Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2024 Jan 8;17:14. doi: 10.1186/s13071-023-06106-3

A novel detection method based on MIRA-CRISPR/Cas13a-LFD targeting the repeated DNA sequence of Trichomonas vaginalis

Zhenke Yang 1, Jinghui Wang 1, Yiming Qi 1, Yiping Shi 1, Fakun Li 1, Weijuan Wang 2, Xiaowei Tian 1, Xuefang Mei 1, Zhenchao Zhang 1,, Shuai Wang 1,
PMCID: PMC10775430  PMID: 38191422

Abstract

Background

Trichomonas vaginalis is a protozoan parasite, widely recognized as the most prevalent non-viral sexually transmitted infection (STI) globally. This infection is linked to various complications, including pelvic inflammatory disease, adverse pregnancy outcomes, and an increased risk of acquiring HIV. Current molecular detection methods for T. vaginalis are often costly and technically challenging.

Methods

We developed a novel detection method for T. vaginalis using a multi-enzyme isothermal rapid amplification–clustered regularly interspaced short palindromic repeats (MIRA-CRISPR)/Cas13a-lateral flow device (LFD). This assay targets the repeated DNA sequence (GenBank: L23861.1) of T. vaginalis and is performed at a constant temperature of 37 °C for approximately 1 hour.

Results

The detection limit of genomic DNA (gDNA) using our protocol was 1 × 10–4 ng/μl. Specificity was confirmed by the absence of cross-reaction with gDNA from various other microorganisms such as Staphylococcus aureus, Lactobacillus taiwanensis, Escherichia coli, Monilia albicans, Giardia lamblia, or Toxoplasma gondii. Among 30 clinical samples tested, the positive rates of T. vaginalis detection were 33.33% (10/30) by wet mount microscopy, 40% (12/30) by nested polymerase chain reaction (PCR), 40% (12/30) by MIRA-CRISPR/Cas13a-LFD, and 40% (12/30) by the culture method. Compared with the culture method, the gold standard for diagnosing trichomoniasis, wet mount microscopy showed a sensitivity of 83.3% and moderate diagnostic agreement (kappa value = 0.87). Both nested PCR and MIRA-CRISPR/Cas13a-LFD exhibited 100% sensitivity and excellent diagnostic agreement (kappa value = 1).

Conclusions

The MIRA-CRISPR/Cas13a-LFD method is a convenient, rapid, stable, and accurate diagnostic tool for detecting T. vaginalis. This method has the potential to enhance the diagnosis and management of vaginitis, offering a significant improvement over existing diagnostic techniques.

Graphical Abstract

graphic file with name 13071_2023_6106_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1186/s13071-023-06106-3.

Keywords: Trichomonas vaginalis, CRISPR/Cas13a, Diagnosis, Visualized, Lateral flow device

Background

Trichomonas vaginalis is a flagellated, protozoan parasite, recognized as the most common non-viral sexually transmitted infection (STI) globally, with an estimated 276 million new cases reported annually; the global prevalence of trichomoniasis has been estimated at 5.3% in females and 0.6% in males, with a growing trend [1, 2]. Despite its ubiquity, it is often underdiagnosed and undertreated due to its asymptomatic nature in a significant proportion of cases [3]. However, when symptoms do occur, they can lead to serious health complications, including pelvic inflammatory disease, adverse pregnancy outcomes, and increased susceptibility to HIV [4]. Moreover, pregnant women afflicted with this infection may be at higher risk of premature birth and lower birth weight [5]. Hence, prompt and accurate identification of T. vaginalis is of utmost significance from a clinical standpoint.

Currently, diagnostic approaches for T. vaginalis infection predominantly involve wet mount microscopy, culture techniques, antigen detection, loop-mediated isothermal amplification (LAMP), and nucleic acid amplification tests (NAATs) [69]. However, these techniques have considerable limitations. Wet mount microscopy, while quick and inexpensive, suffers from low sensitivity, and the culture method, despite its high sensitivity, is time-consuming and labor-intensive [10]. Antigen detection lacks sensitivity, particularly in males, while NAATs, though highly sensitive and specific, require sophisticated laboratory equipment and skilled personnel, and are relatively costly [11]. These constraints hinder the broad implementation of these diagnostic methods, especially in resource-limited settings.

Multi-enzyme isothermal rapid amplification (MIRA) is an isothermal amplification method that combines multiple enzymes to achieve rapid and efficient amplification of target nucleic acids. MIRA has been widely applied in diagnostic settings due to its advantages such as simplicity, rapidity, and sensitivity. It has been used for the detection of various pathogens, including bacteria and viruses [12, 13]. However, MIRA also has some limitations. One major drawback is the potential for non-specific amplification, leading to false-positive results. This can occur due to primer–dimer formation, off-target binding, or the presence of non-specific DNA templates.

The clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins were initially discovered as part of the bacterial immune system, enabling the recognition and cleavage of foreign genetic material [14]. The Cas13a protein, in particular, has been repurposed for diagnostic applications due to its ability to cleave RNA sequences with high precision. The system operates by programming the Cas13a protein with a guide RNA (gRNA) that targets a specific RNA sequence of interest. Upon successful recognition of the target RNA, Cas13a is activated and exhibits collateral cleavage activity, indiscriminately targeting nearby RNA molecules. This collateral cleavage activity can be harnessed as a signal for the detection of the pathogenic RNA, providing a sensitive and specific diagnostic tool [15]. Given the outstanding specificity of the CRISPR/Cas13 system in RNA recognition, its combination with isothermal amplification technology (IAT) proves to be a potent solution for addressing limitations related to specificity in pathogen detection. Numerous studies have showcased the efficacy of CRISPR/Cas13a in detecting various pathogens, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [16], Ebola virus [17], and Schistosoma japonicum [18].

