlD	AE000354	6,308	TACCCAGCTTGGTCGCGTAT
CAG12173	cysC95::Tn10	61.9	62.2	2,886,785	<	cysI	AE000360	1,394	AGCAGAGCGTTTCCTGCCGT
CAG12079	fuc-3072::Tn10	63.2	63.2	2,932,885	>	fucP	AE000364	932	CACCTTATATGATCATCGTG
CAG12135	recD1901::Tn10	63.5	63.6	2,948,961	<	recD	AE000365	5,008	CGCGCGTCTGGTTTGCGATG
CAG12168	zgf-210::Tn10	66.0	66.5	3,082,773	>	speA	AE000377	3,072	CACCGTGTATTCGTTACGTT
CAG18472	nupG511::Tn10	66.9	66.9	3,104,395	<	nupG	AE000379	2,008	CGCCCAGCAGCATTGAGAAG
CAG18475	metC162::Tn10	67.9	67.9	3,150,485	>	metC	AE000383	2,934	GGCTGCGTGCTATTTCCCTG
CAG12184	tolC210::Tn10	68.4	68.5	3,176,389	>	tolC	AE000385	6,033	ACCAGTGCGTCCTTGCAGTT
CAG12152	zgj-3075::Tn10	69.5	69.3	3,215,934	<	air	AE000389	1,688	AGCCAGGTGTCCAGTGTCAG
CAG12072	zha-203::Tn10	70.9	71.8	3,332,800	>	nlp	AE000399	6,432	TGCGTAGCTACACTAAACCG
CAG12153	zhc-6::Tn10	72.1	72.5	3,364,914	>	b3219	AE000401	6,566	GACAACGCGCTTATTCGGCT
CAG12075f	zhe-3083::Tn10	74.7	73.6	3,412,834	>	acrF	AE000405	4,993	GACCGTGCAGGATACGGTGA
CAG12071f	zhd-3082::Tn10	73.3	73.9	3,429,813	<	smg	AE000407	246	TGCTCAACCTTGAAACTCGT
CAG18456	zhe-3084::Tn10	74.0	75.5	3,503,687	>	yhfT	AE000413	6,756	GGCCAAGCCAGTAAAGAACA
CAG18638f	zhh-21::Tn10	77.8	76.8	3,564,175	>	glgP	AE000419	2,951	CGCTAAGCGTGGGCGATGAA
CAG18450f	zhf-5::Tn10	75.8	77.4	3,590,125	>	ig, ugpB-livF	AE000421	8,047	GATGGGGCACGGATAAGCGG
CAG18492f	zic-4901::Tn10	82.7	82.5	3,826,553	<	ig, glts-yicE	AE000443	259	AGCAAAGCGGGCATTTTAGC
CAG18452f	zhf-3085::Tn10	75.8	82.7	3,837,058	>	nlpA	AE000443	10,764	AGCTGCGCCCCCTCGAGTTC
CAG18499	zid-501::Tn10	83.9	83.5	3,873,001	<	ig, yidW-yidX	AE000446	8,448	CGCCTGATATCCCTTTTCAG
CAG18501	zie-296::Tn10	84.5	84.7	3,931,475	<	rbsD	AE000452	854	CGCTGCGCCCGAGAGGGCTT
CAG18431	ilv-500::Tn10	85.2	85.2	3,952,161	<	ilvD	AE000453	10,898	GGCCAAGTACGTTTTTCACA
CAG18491	metE3079::Tn10	86.4	86.4	4,010,549	<	ig, metR-metE	AE000458	8,157	GACCGG
CAG18496	fadAB101::Tn10	86.7	86.8	4,025,408	>	fadA	AE000460	559	TACATGGCAGGATCTGCGCG
CAG18495	zih-35::Tn10	87.4	87.6	4,063,253	>	b3872	AE000463	5,333	TGCAGAGCATTAAATTCGAA
CAG18477	zij-501::Tn10	89.1	89.3	4,143,393	>	pflD	AE000469	3,582	CGCGCGGCGGCTACTTCACG
CAG12185	argE86::Tn10	89.4	89.5	4,151,734	>	argE	AE000470	1,041	CGCTTCGTAGTGATAACGTT
CAG18500	thi-39::Tn10	90.3	90.4	4,192,143	>	thiC	AE000473	4,927	TGCTTAACATCTTCTTTATT
CAG12164f	malF3089::Tn10	91.4	91.4	4,241,898	>	malF	AE000476	11,030	GGCTTAGCTTTTCATCACCC
CAG18427	zje-2241::Tn10	94.1	92.8	4,303,986	>	yjcS	AE000482	2,055	CGCTGGGCATCGTCAAAATC
CAG18488	zjd-2231::Tn10	93.7	93.9	4,356,936	<	cadB	AE000486	731	TGCTGGGTACTGGTTTAGCA
CAG12073	cycA30::Tn10	95.5	95.4	4,427,714	<	cycA	AE000492	2,708	AGCGAAGTCACTAAAAGATT
CAG12019	zjg-920::Tn10	96.2	95.8	4,442,377	>	ytfN	AE000493	7,248	CGCTTAACCTGAACATTGAA
CAG18462f	zdh-603::Tn10	37.1	95.8	4,446,109	>	chpS	AE000494	219	GGCAGAGCGTGGAGGCGCGA
CAG18430	zji-202::Tn10	98.6	99.0	4,595,002	>	mdoB	AE000507	382	TGCTTGTACTCGATTTTTAC

^aOnly the position of Tn10 is given. 

^bMap position as reported in reference 2. 

^cMap position calculated from the DNA sequence position. 

^dD, direction. The flanking sequence was read clockwise (>) or counterclockwise (<) on the genetic map. 

^eig, intergenic. Flanking genes or open reading frames are listed. 

^fStrains from this laboratory and the E. coli Genetic Stock Center were analyzed. 

FIG. 2.

Positions of Tn10 insertions on the E. coli map. Shown for each strain are its designation, the gene or open reading frame disrupted by the insertion, and the base pair position. Numbering on the inside of the circle is in minutes. ig, intergenic.

Eleven of the Tn10 insertion sites were in intergenic regions, 51 were in coding regions of known genes, and 26 were in potential open reading frames identified by sequence analysis (3). For the majority of strains, the nucleotide positions of the Tn10 insertion site fell within 1 min of the position determined by genetic mapping. Six of the sequences differed in map position by greater than 2 min. All strains whose Tn10 positions differed from the mapped position by greater than 1.5 min were obtained from the E. coli Genetic Stock Center and reanalyzed. In most cases, there was agreement between the strains in our laboratory collection and those obtained from the E. coli Genetic Stock Center. In several cases, cross-contamination of cultures was evident. In most cases, the mixture was resolved by isolation of single colonies from the cultures. It is not clear whether the positional differences we noted were caused by culture contamination that occurred prior to the distribution of strains to this laboratory and the E. coli Genetic Stock Center or some other artifact of the original genetic analysis.

There are two noticeable gaps in this particular collection of transposon-containing strains, each about 5 min long. The gap at 33 to 38 min contains the DNA replication terminus and recombination hot spot sites dif and RhsE. The gap at 77 to 82 min is bounded by recombination hot spot sites RhsB and RhsA. Three of the strains with transposons originally mapped to these two gaps (CAG18640, CAG12163, and CAG18462) now contain the transposon at a grossly different location on the chromosome. It seems likely that the failure of the transposons to be maintained at these locations is due to the same features that have led to the characterization of these regions as “recombinationally unstable” (4, 6).