Skip to main content
Journal of Traditional Chinese Medicine logoLink to Journal of Traditional Chinese Medicine
. 2023 Dec 15;44(1):103–112. doi: 10.19852/j.cnki.jtcm.20231215.003

Taohong Siwu decoction (桃红四物汤) ameliorates atherosclerosis in rats possibly through toll-like receptor 4/myeloid differentiation primary response protein 88/nuclear factor-κB signal pathway

Fengjin CHANG 1, Peng ZHOU 2, Guoying LI 2, Weizhi ZHANG 2, Yanyan ZHANG 1, Daiyin PENG 3,, Guangliang CHEN 3,
PMCID: PMC10774721  PMID: 38213245

Abstract

OBJECTIVE:

To investigate the effect of Taohong Siwu decoction (桃红四物汤, TSD) on atherosclerosis in rats as well as investigate the underlying mechanism based on molecular docking.

METHODS:

Sixty healthy male Sprague-Dawley rats were randomly divided into 6 groups with 10 rats in each group: control group, model group, atorvastatin group (AT, 2.0 mg/kg), and TSD groups (20, 10, 5 g/kg) after 7 d of acclimation. The model of atherosclerosis was successfully established except the control group by high fat diet (HFD) and vitamin D2. Biochemical analyzers were used to detect the levels of triglyceride (TG), total cholestero (TC), low density lipoprotein-cholesterol (LDL-C) and high density lipid-cholesterol (HDL-C) in blood lipid. The levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β) were determined by enzyme-linked immunosorbent assay. Sudan IV staining and Hematoxylin and eosin staining (HE staining) were performed to observe the pathological changes in aortic tissue. Molecular docking technology was used to predict the best matching between the main components of TSD and the target proteins. The expression of target proteins was further detected by quantitative real time polymerase chain reaction (qRT-PCR) and Western blot analysis.

RESULTS:

The results showed that TSD restricted atherosclerosis development and decreased the inflammatory cytokines in plasma. Molecular docking results predicted that the main components of TSD showed a strong binding ability with toll-like receptor (TLR4), myeloid differentiation primary response protein 88 (MyD88), and nuclear factor kappa-B (NF-κB). The results of qRT-PCR and Western blot analysis showed that the mRNA and protein expressions of TLR4, MyD88 and NF-κB p65 in the aorta were reduced in atorvastatin group and TSD group.

CONCLUSIONS:

TSD can ameliorate atherosclerosis in rats, and the underlying mechanism is supposed be related to the suppression of inflammatory response by regulating TLR4/MyD88/NF-κB signal pathway.

Keywords: atherosclerosis, molecular docking simulation, toll-like receptor 4, myeloid differentiation factor 88, NF-kappa B, signal transduction, Taohong Siwu decoction

1. INTRODUCTION

Cardiovascular disease (CVD) is currently a universal health problem with high morbidity and mortality.1,2 In China, there are about 330 million CVD patients, including 11 million patients with atherosclerosis (AS).3 AS is a chronic inflammatory disease that featured by lipid metabolism disorder, inflammation, smooth muscle cell proliferation, cell apoptosis, and severe lesions, which result in serious damage, disability, and even death.4,5

The etiology of AS is increasingly complex. Various genetic and environmental risking factors are involved in the occurrence and development of AS. Inflammation and different inflammatory pathways are crucial in the initiation, progression and complication of AS. Toll-like receptor 4 (TLR4)/myeloid differentiation factor 88 (MyD88)/nuclear factor-kappa B (NF-κB) signal pathway is one of the classical inflammatory and immune regulating pathways. Recent researches have shown that TLR4/MyD88/NF-κB signal pathway plays a vital role in atherosclerosis. TLR4 is a bridge between immune response and chronic inflammation, which can participate in the initiation and development of AS, as well as in the stages of plaque instability and rupture.6,-8 Besides, MyD88 also plays a critical role in AS formation and progression, and reduced atherosclerosis has been reported in MyD88-null mice.9 NF-κB is an important regulator in TLR4/MyD88/NF-κB signal pathway, and the activation of NF-κB has been found in situ in the atherosclerotic plaques of human.10

Traditional Chinese Medicine Taohong Siwu decoction (桃红四物汤, TSD) have been used to treat thrombotic diseases or blood stasis-related syndromes for over hundreds of years. 11,12 It functions as “promoting blood circulation and alleviating blood stasis”. TSD is composed of Baishao (Radix Paeoniae Alba), Shudihuang (Radix Rehmanniae Praeparata), Danggui (Radix Angelicae Sinensis), Chuanxiong (Rhizoma Chuanxiong), Taoren (Semen Persicae) and Honghua (Flos Carthami).13 In particular, amygdalin, a main component of Taoren (Semen Persicae), has been applied in the prevention and treatment of AS,14,15 which may be related to its anti-inflammatory effect through mitogen-activated protein kinase, activator protein-1 and NF-κB p65 signaling pathways.15 Paeoniflorin is a bioactive monoterpene glucoside of Baishao (Radix Paeoniae Alba), which can ameliorate inflammatory response in AS via suppressing TLR4/MyD88/NF-κB signaling pathway.16 Besides, other ingredients of TSD, such as Shudihuang (Radix Rehmanniae Praeparata), Danggui (Radix Angelicae Sinensis) and Honghua (Flos Carthami) have also been reported with pharmacological effect on cardiovascular diseases by promoting blood circulation, exerting anti-inflammatory activity, and modulating immune system.17,-19 Clinically, TSD has been used in the treatment of atherosclerosis with satisfactory therapeutic effect.20 However, the underlying mechanism of the anti-atherosclerotic activity intervened by TSD still remains an unsettled issue.