In this study, we present a novel diagnostic approach for T. vaginalis, combining MIRA, CRISPR/Cas13a, and lateral flow device (LFD) targeting. Isothermal amplification simplifies the nucleic acid amplification process by eliminating the need for thermal cycling, thus reducing the complexity and cost [19]. CRISPR/Cas13a is known for its high sensitivity and specificity in RNA targeting and cleavage, allowing for accurate identification of the pathogen [20]. Lastly, LFDs offer a user-friendly, rapid, and visual detection method [21]. We believe that this integrated diagnostic approach could significantly improve the detection of T. vaginalis, offering a solution that is not only rapid and highly accurate but also suitable for point-of-care testing, particularly in resource-constrained environments.

Methods

Plasmid construction and primers

The T. vaginalis repeated element (GenBank: L23861.1) is composed of more than 100 genes of similar sequences in the genome, based on analysis using the Basic Local Alignment Search Tool (BLAST) in the National Center for Biotechnology Information (NCBI) database (data not shown), and therefore is considered the potential optimal target for T. vaginalis diagnosis. In this study, we amplified the sequence of a 1019-base-pair fragment from T. vaginalis genomic DNA (gDNA) using the primers below (forward: 5′-cccgaattcCACACCCCAAACTTGCAATGACACT-3′, reverse: 5′-cccaagcttGGATGGGAAATTAAGGGTAATTTTCCA-3′), and cloned the fragment into vector pUC19 (Vazyme, China) with HindIII and EcoRI to construct pUC19-L23861.1 positive recombinant plasmid. The plasmid was used as standard nucleic acids to quantify the sequences with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). Then, the recombinant plasmids were prepared with a dilution range of 1 ng/μl to 1 × 10−9 ng/μl as a standard control and stored at −20 °C for further use. All the primers used in this study are listed in Table 1.

Table 1.

Primers and probes used in this study

Primers Sequences (5′–3′) Description
TV-F1 TCCATTAAGAAACCTCAAGAGATGACAAGAG
TV-F2 ATTGCTTATGAATTCGACATGGGATATTCC
TV-F3 ACCCCAAACTTGCAATGACACTCAAATTGC
TV-R1 TAATACGACTCACTATAGGGACTGAGGGTAAGACCAATGTTCGACAATAG
TV-R2 TAATACGACTCACTATAGGGTTGTTGTAGTTGTCAAGGACTGCCTTTGCG

Candidates for MIRA primers screened in this study

TV-F5/TV-R5 pair was used for follow-up experimental tests

(this paper)

TV-R3 TAATACGACTCACTATAGGGACCTTCACTTTGGATTTGACTTCGGAGAAG
TV-F4 TCGACATGGGATATTCCATTAAGAAACCTC
TV-F5 ACTTGCAATGACACTCAAATTGCTTATGAA
TV-F6 ACACCCCAAACTTGCAATGACACTCAAATTGCTTA
TV-F7 TGCAATGACACTCAAATTGCTTATGAATTCG
TV-R4 TAATACGACTCACTATAGGGTTGCGAACTGAGGGTAAGACCAATGTTCGACAATAGGT
TV-R5 TAATACGACTCACTATAGGGTACTAAGCCACTTTGACCTTGAGTGAATTCGTACTTC
TV-R6 TAATACGACTCACTATAGGGAATGTTCGACAATAGGTTTTAATGTGGTTACTAAGCCAC
TV-R7 TAATACGACTCACTATAGGGAGACCAATGTTCGACAATAG
TV-crRNA GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUUAUGAGAAGGUCGACAACUUUGUUGAA

crRNA

(this paper)

13U-FB-reporter FAM-UUUUUUUUUUUUU-Bio Reporter
6U-FB-reporter FAM-UUUUUU-Bio
TV-8S TCTGGAATGGCTGAAGAAGACG Nested PCR primers [26] (actin gene)
TV-9R CAGGGTACATCGTATTGGTC
TV-10S CAGACACTCGTTATCG
TV-11R CGGTGAACGATGGATG

TV Trichomonas vaginalis, FB FAM (carboxyfluorescein) and biotin

Parasites

The T. vaginalis strain used in this study was isolated from the vaginal secretions of female patients diagnosed with trichomoniasis. The strain was identified as actin genotype E, which is the predominant genotype in Xinxiang City, Henan Province, China [22]. Following the protocol outlined in our previous study [23], T. vaginalis was cultured in complete TYM (trypticase–yeast extract–maltose) medium at 37 °C in a humidified chamber with 5% CO2. The parasites were harvested from the stationary phase by centrifugation, and DNA extraction was performed using 5 × 106 trophozoites for subsequent analyses.

DNA extraction and DNA samples

Trophozoites of T. vaginalis were washed three times with phosphate-buffered saline (PBS) (pH 7.4) and then isolated by centrifugation (1500×g, 5 min). The DNA extraction from T. vaginalis trophozoites was performed using commercial kits (#D3396, Omega Bio-tek, USA) following the manufacturer's instructions. The DNA samples used in this study, including Staphylococcus aureus, Lactobacillus taiwanensis, Escherichia coli, Monilia albicans, Giardia lamblia, and Toxoplasma gondii, were obtained from the Department of Pathogenic Biology, Xinxiang Medical University. All DNA samples were stored at −20 °C before use.

MIRA-CRISPR/Cas13a-LFD assay

The MIRA reactions were conducted utilizing the MIRA basic kit (#WLB8201KIT, Amp-Future Biotech Co., China). Briefly, each assay comprised a final reaction volume of 50 µl, consisting of buffer A (29.4 µl), DNA template (10 µl), double-distilled water (ddH2O) (4.1 µl), forward primer (2 µl), reverse primer (2 µl), and 2.5 µl of buffer B. Incubation of the mixture was carried out at 37 °C for 30 min. Positive control was established using positive plasmid pUC19-L23861.1, while ddH2O served as the blank control for each batch of MIRA reaction mixture.

Following the MIRA reaction, the resulting MIRA products served as the input for the CRISPR/Cas13a-LFD assay in a total reaction volume of 10 μl. Specifically, 1 μl of MIRA products was combined with the CRISPR reaction mixture, including 1 μl of CRISPR RNA (crRNA) probe (1 μM) (see Table 1), 1 μl of LwCas13a nuclease (5 μM) (#EDE0001, Editgene, China), 1 μl of lateral flow reporter molecule (1 μM) (see in Table 1), RNase inhibitor (1 μl, 40U/μl) (New England Biolabs, USA), ATP (1 μl, 100 mM), GTP (1 μl, 100 mM), UTP (1 μl, 100 mM), CTP (1 μl, 100 mM) (#B600059-0001 NTP Set Solution, Sangon Biotech, China), and T7 polymerase (1 μl, 50U/μl) (#DD4101-02, Vazyme, China). After thorough mixing and incubation at 37 °C for 30 min, 20 μl of ddH2O was added to the 10 μl reaction, followed by another round of thorough mixing. The mixture was then inserted into the LFD (#JY0301, Tiosbio, China) and incubated for 3 min while recording the results until the positive control line became visible. No components of this assay were constructed in our laboratory, and all molecular tools were commercially available.

Specificity and sensitivity tests

To assess the analytical specificity of the MIRA-CRISPR/Cas13a-LFD assay developed in this study, nucleic acids from various microorganisms were employed as templates for the MIRA reaction. Specifically, the nucleic acids of S. aureus, L. taiwanensis, E. coli, M. albicans, G. lamblia, and T. gondii were included. For sensitivity analysis of the MIRA-CRISPR/Cas13a-LFD assay, 10-fold serial dilutions of recombinant plasmids were prepared, ranging from 1 × 10–7 ng/μl to 1 × 10–9 ng/μl, as well as genomic DNA (gDNA) ranging from 1 × 10–2 ng/μl to 1 × 10–4 ng/μl. In some experiments, duplicates were performed using recombinant plasmid as the positive control, while ddH2O served as the negative control.

Clinical samples used in this study

Vaginal secretions were obtained from 30 women presenting clinical symptoms of trichomoniasis at the Third Affiliated Hospital of Xinxiang Medical University, following collection by medical staff using swabs; the volume of each sample was approximately 1 ml. To establish T. vaginalis cultures, clinical samples (50 μl) were inoculated into fresh TYM medium and incubated at 37 °C in a 5% CO2 environment for 72 h. For DNA extraction, 800 μl of the sample was processed using the E.Z.N.A.® Tissue DNA kit (#D3396-02, Omega Bio-tek, USA). Following DNA extraction, 100 ng of DNA was utilized for each reaction in nested PCR, and 100 pg of DNA was employed for MIRA-CRISPR/Cas13a-LFD detection.

Wet mount microscopy

The wet mount microscopy followed a procedure described in a previous study [24]. Briefly, a small amount of the collected vaginal discharge was smeared on a clean glass microscope slide, and a drop of saline (0.9% NaCl solution) was added. Next, a cover slip was carefully placed over the sample on the slide to avoid any air bubbles that might distort the view. The wet mount was then immediately examined under the microscope, starting with the low-power objective (×10) to locate the field and then switching to the high-power objective (×40) to look for T. vaginalis, which are pear-shaped protozoa with four anterior flagella and an undulating membrane. If motile T. vaginalis were seen, the test was positive. If no T. vaginalis were seen, the test was negative.

Nested PCR

The actin gene (GenBank: AF237734) was chosen as the target gene for nested PCR amplification [25]. Based on primer sequences reported in the literature [26], the nested PCR was performed in two rounds. In the first round, the PCR amplification system contained 2× Taq Plus Master Mix (Dye Plus) Enzyme (12.5 μl), 1 μl each of upstream and downstream primers, 1 μl of template, and ddH2O to reach a final volume of 25 μl. The first round of PCR included an initial denaturation step at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, and extension at 72 °C for 1 min. A final extension was performed at 72 °C for 5 min. For the second round, 2 μl of the product from the first round was used as the template. The reaction mixture for the second round contained 2× Dye Plus Enzyme (25 μl), 2 μl each of upstream and downstream primers, and ddH2O to reach a final volume of 50 μl. The second round of PCR followed a similar protocol with an initial denaturation step at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 50 °C for 15 s, and extension at 72 °C for 1 min. A final extension was performed at 72 °C for 5 min. The amplified products were then analyzed using 1.0% agarose gel electrophoresis.

Statistical analysis

Statistical analysis was performed to evaluate the diagnostic performance of wet mount microscopy, culture, nested PCR, and MIRA-CRISPR/Cas13a-LFD assays in this study. Key parameters including sensitivity and specificity were calculated. The diagnostic standard employed for comparison was the culture method. The level of agreement between each diagnostic method and culture was assessed using the kappa test in SPSS version 27.0. The agreement between the diagnostic methods and culture was categorized based on kappa values, as follows: excellent (1.00–0.81), substantial (0.80–0.61), moderate (0.60–0.41), weak (0.40–0.21), and negligible (0.20–0) [27]. This analysis enabled the determination of the level of agreement between each method and the gold standard culture, providing insight into the diagnostic performance of the different assays.