Molecular docking is a powerful method that used in finding the best matching between small molecule drug candidates with targeted protein receptors, which enables the characterization of the binding behavior therein and related biochemical processes.21 In the present work, we investigated the protective effects of TSD on AS in High-fat diet + vitamin D2 (VD2) rats, and performed molecular docking to predict the binding orientation of TSD components and their targeted proteins, which may provide a deeper understanding of the molecular mechanism that involved in the anti- atherosclerotic activity intervened by TSD.

2. MATERIALS AND METHODS

2.1. Preparation of TSD

TSD is composed of Baishao (Radix Paeoniae Alba), Shudihuang (Radix Rehmanniae Praeparata), Danggui (Radix Angelicae Sinensis), Chuanxiong (Rhizoma Chuanxiong), Taoren (Semen Persicae) and Honghua (Flos Carthami) at a weight ratio of 3: 4: 3: 2: 3: 2. All the Chinese herbal medicine were supplied by Traditional Chinese Medicine (TCM) pharmacy of the First Affiliated Hospital of Anhui University of Chinese Medicine and examined at least twice by Professor WANG Dequn in the School of Pharmacy, Anhui University of Chinese Medicine. TSD is prepared as follows: The herbs were air-dried and immersed in (v/w) 75% ethanol for 6 h and then boiled for 1.5 h. After that, the decoction was extracted. The residue was refluxed again for 1.5 h with eight times (v/w) 75% ethanol. Thereafter, the supernatant was obtained, and underwent filtration and concentration into 1.8 g/mL. The collected decoction was preserved at 4 ℃ for further use.13

2.2. Animals

A total of 60 healthy male Sprague-Dawley rats of clean grade, weighing (200 ± 20) g, were purchased from the experiment animal center in Anhui University of Chinese Medicine (Hefei, China) [Certificate of quality No. SCXK (Wan) 2017-001]. All experiments animals were housed at room temperature (20-25 ℃) and humidity (50% ± 15%), with free access to water and food.

This study was audited and approved by Animal Ethics Committee of Anhui University of Chinese Medicine. All experimental procedure and animal care were carried out under the guidance of the Ethics Committee in order to minimize the suffering of animals.

2.3. Animal grouping and herbal administration

Sixty rats were randomly divided into 6 groups with 10 rats in each group: control group, model group, atorvastatin group (AT, 2.0 mg/kg), and TSD groups (20, 10, 5 g/kg) after 7 d of acclimation. The rats in the control group were fed with standard rat chow. The rats in other groups were fed with a high fat diet (HFD) containing 84% standard rat chow, 5% yolk powder, 5% lard, 5% white sugar and 1% cholesterol for 9 subsequent weeks and performed intraperitoneal injection of VD2 at the dose of 6.0 × 105 IU/kg at the beginning of the experiment, then VD2 at the dose of 1.0 × 105 IU/kg was injected at 3th, 6th and 9th weeks. From the 9th week, the drugs were administered intragastrically once a day for 8 weeks in atorvastatin and TSD groups. The rats in control and model groups were treated with the same volume of normal saline.

2.4. Sample collection

After intragastric administration, all the rats underwent fasting for 12 h with free access to water. Then the rats were anesthetized by 1% sodium pentobarbital (40 mg/kg). The blood samples were obtained from the abdominal aorta. After static settlement, the blood samples were centrifuged at 3000 r/min for 15 min. The supernatant liquid was acquired and maintained at -80 ℃ for further study. The heart as well as aorta samples were removed and placed into cold phosphate buffer saline. Then a part of these tissues was stored at -80 ℃ and others were fixed in 4% paraformaldehyde for histology assay.

2.5. Sudan IV staining of aorta

Aortas with peripheral fat and adventitial tissue were removed and fixed in 4% paraformaldehyde for 24 h. And then opened longitudinally from brachiocephalic artery to iliac artery bifurcation. Then aortas were stained according to the instructions of Sudan IV staining solution kit. The images were captured with a digital color camera (Canon EOS 7D, Tokyo, Japan).

2.6. Hematoxylin-eosin staining of aorta

The aortas were fixed with 4% paraformaldehyde. After dehydration, transparency, wax immersion and paraffin embedding, the aortas were stained with hematoxylin and eosin (HE staining), and the pathological changes were observed by microscope (Olympus BX51, Tokyo, Japan).

2.7. Serum biochemical assays

The serum level of Total cholesterol (TC), low density lipoprotein (LDL-C), high density lipoprotein (HDL-C), and triglyceride (TG) were determined by an automatic blood chemical analyzer (Beckman Coulter AU-5800, Bria, CA, USA).

2.8. Measurement of inflammatory cytokines in plasma

The plasma interleukin-1β (IL-1β), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) levels were detected by ELISA kits (R&D Systems, Minneapolis, MN, USA) following the instructions from the manufacturer.

2.9. Molecular docking analysis

CB-DOCK was applied to predict protein cavities, calculate the center and size of the cavities, and finally conduct molecular docking between the main components of TSD and targets. The main components of TSD were referred to the published literature.22 Protein data bank (PDB) formats of TLR4 (PDB Code: 2Z62),23 MyD88 (PDB Code: 2JS7),24 NF-κB (PDB Code: 1MDI),25 and the main components of TSD in standard delay format were input to CB-Dock (http://clab.labshare.cn/cb-dock/php/blinddock.php) for molecular docking.26 The style of ligand was set as “spacefill”, and the target was set as “cartoon”. The lower the Vina score means the stronger the binding ability between ligand and target.

2.10. Quantitative real-time polymerase chain reaction (qRT-PCR)

The mRNA expression of TLR4, My D88 and NF-κB p65 mRNA were determined by qRT-PCR. TRIzol kit (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNA of arterial tissue and identify their purity and integrity. After measuring optical density value by ultraviolet spectrophotometer, the total RNA was reversely transcribed into cDNA and then reverse transcription reaction of mRNA was performed by cDNA kit (Invitrogen, Carlsbad, CA, USA). The qRT-PCR analysis was performed for the obtained cDNA using a fluorometric thermal cycler by Quantstudio multiplex real-time fluorescence quantitative PCR system (Life Technologies, Grand Island, NY, USA). The Primer Premier 6.0 and Beacon designer 7.8 software were utilized for primer design (Table 1). The expression levels of each target gene were normalized to corresponding β-actin threshold cycle (CT) values using the 2-∆∆Ct comparative method.