Results

Rapid detection strategy for T. vaginalis

In the pursuit of rapid and visualized diagnostic strategies for T. vaginalis, we have meticulously designed a detailed process as illustrated in Fig. 1. The diagnostic protocol commences with the amplification of the target sequence via MIRA. This amplified product is subsequently transcribed into single-stranded RNA (ssRNA) using the T7 RNA polymerase promoter. A crRNA was meticulously selected as a probe to target the specific ssRNA. Upon recognition of the target ssRNA, the non-specific ribonuclease endonuclease activity of the CRISPR/Cas13a complex is activated, resulting in cleavage of the probe substrate. In the absence of trans-cleavage, the carboxyfluorescein (FAM)/biotin (FB) reporter remains undamaged, allowing its biotinylated end to be captured by streptavidin at the control line. This then permits the anti-FAM antibody-conjugated gold nanoparticles to bind to the exposed FAM moiety, which results in a color deposit at the control line. The appearance of only the control band (blue band) is indicative of negative test results, implying unsuccessful amplification of the target gene fragment within the sample. Conversely, when the FB reporter is subjected to trans-cleavage by Cas13a, biotin will occupy a section of the reporter molecules, replacing FAM. Consequently, fewer FAM ends will be visible at the control line, while a greater number of antibody-conjugated gold nanoparticles are likely to aggregate at the test line. If both the test line and control line, or solely the test line, are visible, the test is deemed positive. This would signify the successful detection of the T. vaginalis target gene within the samples.

Fig. 1.

Fig. 1

Schematic for T. vaginalis detection with the MIRA-CRISPR/Cas13a-LFD assay

Trichomonas vaginalis repeat DNA sequence (L23861.1) as target for diagnosis

To maximize the amplification efficiency of our target gene and enhance diagnostic sensitivity, we selected the repetitive DNA sequence (L23861.1) of T. vaginalis as the target gene. Initially, we designed three sets of MIRA primers, namely TV-F1/F2/F3 and TV-R1/R2/R3 (Table 1).

Using positive plasmid as the template and TV-R1 as the reverse primer, we assessed the efficacy of MIRA forward primers. Our results showed better amplification efficiency for TV-F3 (Additional file 1: Figure S1A). Subsequently, when using TV-F3 as the forward primer, TV-R1 exhibited the highest amplification efficiency (Additional file 1: Figure S1B). Performance testing was then carried out on the primer pair TV-F3 and TV-R1 using plasmid templates at varying concentrations, including 10 pg/μl, 1 pg/μl, 100 fg/μl, 10 fg/μl, 1 fg/μl, and 0.1 fg/μl. Notably, sensitivity as low as 10 fg/μl was observed (Additional file 1: Figure S1C). These findings prompted us to redesign four primer pairs and subsequently subject them to a screening process. Remarkably, TV-F5 and TV-R5 exhibited excellent specificity and demonstrated sensitivity of 0.1 fg/μl when utilizing the template plasmid (Fig. 2A–C).

Fig. 2.

Fig. 2

Primer selection for MIRA of T. vaginalis repetitive DNA sequence. A Screening of the optimal reverse primer using TV-F3 as the forward primer. B Screening of the optimal forward primer using TV-R5 as the reverse primer. C Sensitivity testing of the TV-F5/TV-R5 primer pair using positive plasmid template concentrations as follows. 1: 1 × 10–2 ng/μl;2: 1 × 10–3 ng/μl; 3: 1 × 10–4 ng/μl; 4: 1 × 10–5 ng/μl; 5: 1 × 10–6 ng/μl; 6: 1 × 10–7 ng/μl. NC negative control

MIRA time and temperature optimization

To enhance the performance of isothermal amplification in vitro, we conducted optimization of amplification time and temperature by creating gradients of both variables. Our findings indicate that the most favorable amplification efficiency of MIRA was achieved after 30 min at a temperature of 37 °C (Fig. 3A and B).

Fig. 3.

Fig. 3

MIRA time and temperature optimization. A Optimal reaction time for MIRA assay. Saturation amplification was achieved within 30 min. B Temperature optimization for MIRA from 25 °C to 45 °C; the highest amplification efficiency was observed at 37 °C. NC negative control

MIRA-CRISPR/Cas13a-LFD system for T. vaginalis detection

If an excessive number of probes are present in the system, it may result in the saturation of the C line of LFD by uncut probes, and this saturation can lead to their leakage through to the T line, causing false-positive results [28]. Hence, we performed preliminary tests to assess the impact of probe concentrations on the reliability of the results. Our investigation revealed that when employing CRISPR probes at concentrations of 500, 200, 100, and 50 nM for direct lateral flow detection, devices in the 500 nM concentration group exhibited a notable occurrence of false-positive bands, while the other concentration groups did not display such issues (Additional file 2: Fig S2). Thus, to maintain the reliability of our results, the probe concentration was kept below 200 nM. The pUC19-L23861.1 plasmid (10 fg/μl) was used as template and amplified using MIRA with TV-F5 and TV-R5 primers, employing conditions of 37 °C for 30 min. Based on the crRNA and the FAM-13U-biotin reporter (13U-FB reporter) [29] (Table 1), we designed and optimized a reaction system (see Methods section) for CRISPR/Cas13a-LFD detection. The results showed that compared with the control group, the plasmid group exhibited strong and distinct bands (Fig. 4A). To further optimize the system, we designed a new probe, FAM-6U-biotin reporter (6U-FB reporter), reducing the cleaved nucleic acid chain from 13 to 6 uracil. Interestingly, when comparing the band patterns of samples with different plasmid concentrations (1 fg/μl and 1 pg/μl) under the conditions of 6U-FB reporter and 13U-FB reporter, no significant difference was observed, indicating that the probes could be used interchangeably for further experiments (Fig. 4B and C).

Fig. 4.

Fig. 4

MIRA-CRISPR/Cas13a-LFD system test for T. vaginalis detection. A MIRA-CRISPR/Cas13a-LFD system test, NC: negative control using ddH2O as template. Plasmid: testing group using 1 × 10–6 ng/μl positive plasmid as the template. B, C MIRA-CRISPR/Cas13a-LFD assay FAM-UUUUUUUUUUUUU-biotin reporter (13U-FB-reporter) and FAM-UUUUUU-biotin reporter (6U-FB-reporter) test. 1. Negative control using ddH2O as template. 2. 1 × 10–6 ng/μl positive plasmid as the template. 3. 1 × 10–3 ng/μl positive plasmid as the template

Specificity test

Using the optimized experimental parameters, we assessed the diagnostic specificity of the method employed in this study. To this end, we included gDNA samples from six common pathogens in humans, namely S. aureus, L. taiwanensis, E. coli, M. albicans, G. lamblia, and T. gondii, as controls for MIRA isothermal amplification. It is worth mentioning that despite the presence of significant non-specific bands observed during the MIRA isothermal amplification process (Fig. 5A), the CRISPR/Cas13a complex exhibited no recognition of off-target gene sequences. Consequently, the probe remained intact without undergoing cleavage, leading to negative LFD results (Fig. 5B). This finding underscores the robustness of our approach in identifying T. vaginalis.

Fig. 5.

Fig. 5

MIRA-CRISPR/Cas13a-LFD specificity test. A Specificity analysis of MIRA assay. B Specificity analysis of MIRA-CRISPR/Cas13a-LFD assay. 1. Trichomonas vaginalis; 2. Staphylococcus aureus; 3. Lactobacillus taiwanensis; 4. Escherichia coli; 5. Monilia albicans; 6. Giardia lamblia; 7. Toxoplasma gondii; NC: negative control using ddH2O as template

Sensitivity test

The sensitivity of this diagnosis system was evaluated using serial dilutions of positive plasmid and T. vaginalis genomic DNA. We found that our MIRA-CRISPR/Cas13a-LFD system could reliably detect as little as 0.01 fg/μl of positive plasmid and 1 pg/μl of T. vaginalis gDNA. When the plasmid concentration was 0.001 fg/μl and the genomic DNA concentration was 100 fg/μl, the test's positivity rate also reached 75% (3/4) (Fig. 6A and B).

Fig. 6.

Fig. 6

MIRA-CRISPR/Cas13a-LFD sensitivity test. Different concentrations of positive plasmid DNA (A) and T. vaginalis gDNA (B) were used for the MIRA-CRISPR/Cas13a-LFD assay. A 1: Negative control; 2–5: 0.1 fg/μl; 6–9: 0.01 fg/μl; 10–13: 0.001 fg/μl. B 1: Negative control; 2–5: 10 pg/μl; 6–9: 1 pg/μl; 10–13: 100 fg/μl

Assessment of the MIRA–Cas13a–LFD assay on clinical samples

Vaginal discharge samples were collected from 30 patients clinically diagnosed with vaginitis. These samples were concurrently tested using four different diagnostic methods: conventional culture method (gold standard), wet mount microscopy, nested PCR, and the newly developed MIRA-CRISPR/Cas13a-LFD technique presented in this study. Out of the 30 samples tested, the positive detection rates yielded by the culture method, wet mount microscopy, nested PCR (Fig. 7A), and MIRA-CRISPR/Cas13a-LFD (Fig. 7B and C) were 40% (12/30), 33.3% (10/30), 40% (12/30), and 40% (12/30), respectively. When compared with the gold standard culture method, the sensitivity of the wet mount microscopy was only 83.3%. In contrast, both nested PCR and the MIRA-CRISPR/Cas13a-LFD methods demonstrated 100% efficiency, aligning perfectly with the results of the culture method.

Fig. 7.

Fig. 7

Trichomonas vaginalis detected in clinical samples via MIRA-CRISPR/Cas13a-LFD and other methods A Nested PCR diagnosis of 30 samples presenting symptoms of trichomoniasis. PC positive control, NC negative control. B MIRA direct diagnosis of the 30 clinical samples. C MIRA-CRISPR/Cas13a-LFD assay platform results of 30 female samples were interpreted using an LFD sensor

To evaluate the level of agreement between these diagnostic methods and the gold standard, a kappa statistical analysis was performed. The wet mount microscopy method only reached a kappa value of 0.87, suggesting that this method often results in missed detection. On the other hand, both nested PCR and the MIRA-CRISPR/Cas13a-LFD methods achieved a kappa value of 1, showing an excellent level of agreement with the gold standard culture method (Table 2). These results suggest that the MIRA-CRISPR/Cas13a-LFD method is not only convenient and quick but also stable and accurate and would potentially enhance the diagnosis and management of vaginitis.

Table 2.

Comparison of methods for detection of T. vaginalis by testing clinical samples (n = 30)

Method No. positive Positive rate (%) Sensitivity (%) Kappa
Wet mount microscopy 10 33.3 83.3 0.87
Nested PCR 12 40 100 1
MIRA-CRISPR/Cas13a-LFD 12 40 100 1
Culture 12 40 100 1

The sensitivity of the tests was determined using the culture method as the standard

Discussion

Trichomonas vaginalis is a flagellated protozoan parasite that is primarily known to cause trichomoniasis, one of the most common non-viral STIs globally [30]. The clinical manifestations of the infection range from asymptomatic to severe inflammatory disease. Given the widespread prevalence and significant health consequences of T. vaginalis infection, there is an urgent need for rapid, accurate, and easily interpretable diagnostic methods. Early and accurate detection of T. vaginalis not only can facilitate timely treatment and prevent adverse health outcomes, but can also aid in reducing transmission rates [31].

Nested PCR has long been established as a sensitive and reliable method for the detection of various pathogens, including T. vaginalis [32]. Our study confirmed that nested PCR maintains sensitivity and specificity on par with the gold standard in pathogen detection, effectively identifying T. vaginalis. However, the inherent sensitivity of nested PCR comes at the cost of complexity, time, and resource requirements. It involves multiple amplification steps, increasing the risk of contamination and necessitating meticulous laboratory conditions. Additionally, the method typically requires skilled personnel and advanced laboratory infrastructure, limiting its applicability in resource-limited settings and at the point of care [33]. IAT, although slightly inferior in specificity, represents a significant advancement from nested PCR. It simplifies the amplification of target genes in direct scenarios, eliminating the need for expensive equipment, and has been developed for diagnosing T. vaginalis [34]. The integration of IAT with LFD for visualizing detection results has been successfully reported in detecting viruses [35], bacteria [36], and parasites [37]. However, its application in T. vaginalis detection remains unreported, likely due to challenges in ensuring adequate specificity. Our study demonstrates a novel detection method for T. vaginalis by combining the benefits of MIRA with the CRISPR/Cas13a system and readout in LFD format. The strength of our diagnostic approach lies in its ability to leverage CRISPR/Cas13a's non-specific ribonuclease activity upon target recognition, which yields clear and concise diagnostic outcomes on a lateral flow dipstick.