Table 1.

Primer sequence in qRT-PCR

Gene Accession No. Sense primer (5′-3′) Antisense primer (5′-3′)
TLR4 NM_019178.2 ATCGGTGGTCAGTGTGCTTGTG AAAGCTGAAAGCGGGGCACT
MyD88 NM_198130.2 TCCAACGCTGTCCTGTCTGCAT TGCCACCTCAAGCAAGGCAAA
NF-κB NM_001276711.1 ACGCGGTTACGGGAGATGTGAA TCACGGCCAAGTGCAAAGGTGT
β-actin NM_031144.3 TGGCTACAGCTTCACCACCACA TCGGAACCGCTCATTGCCGATA

Notes: TLR4: toll-like receptor 4; MyD88: myeloid differentiation primary response protein 88; NF-κB: nuclear factor-κB.

2.11. Western blot analysis

Arterial tissue was prepared for Western blot analysis. Totally 100 mg arterial tissue was homogenized in 1 mL radio immunoprecipitation assay buffer containing 1% phenylmethanesulfonyl fluoride and incubated for 30 min on ice, then the samples were centrifuged at 12 000 rpm for 15 min at 4 ℃. The concentration of protein was detected by bicinchoninic acid assays (Beyotime, Shanghai, China). After that, protein in each group was electrophoresed on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gel and then transferred onto polyvinylidene fluoride membranes. After blocking by Tris buffered saline with Tween (TBST) containing 5% fat-free milk for 2 h at room temperature, the membranes were incubated with primary antibody (TLR4: ab13556, Abcam; MyD88: ab2064, Abcam; NF-κB p65: ab16502, Abcam, Cambridge, MA, USA) overnight at 4 ℃. Later on, the membranes were washed three times by TBST and incubated with the horseradish peroxidase-conjugated secondary antibodies at room temperature for 2 h and developed with electrogenerated chemiluminescence regent (Thermo Fisher, Waltham, MA, USA). Meanwhile, the expression of β-actin was used as the reference bands.

2.12. Statistical analysis

All results were expressed as mean ± standard deviation. The differences between groups were analyzed by one-way analysis of variance using SPSS 23.0 (IBM Corp., Armonk, NY, USA). P < 0.05 was considered to be statistically significant.

3. RESULTS

3.1. Confirmation of AS formation in rats

As the Sudan IV staining results shown in Figure 1A, distinct dyed red plaque was found in the arterial tree of the rats in model group and smooth arterial vessels in rats of control group. Figure 1C is the HE-staining results of the aortas, which showed there were thickening of the aortic intima, disordered arrangement of smooth muscle cells and significant proliferation in the model group. In addition, a large number of foam cell aggregation accompanied by atherosclerotic plaque formation were also observed in the model group. These staining results suggested that the AS model was successfully established in HFD rats.

Figure 1. Effects of TSD on Atherosclerotic Lesions in AS rats (Sudan IV staining and HE staining).

Figure 1

A: Sudan IV staining of aortas in different groups. A1: Control group, A2: Model group, A3: TSD-H group, A4: TSD-M group, A5: TSD-L group, A6: AT group. B: proportion of plaque area to total intimal area in different groups. C: HE staining of aortas (×200) in different groups. C1: Control group, C2: Model group, C3: TSD-H group, C4: TSD-M group, C5: TSD-L group, C6: AT group. Control group: the rats in the control group were fed with standard rat chow. Model group: the rats in model group were fed with a high-fat diet containing 84% standard rat chow, 5% yolk powder, 5% lard, 5% white sugar and 1% cholesterol for 9 subsequent weeks and performed intraperitoneal injection of VD2 at the dose of 6.0×105 IU/kg at the beginning of the experiment, then VD2 at the dose of 1.0×105 IU/kg was injected at 3th, 6th and 9th weeks. TSD-H, TSD-M, TSD-L group (20, 10, 5 g/kg): the rats in the TSD groups were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks. AT group: the rats in the AT group were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks at a dose of 2 mg/kg. TSD: Taohong Siwu decoction; TSD-H: Taohong Siwu decoction high dose group; TSD-M: Taohong Siwu decoction middle dose group; TSD-L: Taohong Siwu decoction low dose group; VD2: vitamin D2; AS: atherosclerosis; AT: atorvastatin group; HE: Hematoxylin and eosin. Data were expressed as mean ± standard deviation (n = 6). aP < 0.01 compared with control group; bP < 0.01, cP < 0.05, compared with model group.

3.2. TSD reduced atherosclerotic lesions in AS rats

In order to evaluate the effect of TSD on AS, a range of indicators of atherosclerosis were tested. According to the Sudan IV staining results as shown in Figure 1A and Figure 1B, atherosclerotic plaques in the TSD-treated groups were significantly reduced compared with the model group (P < 0.05). And with the increase of TSD dose, the lesion area decreased gradually. Atorvastatin was used as positive control in the present work, which can significantly reduce atherosclerotic plaques. The Sudan IV staining of aortas in AT group showed the lesion area was significantly reduced than model group. In addition, HE staining showed the similar results (Figure 1C). In the control group, the morphology of aorta was normal, with clear boundary and complete structure. The vascular endothelium was continuous, intact and smooth, and there was no plaque or lipid deposition in the aorta. The vascular smooth muscle cells were arranged regularly. In the model group, the intima of the aorta was thickened and the endothelial cells were discontinuous and incomplete. Moreover, the vascular smooth muscle cells were irregular and proliferous. A large number of foam cells were aggregated in vessel wall and there were remarkable atheromatous plaque formation. Compared with the model group, TSD low-dose group showed minor improvement in the area, thickness of plaque, and the degree of lesions. While in TSD middle-dose and TSD high-dose groups, the area, thickness, and the degree of atherosclerotic plaques were significantly decreased as compared to model group. Therefore, the atherosclerosis development was restricted by TSD in AS rats.