In this study, the MIRA-CRISPR/Cas13a-LFD system showed remarkable efficiency and sensitivity in amplifying and detecting the T. vaginalis repeat DNA sequence (L23861.1), and the system's capacity to accurately detect as low as 10 fg/µl of the target gene with no false-positive results is noteworthy. One of the main findings of our study is the remarkable specificity of the MIRA-CRISPR/Cas13a-LFD system, even in the presence of non-specific bands observed during the MIRA isothermal amplification process. This implies that the CRISPR/Cas13a system could effectively avoid off-target gene sequences, thereby minimizing false positives, which is a significant challenge in diagnostic tests.

The differential detection capability of our proposed method is notable, distinguishing T. vaginalis from several other microorganisms including L. taiwanensis, E. coli, G. lamblia, S. aureus, and M. albicans. This is critical in clinical settings, where accurate diagnosis is paramount for successful treatment.

Further, in a clinical setting, our system consistently exhibited robust diagnostic results. The detection rate of our system, when compared with the conventional culture method (gold standard), wet mount microscopy, and nested PCR, proved to be highly satisfactory. In fact, the sensitivity of the MIRA-CRISPR/Cas13a-LFD method was equivalent to nested PCR and superior to wet mount microscopy.

Intriguingly, another recent research work adopted a comparable isothermal amplification technique integrated with CRISPR-Cas12a and a lateral flow strip for the detection of T. vaginalis. Although their methodology also sidesteps the requirement for a complex laboratory apparatus, the key difference lies in our choice of target gene, which may enhance our system's sensitivity, but due to differences in the method for calculating sensitivity, it remains to be conclusively proven which technique holds the upper hand [38].

Despite the promising outcomes, certain limitations associated with our approach need to be acknowledged. First, the system’s potential for mass production and global distribution needs to be validated through further studies. Given the need for specialized manufacturing processes, the cost-effectiveness of our technique at a larger scale remains to be ascertained.

Overall, the MIRA-CRISPR/Cas13a-LFD technique presented in this study provides an efficient, accurate, and user-friendly approach for the rapid detection of T. vaginalis, thereby potentially enhancing the diagnosis and management of vaginitis.

Conclusions

In summary, this study demonstrated that the MIRA-CRISPR/Cas13a-LFD method targeting the repeated DNA element is an efficient, reliable, and rapid detection tool for T. vaginalis. The method exhibited superior sensitivity and specificity, with the capacity to discriminate between T. vaginalis and other common pathogens in humans. The speed and visual readability of the LFD readout, combined with the high amplification efficiency and selectivity of MIRA–CRISPR/Cas13a, make this method highly suitable for point-of-care testing, particularly in resource-limited settings. Future work will aim to further refine and validate the method in a larger clinical context, potentially integrating it into standard diagnostic procedures to enable quicker and more accurate detection of T. vaginalis infections.

Supplementary Information

13071_2023_6106_MOESM1_ESM.tif (6.6MB, tif)

Additional file 1: Figure S1 Primer selection for MIRA of T. vaginalis repetitive DNA sequence. (A) Screening of the optimal reverse primer using TV-R1 as the reverse primer. (B) Screening of the optimal forward primer using TV-F3 as the forward primer. (C) Sensitivity testing of the TV-F3/TV-R1 primer pair using positive plasmid template concentrations of (1) 1×10−2 ng/μl, (2) 1× 10−3 ng/μl, (3) 1× 10−4 ng/μl, (4) 1× 10−5 ng/μl, (5) 1× 10−6 ng/μl, and (6) 1× 10−7 ng/μl. NC: negative control.

13071_2023_6106_MOESM2_ESM.tif (3.5MB, tif)

Additional file 2: Figure S2 CRISPR probe concentration test.

Acknowledgements

The authors are grateful to the Xinxiang Key Laboratory of Pathogenic, Xinxiang Medical University for providing the research platform , as well as the Third Affiliated Hospital of Xinxiang Medical University, for their invaluable support in providing resources, and clinical samples essential for this research.

Author contributions

Shuai Wang and Zhenchao Zhang conceived and designed the research. Zhenke Yang, Jinghui Wang, and Yiming Qi carried out the experiments, analyzed data, and drafted the manuscript. Xiaowei Tian, Xuefang Mei, and Yiping Shi helped carry out various aspects of the experiments, and Fakun Li and Weijuan Wang collected the clinical samples. Zhenchao Zhang and Shuai Wang revised the manuscript. All authors have read and approved the final manuscript.

Funding

This work was funded by the Science and Technology Planning Project of Henan Province (nos. 232102311113 and 232102311142), the Innovation and Entrepreneurship Training Plan for College Students in Henan Province (no. 202210472055), the Doctoral Scientific Research Activation Foundation of Xinxiang Medical University (no. XYBSKYZZ202179), the Training Plan for Young Backbone Teachers in Universities of Henan Province (no. 2021GGJS101), and the Science and Technology Planning Project of Xinxiang City (no. GG2021011).

Availability of data and materials

All data generated or analyzed during this study are included in this article and additional information files.

Declarations

Ethics approval and consent to participate

This study was reviewed and approved by the Ethics Review Committee of Xinxiang Medical University (Reference No. 2020206).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Zhenchao Zhang, Email: zhangzhenchao525@163.com.