3.3. TSD improved dyslipidemia in AS rats

It is well accepted that the lipid metabolism disorder caused by high fat diet is an important cause of atherosclerosis. Here, we analyzed the lipid profiles (TC, TG, LDL-C, and HDL-C) in serum. As shown in Figure 2A-2D, the levels of TC, TG and LDL-C were significantly increased and the level of HDL-C was significantly reduced in the model group compared with those in the control group (P < 0.05). After the treatment of TSD, the serum level of TC, TG and LDL-C were obviously decreased in TSD high-dose group, TSD middle-dose group, TSD low-dose group and AT group compared with model group (P < 0.05). And the level of HDL-C was significantly increased in TSD high-dose group, TSD middle-dose group, TSD low-dose group and AT group compared with model group (P < 0.05).

Figure 2. Effects of TSD on Dyslipidemia and Serum Inflammatory Cytokines in AS rats (serum lipid profiles and serum inflammatory cytokine levels).

Figure 2

A-D: effects of TSD on cyslipidemia in AS rats (serum lipid profiles). A: TC in serum, B: TG in serum, C: LDL-C in serum, D: HDL-C in serum. E-G: effects of TSD on serum inflammatory cytokines in AS rats (serum inflammatory cytokine levels). E: IL-1β in serum, F: IL-6 in serum, G: TNF-α in serum. Control group: the rats in the control group were fed with standard rat chow. Model group: the rats in model group were fed with a high-fat diet containing 84% standard rat chow, 5% yolk powder, 5% lard, 5% white sugar and 1% cholesterol for 9 subsequent weeks and performed intraperitoneal injection of VD2 at the dose of 6.0×105 IU/kg at the beginning of the experiment, then VD2 at the dose of 1.0×105 IU/kg was injected at 3th, 6th and 9th weeks. TSD-H, TSD-M, TSD-L group (20, 10, 5 g/kg): the rats in the TSD groups were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks. AT group: the rats in the AT group were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks at a dose of 2 mg/kg. TSD: Taohong Siwu decoction; TSD-H: Taohong Siwu decoction high dose group; TSD-M: Taohong Siwu decoction middle dose group; TSD-L: Taohong Siwu decoction low dose group; VD2: vitamin D2; AT: atorvastatin group; AS: atherosclerosis; TC: total cholestero; TG: triglyceride; LDL-C: low density lipoprotein-cholesterol; HDL-C: high density lipid-cholesterol; IL-1β: interleukin-1β; IL-6: interleukin-6; TNF-α: tumor necrosis factor-α. Data were expressed as mean ± standard deviation (n = 10). aP < 0.01 compared with control group; bP < 0.01, cP < 0.05, compared with model group.

3.4. TSD reduced serum inflammatory cytokines in AS rats

The inflammatory cytokines (IL-1β, IL-6 and TNF-α) in serum in each group were detected by ELISA kits. As the results shown in Figure 2E-2G, after fed with a high-fat diet for 9 weeks, the concentration of IL-1β, IL-6 and TNF-α were significantly increased compared with control group (P < 0.01). And in TSD high-dose group, TSD middle-dose group, TSD low-dose group and AT group, the levels of IL-1β, IL-6 and TNF-α were significantly reduced than those in model group (P < 0.01). Collectively, these results indicated that the treatment of TSD could inhibit AS inflammation.

3.5. Docking results

Molecular docking results suggested that the main components of TSD showed a strong binding ability with TLR4, MyD88, and NF-κB. More precisely, paeoniflorin had the strongest binding ability with TLR4, followed by Verbascoside and Laetrile. The Vina score of Paeoniflorin and Verbascoside were lower than that of native ligand, suggested that the binding ability of Paeoniflorin and Verbascoside to TLR4 were stronger than that of native ligand (Table 2, supplementary Figure 1). Verbascoside, Paeoniflorin and Hydroxysafflor yellow had strong binding ability with MyD88, in which the VINA scores were slightly higher than that of native ligand (Table 3, supplementary Figure 2). Hydroxysafflor yellow had the strongest binding ability with NF-κB, followed by Laetrile and Verbascoside. The VINA score of the three compounds were lower than that of native ligand, suggesting that the binding ability of the three compounds to NF-κB were stronger than that of native ligand (Table 4, supplementary Figure 3). The molecular docking prediction indicated that the anti-atherosclerotic activity of TSD is likely related to the suppression of TLR4/MyD88/NF-κB signaling pathway.

Table 2.

Docking of main components of TSD with TLR4

Chemical Vina score Cavity score Center (x, y, z) Size (x, y, z)
Native ligand 5.7 254 0, 2, 16 21, 21, 21
Paeoniflorin 6.7 254 0, 2, 16 23, 23, 23
Verbascoside 6.6 254 0, 2, 16 27, 27, 27
Laetrile 5.6 254 0, 2, 16 24, 24, 24
Hydroxysafflor yellow 5.3 254 0, 2, 16 25, 25, 25
Ferulic acid 5.0 254 0, 2, 16 19, 19, 19
Oshaic lactone 5.0 254 0, 2, 16 18, 18, 18
Gallic acid 4.9 254 0, 2, 16 17, 17, 17
5-hydroxymethyl furfuraldehyde 4.1 254 0, 2, 16 16, 16, 16

Notes: TSD: Taohong Siwu decoction; TLR4: toll-like receptor 4.

Table 3.

Docking of main components of TSD with MyD88

Chemical Vina score Cavity score 8Center (x, y, z) Size (x, y, z)
Native ligand 7.1 554 7, 7, 9 27, 27, 27
Verbascoside 6.8 554 7, 7, 9 27, 27, 27
Paeoniflorin 6.8 554 7, 7, 9 23, 23 23
Hydroxysafflor yellow 6.8 554 7, 7, 9 25, 25, 25
Laetrile 6.6 554 7, 7, 9 24, 24, 24
Ferulic acid 5.3 554 7, 7, 9 19, 19, 19
Oshaic lactone 4.9 554 7, 7, 9 18, 24, 18
Gallic acid 4.8 554 7, 7, 9 17, 24, 17
5-hydroxymethyl furfuraldehyde 3.8 554 7, 7, 9 16, 24, 16

Notes: TSD: Taohong Siwu decoction; MyD88: myeloid differentiation primary response protein 88.

Table 4.

Docking of main components of TSD with NF-κB

Chemical Vina score Cavity score Center (x, y, z) Size (x, y, z)
Native ligand 5.6 408 7, 1, 6 25, 25, 25
Hydroxysafflor yellow 6.1 408 7, 1, 6 25, 25, 25
Laetrile 5.9 408 7, 1, 6 24, 24, 24
Verbascoside 5.8 408 7, 1, 6 27, 27, 27
Paeoniflorin 5.2 408 7, 1, 6 23, 23, 23
Gallic acid 5.2 408 7, 1, 6 17, 17, 17
Oshaic lactone 5.1 408 7, 1, 6 18, 18, 18
Ferulic acid 4.7 408 7, 1, 6 19, 19, 19
5-hydroxymethyl furfuraldehyde 4.4 408 7, 1, 6 16, 16, 16

Notes: TSD: Taohong Siwu decoction; NF-κB: nuclear factor-κB.

3.6. TSD downregulated the mRNA expression level of TLR4/MyD88/NF-κB signaling pathway in the AS rats aortas

Based on previous study and molecular docking results, TSD might target on TLR4, MyD88, and NF-κB. TLR4/MyD88/NF-κB is a classical signaling pathway that participate in the regulation of the inflammatory response, and is considered to be involved in the formation and progression of atherosclerosis. Therefore, the mRNA expression level of TLR4/MyD88/NF-κB signaling pathway were evaluated. As shown in Figure 3, the mRNA expression level of TLR4, MyD88 and NF-κB p65 in model group were significantly increased than those in control group (P < 0.01). In contrast, treatment with TSD or atorvastatin significantly decreased the mRNA expression level of TLR4, MyD88 and NF-κB p65. In TSD high-dose group, TSD middle-dose group and TSD low-dose group, the mRNA expression level of TLR4, MyD88 and NF-κB p65 were signifincant reduced than model group (P < 0.01). And high-dose group down-regulated TLR4, MyD88 and NF-κB p65 mRNA expression level better than low-dose group.

Figure 3. Effects of TSD on the mRNA expression levels of TLR4/MyD88/NF-κB signaling pathway components in aorta of AS rats.

Figure 3

Control group: the rats in the control group were fed with standard rat chow. Model group: the rats in model group were fed with a high-fat diet containing 84% standard rat chow, 5% yolk powder, 5% lard, 5% white sugar and 1% cholesterol for 9 subsequent weeks and performed intraperitoneal injection of VD2 at the dose of 6.0×105 IU/kg at the beginning of the experiment, then VD2 at the dose of 1.0 × 105 IU/kg was injected at 3th, 6th and 9th weeks. TSD-H, TSD-M, TSD-L group (20, 10, 5 g/kg): the rats in the TSD groups were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks. AT group: the rats in the AT group were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks at a dose of 2 mg/kg.TSD: Taohong Siwu decoction; TSD-H: Taohong Siwu decoction high dose group; TSD-M: Taohong Siwu decoction middle dose group; TSD-L: Taohong Siwu decoction low dose group; VD2: vitamin D2; AT: atorvastatin group; mRNA: messenger RNA; TLR4: toll-like receptor 4; MyD88: myeloid differentiation factor 88; NF-κB: nuclear factor-kappa B. Data were expressed as mean ± standard deviation (n = 3). aP < 0.01, compared with control group; bP < 0.01, compared with model group.

3.7. TSD downregulated the protein expression level of TLR4/MyD88/NF-κB signaling pathway in the AS rats aortas

The protein expression level of TLR4/MyD88/NF-κB signaling components in AS rats’ aortas were also analyzed. Figure 4 showed the protein expression level of TLR4, MyD88 and NF-κB p65. Compared with control group, the protein expression levels of TLR4, MyD88 and NF-κB p65 in model group were significantly increased (P < 0.01). And after the treatment of TSD or atorvastatin, the protein expression level of TLR4, MyD88 and NF-κB p65were significantly reduced compared with the model group (P < 0.01). TLR4, MyD88 and NF-κB p65 protein expression in TSD low-dose, middle-dose, and high-dose groups also showed gradual decreasing than model group with increasing drug dose. And the high dose of TSD down-regulated TLR4, MyD88 and NF-κB p65 protein expression level better than low dose of TSD. These results suggested that TSD can inhibit the activation of the TLR4/ MyD88/NF-κB signaling pathway in AS rats.

Figure 4. Effect of TSD on the protien expression levels of TLR4/MyD88/NF-κB signaling pathway components in aorta of AS rats.