Shuai Wang, Email: tongbaiws1003@163.com.

References

  • 1.Rowley J, Vander Hoorn S, Korenromp E, Low N, Unemo M, Abu-Raddad L, et al. Global and regional estimates of the prevalence and incidence of four curable sexually transmitted infections in 2016. WHO Bulletin. 2019;97:548–562. [Google Scholar]
  • 2.Organization WH. Report on global sexually transmitted infection surveillance 2018. 2018.
  • 3.Meites E. Trichomoniasis: the “neglected” sexually transmitted disease. Infect Dis Clin. 2013;27:755–764. doi: 10.1016/j.idc.2013.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kissinger P. Trichomonas vaginalis: a review of epidemiologic, clinical and treatment issues. BMC Infect Dis. 2015;15:1–8. doi: 10.1186/s12879-015-1055-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kreisel KM, Spicknall IH, Gargano JW, Lewis FM, Lewis RM, Markowitz LE, et al. Sexually transmitted infections among US women and men: prevalence and incidence estimates, 2018. Sex Transm Dis. 2021;48:208. doi: 10.1097/OLQ.0000000000001355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Herath S, Balendran T, Herath A, Iddawela D, Wickramasinghe S. Comparison of diagnostic methods and analysis of socio-demographic factors associated with Trichomonas vaginalis infection in Sri Lanka. PLoS ONE. 2021;16:e0258556. doi: 10.1371/journal.pone.0258556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Schwebke JR, Barrientes FJ. Prevalence of Trichomonas vaginalis isolates with resistance to metronidazole and tinidazole. Antimicrob Agents Chemother. 2006;50:4209–4210. doi: 10.1128/AAC.00814-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Goo Y-K, Shin W-S, Yang H-W, Joo S-Y, Song S-M, Ryu J-S, et al. Loop-mediated isothermal amplification targeting actin DNA of Trichomonas vaginalis. Korean J Parasitol. 2016;54:329. doi: 10.3347/kjp.2016.54.3.329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Van Der Pol B, Rao A, Nye MB, Chavoustie S, Ermel A, Kaplan C, et al. Trichomonas vaginalis detection in urogenital specimens from symptomatic and asymptomatic men and women by use of the cobas TV/MG test. J Clin Microbiol. 2021 doi: 10.1128/JCM.00264-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hobbs MM, Seña AC. Modern diagnosis of Trichomonas vaginalis infection. Sexually Transmitted Infect. 2013;89:434–438. doi: 10.1136/sextrans-2013-051057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Andrea SB, Chapin KC. Comparison of APTIMA Trichomonas vaginalis transcription-mediated amplification assay and BD affirm VPIII for detection of T. vaginalis in symptomatic women: performance parameters and epidemiological implications. J Clin Microbiol. 2011;49:866–9. doi: 10.1128/JCM.02367-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sun M-L, Lai H-Y, Chong N-Y, Liu D-F, Zhang Z-Y, Pang B, et al. Simple and feasible detection of hepatitis B virus via combination of multienzyme isothermal rapid amplification and lateral flow dipstick strip. Front Mol Biosci. 2021;8:763079. doi: 10.3389/fmolb.2021.763079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Heng P, Liu J, Song Z, Wu C, Yu X, He Y. Rapid detection of Staphylococcus aureus using a novel multienzyme isothermal rapid amplification technique. Front Microbiol. 2022;13:1027785. doi: 10.3389/fmicb.2022.1027785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Shmakov S, Smargon A, Scott D, Cox D, Pyzocha N, Yan W, et al. Diversity and evolution of class 2 CRISPR-Cas systems. Nat Rev Microbiol. 2017;15:169–82. doi: 10.1038/nrmicro.2016.184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gootenberg JS, Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science. 2017;356:438–442. doi: 10.1126/science.aam9321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Casati B, Verdi JP, Hempelmann A, Kittel M, Klaebisch AG, Meister B, et al. Rapid, adaptable and sensitive Cas13-based COVID-19 diagnostics using ADESSO. Nat Commun. 2022;13:3308. doi: 10.1038/s41467-022-30862-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Barnes KG, Lachenauer AE, Nitido A, Siddiqui S, Gross R, Beitzel B, et al. Deployable CRISPR-Cas13a diagnostic tools to detect and report Ebola and Lassa virus cases in real-time. Nat Commun. 2020;11:4131. doi: 10.1038/s41467-020-17994-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.MacGregor SR, McManus DP, Sivakumaran H, Egwang TG, Adriko M, Cai P, et al. Development of CRISPR/Cas13a-based assays for the diagnosis of schistosomiasis. EBioMedicine. 2023;94:104730. doi: 10.1016/j.ebiom.2023.104730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chen H, Sun C, Wang Y, Gao X, You J, Yu W, et al. Rapid detection of SARS-CoV-2 using duplex reverse transcription-multienzyme isothermal rapid amplification in a point-of-care testing. Front Cell Infect Microbiol. 2021;11:678703. doi: 10.3389/fcimb.2021.678703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DB, et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science. 2016;353:6299. doi: 10.1126/science.aaf5573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Posthuma-Trumpie GA, Korf J, van Amerongen A. Lateral flow (immuno) assay: its strengths, weaknesses, opportunities and threats. A literature survey. Anal Bioanal Chem. 2009;393:569–82. doi: 10.1007/s00216-008-2287-2. [DOI] [PubMed] [Google Scholar]