Figure 4

Control group: the rats in the control group were fed with standard rat chow. Model group: the rats in model group were fed with a high-fat diet containing 84% standard rat chow, 5% yolk powder, 5% lard, 5% white sugar and 1% cholesterol for 9 subsequent weeks and performed intraperitoneal injection of VD2 at the dose of 6.0 × 105 IU/kg at the beginning of the experiment, then VD2 at the dose of 1.0 × 105 IU/kg was injected at 3th, 6th and 9th weeks. TSD-H, TSD-M, TSD-L group (20, 10, 5 g/kg): the rats in the TSD groups were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks. AT group: the rats in the AT group were treated in the same way as rats in the model group, from the 9th week, the drugs were administered intragastrically once a day for 8 weeks at a dose of 2 mg/kg. TSD: Taohong Siwu decoction; TSD-H: Taohong Siwu decoction high dose group; TSD-M: Taohong Siwu decoction middle dose group; TSD-L: Taohong Siwu decoction low dose group; VD2: vitamin D2; AT: atorvastatin group; TLR4: toll-like receptor 4; MyD88: myeloid differentiation factor 88; NF-κB: nuclear factor-kappa B. Data were expressed as mean ± standard deviation (n = 3). aP < 0.01, compared with control group; bP < 0.01, compared with model group.

4. DISCUSSION

Atherosclerosis is a chronic inflammatory disease that featured by lipids and fibrous accumulation in arteries, smooth muscle cell proliferation and cell apoptosis.27 It is also the main cause of cardiovascular diseases such as coronary disease and stroke. Over the past decades, epidemiological and experimental studies have revealed the underlying molecular mechanism of AS that combines cholesterol metabolism disorder and atherosclerotic plaque induced by other risking factors.28 Pathological studies have showed a well-defined consecutive changes within vessel. Atherosclerosis plaques develops from the trapping of lipoprotein inside the subendothelial matrix initially. The lipoprotein aggregation and monocyte transmigration will occur accordingly, which lead to foam cell formation and fibrous lesion. These findings suggest that inflammatory cells, especially monocyte or macrophages contributes significantly in atherosclerosis. Particularly, oxidative low-density lipoprotein (LDL) accumulation play a key role in monocyte recruitment and foam cell formation.29,30

Different signaling pathways are considered to be related to the formation of atherosclerosis, such as Sterol-regulatory element binding protein (SREBP) signaling pathway and SREBP-cleavage activating protein (SCAP) signaling pathway, TLR pathway, and NF-κB pathway.31,32 The inflammatory response is basically functionalized by coordinate activation of different signaling pathways which involve in the regulation of anti-inflammatory cytokines. Thereinto, TLR4/MyD88/ NF-κB signal pathway plays an important role in regulating inflammatory response, which is closely related to atherosclerosis. TLR4 is known as an extracellular pathogen recognition receptor to regulate inflammatory signals and participate in immune-related response. The activation of TLR4 make a profound impact on the aggregation of monocyte and the formation of foam cell in AS.33,34 Moreover, TLR4 is significantly expressed in lipid-rich plaques and macrophage infiltration sites in AS mouse models and AS patients.35 MyD88 is a critical component for TLR/IL-1 receptor signaling, which is closely associated with immune response and the activation of NF-κB signaling pathway.36 NF-κB pathway has been recognized as a typical pro-inflammatory signaling pathway, with NF-κB being an significant transcription factor that modulates inflammatory response and cytokine production, such as IL-1β, IL-6 and TNF-α.37

Treatment of AS includes healthy diet and lifestyle, surgery and medication. Medication for AS are mainly focused on lipoprotein modification treatment, such as LDL-C-lowering therapy and TG-lowering therapy.38 To date, LDL-C-lowering therapy is generally conducted in the prevention and treatment of AS in terms of its efficacy and safety. The statins and fibrates that significantly decrease atherogenic lipoproteins are used clinically.39 In our experiment, atorvastatin was applied in AT group, and showed highly effective anti-athero-sclerotic activity. In addition, TCM has also been used in the treatment of AS. Li et al 40 reported that Paeonol can attenuate high-fat-diet-induced atherosclerosis in rabbits by anti-inflammatory activity. The anti-athero-sclerotic effect of Paeonol is further investigated by Wu et al 41 and they demonstrated Paeonol can inhibit the proliferation of vascular smooth muscle cells by up-regulated autophagy through Adenosine 5‘-monophosphate-activated protein kinase/ mammalian target of rapamycin signaling pathway. Chen et al 33 reported the anti-inflammatory activity of tanshinone IIA, as well as its anti-atherosclerotic plaque effects via TLR4/MyD88/NF-κB signal pathway.

In clinical application, TSD has been used in the treatment of blood stasis syndrome-related diseases, including atherosclerosis.21 In our study, we investigate the effect of TSD on AS rats. The Sudan IV staining and HE staining results suggested that the AS model was successfully established in HFD rats. In the model group, there were obvious thickening of the aortic intima, disordered arrangement of vascular smooth muscle cells and significant proliferation. Foam cell aggregation and atherosclerotic plaque formation were also observed in the model group. After intragastric administration of TSD, the area, thickness, and the degree of lesions of atherosclerotic plaques were significantly improved with the increase of TSD dose. Especially in TSD high-dose group, the improvement effect is even comparable with that in AT group. These results indicated that AS development can be restricted by TSD intervention. Besides, in TSD group and AT group, the serum level of TC, TG and LDL-C were remarkably decreased and the level of HDL-C was significantly increased compared with model group, and the difference is statistically significant (P < 0.05). We’d like to note that HDL is a protective component exerting anti-inflammatory and immunologic activity, based on its role in removing excessive cholesterol and inhibiting lipoprotein oxidation.42 Since AS is a chronic inflammatory disease, we also detected the inflammatory cytokines level (IL-1β, IL-6 and TNF-α) in serum in each group. The results showed that in TSD low-dose group, TSD middle-dose group, and TSD high-dose group, the levels of IL-1β, IL-6 and TNF-α were significantly reduced than those in model group (P < 0.01), suggesting that the treatment of TSD can effectively inhibit AS inflammation.

To explore the underlying mechanism of the anti-atherosclerotic activity intervened by TSD, we further performed molecular docking experiment. Molecular docking is a key tool in predicting the ligand-receptor complex structure with computer methods. The results of molecular docking predicted that the main components of TSD have a strong binding ability with TLR4, MyD88, and NF-κB. In detail, paeoniflorin had the strongest binding ability with TLR4, followed by Verbascoside and Laetrile. Verbascoside, Paeoniflorin and Hydroxysafflor yellow showed strong binding ability with MyD88. Besides, Hydroxysafflor yellow had the strongest binding ability with NF-κB, followed by Laetrile and Verbascoside. The VINA score of the three compounds were lower than that of native ligand, suggesting that the binding ability of the three compounds to NF-κB were stronger than that of native ligand. The molecular docking prediction indicated that TSD might target on TLR4, MyD88, and NF-κB. Moreover, qRT-PCR and WB results suggested that mRNA and protein expression of TLR4/MyD88/NF-κB signaling components were down regulated. Therefore, the anti-atherosclerotic activity of TSD is possibly related to the inhibition of TLR4/MyD88/NF-κB signaling pathway.

In conclusion, our work demonstrated the anti-atherosclerotic activity of TSD in AS rats, which decreased the inflammatory cytokines in plasma. Molecular docking results predicted that the main components of TSD have a strong binding ability with TLR4, MyD88, and NF-κB. Moreover, qRT-PCR and WB results suggested that mRNA and protein expression of TLR4/MyD88/NF-κB signaling components were down regulated. Collectively, the intervention of TSD can effectively ameliorate AS in rats, and the underlying mechanism is possibly related to the suppression of TLR4/MyD88/NF-κB signaling pathway.

5. SUPPORTING INFORMATION

Supporting data to this article can be found online at http://www.journaltcm.com.

Contributor Information

Daiyin PENG, Email: pengdy@ahtcm.edu.cn.

Guangliang CHEN, Email: chen_guangl@126.com.

REFERENCES

  • 1. Timmis A, Townsend N, Gale CP, et al. European society of cardiology: cardiovascular disease statistic 2019. Eur Heart J 2020; 41: 12-85. [DOI] [PubMed] [Google Scholar]
  • 2. Leong DP, Joseph PG, McKee M, et al. Reducing the global burden of cardiovascular disease, part 2: prevention and treatment of cardiovascular disease. Circ Res 2017; 121: 695-710. [DOI] [PubMed] [Google Scholar]
  • 3. Hu SS. Report on cardiovascular health and diseases in China 2021:an updated summary. J Geriatr Cardiol 2023; 20: 1-32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Lusis AJ. Atherosclerosis. Nature 2000; 407: 233-41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Moriya J. Critical roles of inflammation in atherosclerosis. J Cardiol 2019; 73: 22-7. [DOI] [PubMed] [Google Scholar]
  • 6. Lu Z, Zhang X, Li Y, et al. TLR4 antagonist reduces early-stage atherosclerosis in diabetic apolipoprotein E-deficient mice. J Endocrinol 2013; 216: 61-71. [DOI] [PubMed] [Google Scholar]
  • 7. Roshan M, Amos T, Pace NP. The role of TLR2, TLR4, and TLR9 in the pathogenesis of atherosclerosis. Int J Inflam 2016; 1532832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hayashi C, Papadopoulos G, Gudino CV, et al. Protective role for TLR4 signaling in atherosclerosis progression as revealed by infection with a common oral pathogen. J Immunol 2012; 189: 3681-88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. BjoRkbacka H, Kunjathoor VV, Moore K J, et al. Reduced atherosclerosis in MyD88-null mice links elevated serum cholesterol levels to activation of innate immunity signaling pathways. Nat Med 2004; 10: 416-21. [DOI] [PubMed] [Google Scholar]
  • 10. Monaco C, Paleolog E. Nuclear factor κB: a potential therapeutic target in atherosclerosis and thrombosis. Cardiovasc Res 2004; 61: 671-82. [DOI] [PubMed] [Google Scholar]
  • 11. Li L, Yang N, Nin L, et al. Chinese herbal medicine formula Taohong Siwu decoction protects against cerebral ischemia-reperfusion injury via PI3K/Akt and the Nrf2 signaling pathway. J Nat Med 2015; 69:76-85. [DOI] [PubMed] [Google Scholar]
  • 12. Ma Q, Li PL, Hua YL, et al. Effects of Tao-Hong-Si-Wu decoction on acute blood stasis in rats based on a LC-Q/TOF-MS metabolomics and network approach. Biomed Chromatogr 2018; 32: e4144. [DOI] [PubMed] [Google Scholar]
  • 13. Chen FF, Wang MM, Xia WW, et al. Taohong Siwu decoction promotes angiogenesis after cerebral ischaemia in rats via platelet microparticles. Chin J Nat Med 2020; 18: 620-7. [DOI] [PubMed] [Google Scholar]
  • 14. Deng J, Li C, Wang H, et al. Amygdalin mediates relieved atherosclerosis in apolipoprotein E deficient mice through the induction of regulatory T cells. Biochem Biophys Res Commun 2011; 411: 523-9. [DOI] [PubMed] [Google Scholar]
  • 15. Wang Y, Jia Q, Zhang Y, et al. Amygdalin attenuates atherosclerosis and plays an anti-inflammatory role in ApoE knock-out mice and bone marrow-derived macrophages. Front Pharmacol 2020; 11: 590929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Li H, Jiao Y, Xie M. Paeoniflorin ameliorates atherosclerosis by suppressing TLR4-mediated NF-κB activation. Inflammation 2017; 40: 2042-51. [DOI] [PubMed] [Google Scholar]
  • 17. Zhang X, Wang D, Ren X, et al. System Bioinformatic approach through molecular docking, network pharmacology and microarray data analysis to determine the molecular mechanism underlying the effects of Rehmanniae Radix Praeparata on cardiovascular diseases. Curr Protein Pept Sci 2019; 20: 964-75. [DOI] [PubMed] [Google Scholar]
  • 18. Wu YC, Hsieh CL. Pharmacological effects of Radix Angelica Sinensis (Danggui) on cerebral infarction. Chin Med 2011; 6: 32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Tu Y, Xue Y, Guo D, et al. Carthami flos: a review of its ethnopharmacology, pharmacology and clinical applications. Rev Bras Farmacogn 2015; 25: 553-66. [Google Scholar]
  • 20. Bu Y, Zhao P, Ke W. Clinical study of Taohong Siwu Tang for diabetes of phlegm and blood stasis type with carotid atherosclerosis. Xin Zhong Yi 2018; 50: 103-5. [Google Scholar]
  • 21. Saikia S, Bordoloi M. Molecular docking: challenges, advances and its use in drug discovery perspective. Curr Drug Targets 2019; 20: 501-21. [DOI] [PubMed] [Google Scholar]
  • 22. Huang S, Chen Y, Pan L, et al. Exploration of the potential mechanism of Taohong Siwu decoction for the treatment of breast cancer based on network pharmacology and in vitro experimental verification. Front Oncol 2021; 11: 731522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Kim HM, Park BS, Kim JI, et al. Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran. Cell 2007; 130: 906-17. [DOI] [PubMed] [Google Scholar]
  • 24. Bovijn C, Desmet AS, Uyttendaele I, et al. Identification of binding sites for myeloid differentiation primary response gene 88 (MyD88) and toll-like receptor 4 in MyD88 adapter-like (Mal). J Biol Chem 2013; 288: 12054-66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Qin J, Clore GM, Kennedy WMP, et al. Solution structure of human thioredoxin in a mixed disulfide intermediate complex with its target peptide from the transcription factor NF kappa B. Structure 1995; 3: 289-97. [DOI] [PubMed] [Google Scholar]
  • 26. Liu Y, Grimm M, Dai W, et al. CB-Dock: a web server for cavity detection-guided protein-ligand blind docking. Acta Pharmacol Sin 2020; 41: 138-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Taleb S. Inflammation in atherosclerosis. Arch Cardiovasc Dis 2016; 109: 708-715. [DOI] [PubMed] [Google Scholar]
  • 28. Falk E. Pathogenesis of atherosclerosis. J Am Coll Cardiol 2006; 47: C7-12. [DOI] [PubMed] [Google Scholar]
  • 29. Ivanova EA, Myasoedova VA, Melnichenko AA, et al. Small dense low-density lipoprotein as biomarker for atherosclerotic diseases. Oxid Med Cell Longev 2017; 2017: 1273042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Rhoads JP, Major AS. How oxidized low-density lipoprotein activates inflammatory responses. Crit Rev Immunol 2018; 38: 333-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Li B, Xia Y, Hu B. Infection and atherosclerosis: TLR-dependent pathways. Cell Mol Life Sci 2020; 77: 2751-69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Zhang Y, Ren P, Kang Q, et al. Effect of tetramethylpyrazine on atherosclerosis and SCAP/SREBP-1c signaling pathway in ApoE-/- mice fed with a high-fat diet. Evid-Based Compl Alt 2017; 2017: 3121989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Chen Z, Gao X, Jiao Y, et al. Tanshinone ⅡA exerts anti-inflammatory and immune-regulating effects on vulnerable atherosclerotic plaque partially via the TLR4/MyD88/NF-κB signal pathway. Front Pharmacol 2019; 10: 850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Xie X, Shi X, Liu M. The roles of TLR gene polymorphisms in atherosclerosis: a systematic review and Meta-analysis of 35 317 subjects. Scand J Immunol 2017; 86: 50-8. [DOI] [PubMed] [Google Scholar]
  • 35. Xu XH, Shah PK, Faure E, et al. Toll-like receptor-4 is expressed by macrophages in murine and human lipid-rich atherosclerotic plaques and upregulated by oxidized LDL. Circulation 2001; 104: 3103-8. [DOI] [PubMed] [Google Scholar]
  • 36. Bayer AL, Alcaide P. MyD88: At the heart of inflammatory signaling and cardiovascular disease. J Mol Cell Cardiol 2021; 161: 75-85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Liu T, Zhang L, Joo D, et al. NF-κB signaling in inflammation. Signal Transduct Target Ther 2017; 2: 17023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Gragnano F, Calabro P. Role of dual lipid-lowering therapy in coronary atherosclerosis regression: evidence from recent studies. Atherosclerosis 2018; 269: 219-28. [DOI] [PubMed] [Google Scholar]
  • 39. Kouhpeikar H, Delbari Z, Sathyapalan T, et al. The effect of statins through mast cells in the pathophysiology of atherosclerosis: a review. Curr Atheroscler Rep 2020; 22: 19. [DOI] [PubMed] [Google Scholar]
  • 40. Li H, Dai M, Jia W. Paeonol attenuates high-fat-diet-induced atherosclerosis in rabbits by anti-inflammatory activity. Planta Med 2009; 75: 7-11. [DOI] [PubMed] [Google Scholar]
  • 41. Wu H, Song A, Hu W, et al. The anti-atherosclerotic effect of paeonol against vascular smooth muscle cell proliferation by up-regulation of autophagy via the AMPK/mTOR signaling pathway. Front Pharmacol 2018; 8: 948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Kosmas CE, Martinez I, Sourlas A, et al. High-density lipoprotein (HDL) functionality and its relevance to atherosclerotic cardiovascular disease. Drugs in Context 2018; 7: 212525. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Traditional Chinese Medicine are provided here courtesy of Journal of Traditional Chinese Medicine

RESOURCES