  • 22.Zhang Z, Kang L, Wang W, Zhao X, Li Y, Xie Q, et al. Prevalence and genetic diversity of Trichomonas vaginalis clinical isolates in a targeted population in Xinxiang City, Henan Province. China Parasites Vectors. 2018;11:1–7. doi: 10.1186/s13071-018-2753-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhang Z, Song X, Zhang Z, Li H, Duan Y, Zhang H, et al. The molecular characterization and immune protection of adhesion protein 65 (AP65) of Trichomonas vaginalis. Microb Pathog. 2021;152:104750. doi: 10.1016/j.micpath.2021.104750. [DOI] [PubMed] [Google Scholar]
  • 24.Nye MB, Schwebke JR, Body BA. Comparison of APTIMA Trichomonas vaginalis transcription-mediated amplification to wet mount microscopy, culture, and polymerase chain reaction for diagnosis of trichomoniasis in men and women. Am J Obst Gynecol. 2009;200:188. doi: 10.1016/j.ajog.2008.10.005. [DOI] [PubMed] [Google Scholar]
  • 25.Crucitti T, Abdellati S, Van Dyck E, Buvé A. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR–restriction fragment length polymorphism. Clin Microbiol Infect. 2008;14:844–852. doi: 10.1111/j.1469-0691.2008.02034.x. [DOI] [PubMed] [Google Scholar]
  • 26.Crucitti T, Jespers V, Mulenga C, Khondowe S, Vandepitte J, Buvé A. Trichomonas vaginalis is highly prevalent in adolescent girls, pregnant women, and commercial sex workers in Ndola, Zambia. Sexually Transm Dis. 2010 doi: 10.1097/OLQ.0b013e3181c21f93. [DOI] [PubMed] [Google Scholar]
  • 27.Sun K, Xing W, Yu X, Fu W, Wang Y, Zou M, et al. Recombinase polymerase amplification combined with a lateral flow dipstick for rapid and visual detection of Schistosoma japonicum. Parasit Vectors. 2016;9:1–9. doi: 10.1186/s13071-016-1745-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Su G, Zhu M, Li D, Xu M, Zhu Y, Zhang Y, et al. Multiplexed lateral flow assay integrated with orthogonal CRISPR-Cas system for SARS-CoV-2 detection. Sens Actuators B Chem. 2022;371:132537. doi: 10.1016/j.snb.2022.132537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science. 2018;360:439–444. doi: 10.1126/science.aaq0179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cotch MF, Pastorek JG, Nugent RP, Hillier SL, Gibbs RS, Martin DH, et al. Trichomonas vaginalis associated with low birth weight and preterm delivery. Sexually Transm Dis. 1997 doi: 10.1097/00007435-199707000-00008. [DOI] [PubMed] [Google Scholar]
  • 31.Schwebke J, Trichomoniasis BD. Clinical microbiology reviews. Trichomoniasis Clin Microbiol Rev. 2004 doi: 10.1128/CMR.17.4.794-803.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ziaei Hezarjaribi H, Taghavi M, Fakhar M, Gholami S. Direct diagnosis of Trichomonas vaginalis Infection on archived pap smears using nested PCR. Acta Cytol. 2015;59:104–8. doi: 10.1159/000369772. [DOI] [PubMed] [Google Scholar]
  • 33.De Silva NL, De Silva VNH, Deerasinghe ATH, Rathnapala UL, Itoh M, Takagi H, et al. Development of a highly sensitive nested PCR and its application for the diagnosis of cutaneous leishmaniasis in Sri Lanka. Microorganisms. 2022 doi: 10.3390/microorganisms10050990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li F, Deng Y, Sheng W, Gao X, Wang W, Chu Z, et al. Construction a novel detection method for Trichomonas vaginalis based on recombinant enzyme polymerase amplification targeting the actin gene. J Eukaryot Microbiol. 2023 doi: 10.1111/jeu.12963. [DOI] [PubMed] [Google Scholar]
  • 35.Tu PA, Shiu JS, Lee SH, Pang VF, Wang DC, Wang PH. Development of a recombinase polymerase amplification lateral flow dipstick (RPA-LFD) for the field diagnosis of caprine arthritis-encephalitis virus (CAEV) infection. J Virol Methods. 2017;243:98–104. doi: 10.1016/j.jviromet.2017.01.023. [DOI] [PubMed] [Google Scholar]
  • 36.Bian Z, Liu W, Jin J, Hao Y, Jiang L, Xie Y, et al. Development of a recombinase polymerase amplification assay with lateral flow dipstick (RPA-LFD) for rapid detection of Shigella spp. and enteroinvasive Escherichia coli. PLoS ONE. 2022;17:e0278869. doi: 10.1371/journal.pone.0278869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Onchan W, Ritbamrung O, Changtor P, Pradit W, Chomdej S, Nganvongpanit K, et al. Sensitive and rapid detection of Babesia species in dogs by recombinase polymerase amplification with lateral flow dipstick (RPA-LFD) Sci Rep. 2022;12:20560. doi: 10.1038/s41598-022-25165-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li S, Wang X, Yu Y, Cao S, Liu J, Zhao P, et al. Establishment and application of a CRISPR-Cas12a-based RPA-LFS and fluorescence for the detection of Trichomonas vaginalis. Parasit Vectors. 2022;15:1–13. doi: 10.1186/s13071-022-05475-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13071_2023_6106_MOESM1_ESM.tif (6.6MB, tif)

Additional file 1: Figure S1 Primer selection for MIRA of T. vaginalis repetitive DNA sequence. (A) Screening of the optimal reverse primer using TV-R1 as the reverse primer. (B) Screening of the optimal forward primer using TV-F3 as the forward primer. (C) Sensitivity testing of the TV-F3/TV-R1 primer pair using positive plasmid template concentrations of (1) 1×10−2 ng/μl, (2) 1× 10−3 ng/μl, (3) 1× 10−4 ng/μl, (4) 1× 10−5 ng/μl, (5) 1× 10−6 ng/μl, and (6) 1× 10−7 ng/μl. NC: negative control.

13071_2023_6106_MOESM2_ESM.tif (3.5MB, tif)

Additional file 2: Figure S2 CRISPR probe concentration test.

Data Availability Statement

All data generated or analyzed during this study are included in this article and additional information files.


Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES