Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2023 Nov 30;103(2):103332. doi: 10.1016/j.psj.2023.103332

A novel goose-origin Tembusu virus exhibits pathogenicity in day-old chicks with evidence of direct contact transmission

Min Liu *, Yao-Yun Chen *, Ning-Chieh Twu †, Meng-Chi Wu *, Zih-Syun Fang *, Alexandre Dubruel *, Shih-Chung Chang ‡, Ching-Fen Wu †, Dan-Yuan Lo †, Hui-Wen Chen *,§,1
PMCID: PMC10776645  PMID: 38128459

Abstract

In late 2020, an outbreak of Tembusu virus (TMUV)-associated disease occurred in a 45-day-old white Roman geese flock in Taiwan. Here, we present the identification and isolation of a novel goose-origin TMUV strain designated as NTU/C225/2020. The virus was successfully isolated using minimal-pathogen-free duck embryos. Phylogenetic analysis of the polyprotein gene showed that NTU/C225/2020 clustered together with the earliest isolates from Malaysia and was most closely related to the first Taiwanese TMUV strain, TP1906. Genomic analysis revealed significant amino acid variations among TMUV isolates in NS1 and NS2A protein regions. In the present study, we characterized the NTU/C225/2020 culture in duck embryos, chicken embryos, primary duck embryonated fibroblasts, and DF-1 cells. All host systems were susceptible to NTU/C225/2020 infection, with observable lesions. In addition, animal experiments showed that the intramuscular inoculation of NTU/C225/2020 resulted in growth retardation and hyperthermia in day-old chicks. Gross lesions in the infected chicks included hepatomegaly, hyperemic thymus, and splenomegaly. Viral loads and histopathological damage were displayed in various tissues of both inoculated and naïve co-housed chicks, confirming the direct chick-to-chick contact transmission of TMUV. This is the first in vivo study of a local TMUV strain in Taiwan. Our findings provide essential information for TMUV propagation and suggest a potential risk of disease outbreak in chicken populations.

KEY WORDS: Tembusu virus, goose, day-old chick, pathogenicity, contact transmission

INTRODUCTION

Tembusu virus (TMUV), also known as duck egg drop syndrome virus, is an enveloped, positive-sense, single-stranded RNA virus belonging to the Ntaya virus group in the genus Flavivirus of the Family Flaviviridae. Originally isolated from mosquitoes of the genus Culex in peninsular Malaysia in 1955 (Platt et al., 1975), TMUV has been found to infect various hosts, including ducks (Yan et al., 2011), geese (Yun et al., 2012), chickens (Chen et al., 2014), house sparrows (Tang et al., 2013a), mice (Li et al., 2013), and humans (Olson et al., 1983; Tang et al., 2013b). While primarily transmitted by mosquitoes, studies have indicated possible evidence of contact, aerosol, and vertical transmission routes of TMUV among ducks and ducklings (Li et al., 2015; Zhang et al., 2015), suggesting potential cross-species transmission. Outbreaks of TMUV infection in ducks have led to severe economic losses in affected egg-laying duck farms in southeast China (Su et al., 2011), Malaysia (Homonnay et al., 2014), and Thailand (Thontiravong et al., 2015). Infected ducks exhibit clinical signs such as heavy egg drop, decreased feed intake, growth retardation, and neurological symptoms, including ataxia, lameness, and progressive paralysis. In China, the morbidity rate among infected ducks in 2010 was up to 90%, with mortality ranging from 5 to 15% and occasionally increasing to 30% due to secondary bacterial infections (Su et al., 2011; Zhang et al., 2017).

The identification of TMUV strains in Taiwan, including TMUV TP1906 isolated from Culex annulus mosquitoes and TMUV 1080905 isolated from a diseased Pekin duck flock, highlights the emergence of TMUV in the region (Peng et al., 2020; Chen et al., 2022). TMUV TP1906 showed high genetic similarity to the Sitiawan virus, known for causing encephalitis and growth retardation in infected chicks (Kono et al., 2000). Phylogenetic analysis revealed the clustering of Taiwanese TMUVs with Malaysian TMUVs, including the chicken-derived Sitiawan virus and the TMUV prototype strain MM1775. In October 2020, an infectious disease outbreak characterized by white diarrhea, depression, lameness, prostrate, and increased mortality occurred in a 45-day-old white Roman geese flock in Chiayi County, Taiwan. In the present study, we successfully identified and isolated the causative agent responsible for this disease outbreak, representing the first report of goose-origin TMUV in Taiwan.

Considering the wide range of host species susceptible to TMUV, including ducks, geese, and chickens, we aimed to characterize the goose-origin TMUV strain in different avian embryos and cell lines. By further exploring optimal strategies for virus propagation in certain systems, we can effectively identify the causative virus and generate stocks for research purposes. Previous studies have extensively investigated the in vivo pathogenicity of various TMUV strains in ducks, demonstrating that TMUV is pathogenic for both adult ducks and ducklings, with the disease severity being influenced by the age of the ducklings (Shen et al., 2016; Liang et al., 2019; Lv et al., 2019; Feng et al., 2020). However, our current understanding of TMUV pathogenicity in chickens remains limited. Although sporadic cases of TMUV-induced egg drop syndrome in laying hens have been reported in China (Yan et al., 2022; Yu et al., 2022), widespread TMUV infections in chicken flocks have not been documented. Given the significant chicken farming industry in Taiwan and the potential risk of virus spread, it is crucial to investigate the infectivity and pathogenicity of local TMUV strains in chickens. Therefore, the objective of this study was to culture and propagate the goose-origin TMUV in vitro and to evaluate its pathogenicity in young chickens using a specific pathogen-free (SPF) day-old chick infection model.

MATERIALS AND METHODS

Field Samples

In October 2020, an infectious disease outbreak characterized by white diarrhea, depression, lameness, prostrate, and increased mortality occurred in a 45-day-old white Roman geese flock in Chiayi County, Taiwan. The flock owner reported that the clinical signs were noted at 30 d of age, and the daily death number ranged from 10 to 20. The crude cumulative mortality rate was approximately 8.1% (210/2,600). Gross lesions of the necropsied geese were recorded. Tissue samples, including the heart, liver, spleen, lung, kidney, and trachea, were collected from each affected goose. The collected tissues were then fixed, dehydrated, embedded in paraffin, and sectioned with a thickness of 5 μm. Hematoxylin and eosin staining were performed on the deparaffinized sections for histopathological evaluation.

Detection of the Causative Agent

For molecular diagnosis, viral nucleic acid was extracted from tissue homogenates from the submitted geese using Viral Nucleic Acid Extraction Kit II (Geneaid Biotech, New Taipei, Taiwan). The extracted nucleic acid was subjected to a reverse transcription-polymerase chain reaction (RT-PCR) targeting the TMUV nonstructural protein 5 (NS5) gene with a pair of primers: TMUV NS5f (5ʹ- TTTGGTACATGTGGCTCG -3ʹ) and TMUV NS5r (5ʹ- ACTGTTTTCCCATCACGTCC -3ʹ) (Liu et al., 2012). The 1-step RT-PCR reaction mixture included 3 μL of viral RNA, 1 μL of 10 mM forward and reverse primers, 4 μL of 5× Phire Reaction Buffer (Thermo Fisher Scientific, Waltham, MA), 3 μL of 2.5 mM deoxynucleoside triphosphates, 0.5 μL of Phire Hot Start II DNA Polymerase (Thermo Fisher Scientific), 0.1 μL of M-MLV Reverse Transcriptase (200 U/µL) (Invitrogen, Thermo Fisher Scientific), and 0.1 μL of RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen, Thermo Fisher Scientific), with RNase free water added to reach a total volume of 20 μL. The reverse-transcription reaction was conducted at 40℃ for 30 min, and a Hot Start polymerase chain reaction (PCR) was performed: 98℃ for 30 s, followed by 35 cycles of 98℃ for 5 s, 54℃ for 5 s, and 72℃ for 10 s. After the correct molecule weight of approximately 350 bp was confirmed by electrophoresis on a 2% agarose gel, PCR products were sent for sequencing at Genomics (New Taipei, Taiwan), and NS5 PCR product sequences were analyzed using FinchTV version 1.4.0 (Informer Technologies, Los Angeles, CA) to ensure the identity of the PCR results.

Immunohistochemistry (IHC) staining was performed to detect TMUV antigens in tissue samples from the submitted geese. The deparaffinized slides of organs underwent antigen retrieval in 10 mM citric acid (pH 6.0) for 20 min. Endogenous peroxidase was blocked with 10% hydrogen peroxide (H₂O₂) for 10 min, and the slides were rinsed with phosphate-buffered saline (PBS) containing 0.05% Tween-20. Subsequently, the slides were incubated with Epredia UltraVision Protein Block (Thermo Shandon, Cheshire, UK) at room temperature to block the nonspecific binding of antibodies. The mouse monoclonal antibodies 9E-1 (Li et al., 2021) were then applied to the slides and incubated for 1 h, followed by Super Enhancer reagent (Super Sensitive Polymer-HRP IHC Detection Kit, BioGenex Laboratories, CA) for 20 min at room temperature. After being washed with PBS containing 0.05% Tween-20, the slides were incubated with Goat anti-Mouse IgG Poly-HRP Secondary Antibody (Super Sensitive Polymer-HRP IHC Detection Kit, BioGenex Laboratories) for 30 min at room temperature. The slides were later washed and stained with 3,3′-diaminobenzidine tetrahydrochloride solution (Thermo Shandon) for 3 min and counterstained with hematoxylin for 1 min. Finally, the slides were mounted with VECTASHIELD Antifade Mounting Medium (Vector, Stuttgart, Germany) and observed under a microscope.

Virus Isolation

For virus isolation, the tissue homogenates that tested positive for TMUV by RT-PCR assays were utilized. The supernatants of the homogenates were filtered through 0.45 um filters and then inoculated into the allantoic cavity of 13-day-old minimal-pathogen-free embryonated duck eggs (0.2 mL/egg). Daily monitoring of the inoculated eggs was performed. Embryos that died within 24 h after inoculation were discarded as they were considered to have a nonspecific cause of death, often attributed to bacterial contamination during inoculation. After 72 h of incubation, allantoic fluid was harvested for RT-PCR testing and subsequent passage. The collected allantoic fluid was stored at −80℃ until further use.

Genome Sequencing and Phylogenetic Analysis

The extracted TMUV genomic RNAs from allantoic fluid were submitted to complete genome sequencing using next-generation sequencing (NGS) via Tri-I Biotech (Taipei, Taiwan). The sequencing results were analyzed using CLC Main Workbench version 20.0.5 (QIAGEN, Venlo, Netherlands). To assess the phylogenetic relationship and genome similarity of the TMUV strain isolated in this study with other selected strains, the open reading frame (ORF) and polyprotein sequences were analyzed. Phylogenetic relationships among the reported isolates were established using the Neighbor-Joining algorithms in Molecular Evolutionary Genetics Analysis version 11.0.10. The reliability of the analysis was evaluated through 1,000 replications of bootstrap. As the outgroups, the sequences of the renowned avian flavivirus were utilized and obtained from GenBank, including Ntaya virus, Bagaza virus, Usutu virus, and West Nile virus.

Virus Culture in Avian Embryonated Eggs and Cell Lines

To evaluate the in vitro infectivity of TMUV strain NTU/C225/2020, various avian embryonated and cell culture systems were used. Thirteen-day-old minimal-pathogen-free embryonated duck eggs and 10-day-old SPF embryonated chicken eggs were obtained from the Yilan Branch of the Livestock Research Institute (Yilan, Taiwan) and JD-SPF Biotech Co. Ltd. (Miaoli, Taiwan), respectively. The eggs were inoculated with 0.2 mL virus solution per egg via the allantoic route. Subsequently, the eggs were placed in an incubator at 37℃ and examined daily. At 7 d postinoculation (dpi) or upon embryo death, the eggs were chilled at 4℃ overnight and opened to observe any embryo lesions. Allantoic fluid from the eggs was harvested and subjected to RT–PCR test to confirm the presence of TMUV.

NTU/C225/2020 infection was also conducted in primary duck embryo fibroblast (DEF) cells and DF-1 cells (chicken embryo fibroblasts). DF-1 cells (ATCC CRL-12203) were purchased from the American Type Culture Collection (ATCC) (Manassas, VA). DEF cells were prepared from 10-day-old minimal-pathogen-free duck embryos (Yilan Branch of the Livestock Research Institute, Yilan, Taiwan). Both cell types were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS) and 1% (v/v) penicillin-streptomycin-amphotericin B solution (PSA). The cells were maintained at 37℃ in a 5% CO2 humidified incubator. Culture supernatants were collected for subsequent analysis. The presence of TMUV was confirmed by RT–PCR test and immunocytochemistry (ICC) staining. For ICC staining, the cells were fixed with 80% acetone in PBS. Following fixation, the cells were incubated with Flavivirus group antigen antibody (D1-4G2-4-15; 4G2) (Novus Biologicals, LLC, Centennial, CO) as primary antibodies, followed by Goat Anti-Mouse IgG H&L (HRP) (Abcam, Cambridge, UK) as a secondary antibody. The cells were then stained with 3,3′-diaminobenzidine tetrahydrochloride solution (Thermo Shandon) and microscopically examined to detect the presence of the virus.

Virus Titration by EID50, TCID50, and Plaque Assays

The infectivity titer of the NTU/C225/2020 suspension was determined using the 50% egg infectious dose (EID50) method. Serial 10-fold dilutions of the NTU/C225/2020 stock virus were prepared in PBS, and 0.l mL of each dilution was inoculated into allantoic cavities of SPF embryonated chicken eggs. After incubation at 37℃ for 7 d, the gross morphology of the embryos was applied as the primary indicator to identify infection in each egg. The NTU/C225/2020 EID50 titer was subsequently calculated based on the number of infective eggs using the Reed-Muench method. The 50% tissue culture infectious dose (TCID50) was also a viable approach for quantifying the infectivity titer, which was performed by adding a serial dilution of the virus to cells in a flat-bottom 96-well plate. Similar to the EID50 method, the virus titer was determined by the dilution at which 50% of the wells showed a cytopathic effect.

Another method that was employed to determine the virus titer of the harvested NTU/C225/2020 was the plaque assay. In a plaque assay, cells were prepared in a 12-well cell culture plate at 90 to 100% confluency. Virus suspension was 10-fold serially diluted with cellular growth media and then added to cells with 0.5 mL of each dilution, a sufficient but low volume of inoculum, for 1 h. The plate was gently rocked every 15 min to ensure even coverage. After the infection period, the virus suspension was removed, and the cells were washed twice with PBS. An agarose overlay was prepared by mixing warmed 2× cellular growth media and a stock solution of heated 2% low-melting agarose solution in a 1:1 ratio, which was then applied to the cell monolayer. The plate was incubated at 37℃ for plaque formation, which could take 3 to 8 d. Ultimately, the cells were fixed with 10% formalin at room temperature for 1 h and stained with 1% (w/v) crystal violet for 10 to 20 min. After decanting the staining solution and gently washing off the crystal violet stain with running water, the plates were fixed, stained, and dried, allowing for the counting of plaques to determine the virus titer.

Virus Propagation, Concentration, and Electron Microscopy

After 4 serial passages in duck embryonated eggs, NTU/C225/2020 was concentrated using the polyethylene glycol (PEG) precipitation technique. Cell-free virus supernatants and 40% PEG-6000/PBS solution (w/v) were sterilized by passing through 0.45 um filters and then mixed to achieve a final PEG concentration of 8%. The mixture was stored overnight at 4℃ with gentle shaking before being centrifuged at 12,000 × g for 30 min at 4℃. The pelleted viral particles were resuspended in a sterile PBS buffer and then cleared by another round of centrifugation at 12,000 × g for 10 min at 4℃. The resulting pellet was resuspended in sterile DMEM buffer containing 20% FBS and 1% PSA. Transmission electron microscopy was used to visualize the virus particles. The concentrated viral particles were adsorbed onto a plasma-discharged copper grid 3 times for 5 min each. After washing with PBS, 1% uranyl acetate was applied for negative staining. The particles were observed under a transmission electron microscope (JEOL JEM-1400).

Experimental Infection of Day-Old Chicks

The infection trials were conducted following the animal welfare guidance and with the approval of the Institutional Animal Care and Use Committee at National Taiwan University (Approval ID: NTU-110-EL-00066). Eighteen 1-day-old chicks were divided into 3 groups: the inoculated group (n = 6), the contact group (n = 6), and the control group (n = 6). In the inoculated group, each chick received an intramuscular injection of 1,000 plaque-forming units (PFU) of NTU/C225/2020 in a volume of 0.03 mL. The contact group was housed together with the inoculated group. Daily observations and measurements of spirit, appetite, rectal temperature, and body weight were conducted for each chick. All groups of chicks were housed in continuously lit rooms with food and water freely available. Euthanization and necropsy were performed on either 7 or 14 dpi. Blood sera and organ samples were collected from individuals in each group. Organ samples were homogenized in a DMEM medium containing 10% FBS and 1% PSA. All collected samples were stored at −80℃ until further use.

Nucleic Acid Extraction and Real-Time RT-PCR

For the rapid detection of TMUV infection in the experimental chicks, total RNA was extracted from the chick sera and tissues using the Total RNA Mini Kit (Geneaid Biotech). The extracted RNA underwent a reverse-transcription reaction to synthesize cDNA. Quantitative real-time PCR was then performed using the QuantiNova SYBR Green RT-PCR Kit (QIAGEN, Venlo, Netherlands). The sequences were amplified using primers targeting the NS5 gene of flaviviruses: mFU1 (5ʹ- TAC AAC ATG ATG GGA AAG CGA GAG AAA AA -3ʹ) and CDF2 (5ʹ- GTG TCC CAG CCG GCG GTG TCA TCA GC -3ʹ) (Chao et al., 2007). Thermal cycling conditions of PCR were as follows: 95℃ for 2 min, followed by 45 cycles of 95℃ for 15 s and 55℃ for 30 s on the CFX Connect Real-Time detection system (Bio-Rad, Hercules, CA). The cycle threshold (Ct) values were determined, and ∆Ct values were obtained by subtracting the Ct value of the TMUV gene from that of the chicken 28S rRNA, which was determined as a reference gene, in each sample. The limit of detection was determined based on the sample with the highest ∆Ct value among those that tested negative for the TMUV gene.

Statistical Analysis

Data derived from animal experiments were expressed as means ± standard error of the mean. To compare differences between groups, the Student t test or 2-way ANOVA was applied. Statistical analysis was processed with GraphPad Prism 9 (GraphPad Software, San Diego, USA). P values < 0.05 were considered statistically significant.

RESULTS

Gross and Microscopic Findings in Affected Geese

The white Roman geese of the affected farm showed severe feather loss on their feathers on the back and neck (Figure 1A). For the 6 geese that were necropsied, the most significant lesions consisted of meningeal congestion, pulmonary hyperemia, hepatomegaly, splenomegaly with the mottled surface, bursa atrophy, and white foci in the pancreas. Microscopic examination of different organs displayed varied lesions. The cerebrum and cerebellum exhibited nonpurulent meningitis, along with lymphoplasmacytic and histiocytic perivascular cuffing. In the lung, mild lymphocytic interstitial inflammation and moderate hyperemia were observed in air capillaries. Liver sections displayed multifocal necrosis, accompanied by mild vacuolated degeneration and fatty degeneration in most hepatocytes. The spleen showed severe lymphocyte depletion and hemosiderosis within the cytoplasm of macrophages. Significant changes in the bursa of Fabricius included apoptotic lymphocytes and lymphoid depletion within the centrum of lymphoid follicles. The pancreas exhibited acinar necrosis with lymphocytic inflammation and lymphoid follicle hyperplasia (Figure 1B). IHC analysis could detect TMUV antigens in glial cells and macrophages located in perivascular cuffing within the cerebrum and cerebellum. Strong positive signals of TMUV antigens were observed in the macrophages within the necrotic lesions of the pancreas, while weak positive staining was shown in the macrophages within the spleen red pulp (Figure 1C). TMUV antigens were not detected in the bursa and liver. These findings suggested that macrophages might be the primary targets of TMUV infection. The electrophoresis analysis revealed that 5 out of the 6 tested samples were TMUV-positive. Direct sequencing of the amplicons further validated the presence of TMUV nucleic acid in the samples. Other pathogens were ruled out, including goose circovirus, duck circovirus, goose parvovirus, duck parvovirus, Muscovy duck parvovirus, and highly pathogenic avian influenza virus by PCR or RT-PCR analysis. Overall, the results confirmed that TMUV was responsible for the outbreak of the disease.

Figure 1.

Figure 1

Open in a new tab

Clinical and pathological findings in TMUV-affected geese. (A) Severe loss of feathers on the back and neck of an affected goose. (B) Gross lesions and microscopic examination through hematoxylin and eosin staining. Brain: prominent meningeal congestion; perivascular cuffing. Lung: mild to severe pulmonary hyperemia and edema; mild lymphocytic interstitial pneumonia. Liver: mild hepatomegaly; vacuolated degeneration and focal necrosis. Spleen: splenomegaly with mottled surface; hemosiderosis. Bursa of Fabricius: severe atrophy; apoptotic lymphocytes and lymphoid depletion. Pancreas: multifocal white foci of the pancreas; acinar necrosis. (C) Immunohistochemical 9E-1 antibody staining against TMUV envelope antigen. Cerebellum: TMUV antigen in glial cells and macrophages (arrows). Pancreas and Spleen: TMUV antigen in macrophages (arrows).

Isolation and Identification of TMUV

To isolate the virus, the positive field samples were processed and inoculated into minimal-pathogen-free duck embryos. Gross lesions were observed in duck embryos within 72 h postinoculation, and TMUV nucleic acid was detected in the allantoic fluid using RT-PCR tests. Upon acquiring the full-length viral genome sequences, the virus strain was certainly isolated and designated as NTU/C225/2020. The corresponding GenBank accession no. is MW821486.1 (Figure 2A). Observed by transmission electron microscopy through negative staining, spherical and enveloped particles with diameters of 46 nm appeared in the allantoic fluid of the 3rd-passaged embryonated duck eggs (Figure 2B).

Figure 2.

Figure 2

Open in a new tab

Isolation and identification of TMUV NTU/C225/2020. (A) Brief workflow of goose-origin TMUV isolation in embryonated duck eggs. (B) Transmission electron micrograph of a TMUV virion from harvested allantoic fluid of duck embryos inoculated with NTU/C225/2020.

Characterization of Genome Sequences of NTU/C225/2020

To comprehensively characterize the goose-origin TMUV strain NTU/C225/2020, we determined its full-length nucleotide (nt) sequences of 10,980 bp, containing 5’-untranslated region, ORF, and 3’-untranslated region. Similar to most of the other TMUV strains, the long ORF was 10,278 bp and encoded 3,425-amino acids (aa) polyprotein, consisting of capsid gene (C; 360 nt; 120 aa), premembrane gene (prM; 501 nt; 167aa), envelope gene (E: 1,503 nt; 501 aa), nonstructural protein 1 gene (NS1; 1056 bp; 352 aa), NS2A gene (681 bp; 227 aa), NS2B gene (393 bp; 131 aa), NS3 gene (1,857 bp; 619 aa), NS4A gene (378 bp; 126 aa), 2K gene (69 bp; 23 aa), NS4B gene (762 bp; 254 aa), NS5 gene (2,718 bp; 905 aa), terminating at the TAA stop codon.

Phylogenetic and Comparative Analysis

Phylogenetic analysis based on the ORF sequences classified the selected TMUV strains into 4 distinct clusters (Figure 3A). Cluster 1 contained the duck-origin TMUV strains from Malaysia and Thailand, while cluster 2 comprised most of the reported strains isolated from diseased waterfowls and wild birds from China and Thailand. Cluster 3 contained the duck-origin strains and the latest chicken-origin strains from China in recent years. NTU/C225/2020 was grouped in cluster 4 and was most closely related to the mosquito-origin TMUV TP1906, along with duck-origin TMUV 1080905, Sitiawan virus, and TMUV prototype strain MM1775. Sitiawan virus is another chicken-origin flavivirus closely related to TMUV prototype strain MM1775, and both strains were among the earliest isolates from Malaysia.

Figure 3.

Figure 3

Open in a new tab

Phylogenetic relationship and genomic analysis of NTU/C225/2020 with other TMUV strains based on the open reading frame sequences. (A) The phylogenetic trees were established using neighbor-joining algorithms, with the NTU/C225/2020 marked as red dots. The analysis involved 34 nucleotide sequences of TMUV strains, with strain name, GenBank accession number, and host for each strain shown. As the outgroup, 4 sequences of other flavivirus were used. (B) The CryoEM structure model of the dengue virus NS1 dimer (Protein Data Bank identification code: 7WUS) was used for displaying the 3 domains: β-roll colored in orange, wing colored in green, and β-ladder colored in blue. (C) Amino acid sequence alignment of the β-roll and wing domains in NS1 protein of the representative TMUV strains. Amino acids that differ from the consensus sequences were marked with colored backgrounds.

A comparative genomic analysis based on the sequences of the whole polyprotein and different protein regions is shown in Table 1. NTU/C225/2020 showed the nt similarities of from 86.9 to 87.0% with cluster 1, 86.4 to 86.7% with cluster 2.1, 86.9 to 87.0% with cluster 2.2, and 87.4 to 88.7% with the cluster 3 TMUVs; the aa similarities ranged from 96.1 to 96.3%, 96.2 to 96.3%, 96.4 to 96.5%, and 96.6 to 97.9%, respectively. Some comparison results showed low nt similarities but high aa similarities, indicating the presence of silent mutations. While compared to the other cluster TMUVs, NTU/C225/2020 shared the lowest percent of aa similarities in the NS1 and NS2A protein regions. A sequence alignment of distinct NS1 regions among the selected TMUVs was further performed. Aligning with the typical structure of flaviviruses shown in Figure 3B, the TMUV NS1 protein contains 3 distinct domains: the β-roll (residues 1–29), wing (residues 30–180), and β-ladder (residues 181–352) (Akey et al., 2014; Tan et al., 2023). Amino acid variations among TMUVs were discernibly scattered across these 3 domains, with the β-roll and wing domains exhibiting the highest percentage of differences. Compared to the cluster 1 and 2 TMUVs, NTU/C225/2020 showed aa similarities of 86.2% in the β-roll domain, similarities ranging from 88.7 to 92.1% in the wing domain, and similarities ranging from 95.4 to 98.3% in the β-ladder domain (Figure 3C). Moreover, an intracluster comparison among the cluster 4 TMUVs showed high homology with aa similarities from 98.5 to 99.7% in the whole polyprotein. NTU/C225/2020 exhibited the closest aa identities to the local TP1906 strain, with 99.7% aa similarities in the whole polyprotein; the lowest percent aa similarity (97.7%) was observed in the NS2B protein region while comparing the 2 strains.

Table 1.

Nucleotide and amino acid % sequence similarities between TMUV NTU/C225/2020 and other isolates.

Genomic region Cluster 1 Cluster 2.1 Cluster 2.2 Cluster 3
Polyprotein nt 86.9–87.0 86.4–86.7 86.9–87.0 87.4–88.7
aa 96.1–96.3 96.2–96.3 96.4–96.5 96.6–97.9
C nt 89.4–90.6 89.4–90.6 88.9–89.7 90.3–91.7
aa 93.3 93.3–94.1 94.1–95.0 95.0–95.8
prM nt 85.0–85.9 83.4–84.2 84.2–85.0 86.6–87.6
aa 95.8 95.2–95.8 95.2–95.8 94.6–98.2
E nt 85.8–86.1 85.8–86.1 86.1–86.5 85.8–88.1
aa 96.6–97.6 96.4–97.0 96.4–97.2 96.2–98.8
NS1 nt 87.8–88.5 85.6–86.1 86.4–86.8 87.7–89.3
aa 93.2–94.6 92.1–92.6 92.6–93.2 94.9–96.9
NS2A nt 84.3–84.9 84.1–85.5 84.6–85.2 86.2–88.8
aa 90.8–92.5 91.2–92.1 92.1–92.5 93.1–96.5
NS2B nt 87.3–87.5 85.8–86.8 86.8–88.3 87.5–88.6
aa 94.7–95.4 96.2 93.1–96.2 95.4–96.2
NS3 nt 87.9–88.2 87.6 87.7–88.0 88.8–89.9
aa 98.6–98.7 98.6–98.7 98.2–98.7 98.6–98.9
NS4A nt 85.5–86.2 82.8–84.9 85.5–86.0 85.2–88.1
aa 94.4–95.2 94.4 94.4 95.2–97.6
2K nt 85.5–89.9 84.1–87.0 87.0–89.9 87.0–92.8
aa 95.7 95.7 95.7 95.7
NS4B nt 86.4–86.8 86.5–87.0 86.9–87.4 85.2–87.1
aa 95.3–95.7 94.5–96.5 97.2 94.9–97.6
NS5 nt 86.9–87.2 87.1–87.5 87.3–87.6 87.0–88.4
aa 96.8–97.5 97.6–98.0 97.6–98.0 97.7–98.6
Open in a new tab

Characterization of NTU/C225/2020 Infection In Vitro

To propagate NTU/C225/2020 in embryos, we performed virus inoculation in 13-day-old duck eggs and 10-day-old chicken eggs via the allantoic route. Both the duck embryos and the chicken embryos died and exhibited significant abnormalities such as smaller size, edema, and hyperemia at from 6 to 7 dpi (Figures 4A and 4B). TMUV-specific RT-PCR testing confirmed the presence of TMUV in the allantoic fluid of infected embryos, while embryos with normal appearances tested negative for TMUV (Figure 4E). These findings indicated that embryos infected with NTU/C225/2020 displayed distinctive gross lesions, allowing for easy differentiation between infected and noninfected embryos, and thereby obviating the need for RT-PCR testing.

Figure 4.

Figure 4

Open in a new tab

TMUV NTU/C225/2020 culture and identification in various host systems. (A) Duck and (B) chicken embryos infected with NTU/C225/2020. (C) Primary duck embryo fibroblast (DEF) cells and (D) DF-1 cells infected with NTU/C225/2020. Scale bar, 50 µm. NTU/C225/2020-infected DF-1 cells were used to perform immunocytochemical 4G2 antibody staining and plaque assay. The immunocytochemical positive signals and the plaque morphology in 12-well plates were shown. (E) Positive detection in harvested NTU/C225/2020 by TMUV-specific RT-PCR assay. The molecular weight of the target product is 350 bp. M: molecular weight marker. 1: duck embryo allantoic fluid. 2: chicken embryo allantoic fluid. 3: DEF cell supernatant. 4: DF-1 cell supernatant. P: positive control. N: negative control.

To gain further insights into the in vitro culture and replication of NTU/C225/2020, 2 avian cell lines, primary DEF cell and DF-1 lines, were employed. Following virus inoculation, the cytopathic effect was observed in DEF cells at 6 dpi and in DF-1 cells at 3 dpi, characterized by cell detachment and disruption (Figures 4C and 4D). The cell supernatants harvested from these cultures tested positive in the TMUV-specific RT-PCR assay (Figure 4E). The ICC staining of inoculated DF-1 cell cultures revealed the presence of TMUV antigen in the cytoplasm. For virus titration, DF-1 cells were further utilized using TCID50 and plaque assay methods. The viral plaques formed in circular shapes with turbid edges (Figure 4D).

Optimization of NTU/C225/2020 Propagation

To identify the most efficient and convenient system for propagating TMUV, various propagation conditions were explored in SPF embryonated chicken eggs, which provide the more stable quality that the viral experiments require when compared to minimal-pathogen-free embryonated duck eggs. Different embryo ages (9 and 12 d old) and different inoculation doses (16 and 160 TCID50/egg) were employed. The harvested allantoic fluid from these eggs was used to perform EID50 assays in chicken embryos. The results revealed that the chicken embryos inoculated with the higher dose (160 TCID50/egg) of NTU/C225/2020 showed higher EID50 values compared to those inoculated with the lower dose (16 TCID50/egg), regardless of the embryo age. Additionally, 9-day-old chicken embryos yielded higher infectivity titers than 12-day-old embryos. In summary, 9-day-old chicken embryonated eggs inoculated with 160 TCID50/egg of NTU/C225/2020 exhibited the most favorable conditions for virus propagation (Table 2).

Table 2.

TMUV propagation optimization in chicken embryos with different embryo ages and infection doses. Virus yield was evaluated by EID50 assays in chicken embryos.

Age 9 days old 12 days old
Dose (TCID50/egg) 160 16 160 16
EID50/0.1 mL (Log10) 4.56 4.18 3.38 2.00
Open in a new tab

Clinical Manifestations in NTU/C225/2020-Infected Chicks

To assess the pathogenicity of low-dose TMUV on young chickens, the NTU/C225/2020 suspension, concentrated using the PEG-6000 precipitation method, was experimentally inoculated into 1-day-old chicks (Figure 5A). One out of 6 inoculated chicks temporarily exhibited severe labored breathing, unstable gait, and lethargy at 4 dpi. These symptoms resolved within a few hours. None of these symptoms were observed in the contact chicks. Throughout the 14-d experiment, no deaths or noticeable anorexia occurred in any of the chicks. In terms of growth, the inoculated chicks exhibited retardation compared to the noninoculated chicks housed together (Figure 5B). There was a significant difference in the percent mean body weight between the inoculated and contact groups from 5 dpi (n = 6; P < 0.05) until the end of the study (n = 3; P < 0.05). Both of these groups exhibited lower body weight compared to naïve day-old layer chicks in the existing studies (Nguyen et al., 2019), at around 70 g at 7 d old and 140 g at 14 d old. Additionally, 4 out of 6 inoculated chicks showed an elevated rectal temperature starting from 2 dpi, while the other 2 inoculated chicks exhibited the same signs from 3 dpi. Hyperthermia resolved from 6 dpi but reappeared a few days later, with the peak occurring at 11 dpi (Figure 5C). The rectal temperature of contact chicks ranged between approximately 40°C and 41°C, aligning with the normal body temperature of Leghorn chicks, as indicated in the previous literature (Hayne et al., 1986). In our studies, we deliberately refrained from collecting data on body weight and body temperature from control chicks to prevent potential stress induced by human handling.

Figure 5.

Figure 5

Open in a new tab

Experimental design and clinical observations in day-old specific pathogen-free (SPF) chicks post NTU/C225/2020 infection. (A) Schematic diagram of TMUV infection in day-old chicks. (B) Body size difference between inoculated and contact chicks, 14 d postinoculation (dpi). (C) Comparison of body weight and body temperature between inoculated and contact chicks from 1 dpi to 14 dpi. The data were shown as mean value ± SEM (n = 6, from 1 dpi till 7 dpi; n = 3, from 8 dpi till 14 dpi) and compared with the Student t test. Asterisks indicate a significant difference between the inoculated group and the day-matched contact group. *P < 0.05, **P < 0.01, ***P < 0.001. (D) Gross lesions characterized by hepatomegaly, hyperemic thymus, and splenomegaly were observed in the inoculated chicks at 14 dpi.

Gross Pathological Findings in NTU/C225/2020-Infected Chicks

Following sacrifice on the indicated days, a significant difference in body size between inoculated and contact chicks was observed. Viscous, transparent nasal discharge was randomly observed in some inoculated chicks. A necropsy examination of the inoculated chicks revealed several lesions, including mild hepatomegaly and hyperemic thymi. Splenomegaly was observed in 2 out of 3 inoculated chicks. Some contact chicks also exhibited hyperemic thymi at 7 dpi. No significant gross lesions were observed in the chicks of the control group (Figure 5D).

Viral Load Evaluation in NTU/C225/2020-Infected Chicks

To assess the distribution of NTU/C225/2020 replication in chicks, serum samples and suspected TMUV-distributed tissues (including brains, hearts, livers, spleens, kidneys, and thymus) collected at 7 and 14 dpi were analyzed using TMUV NS5 gene-specific real-time RT-PCR assay (Chao et al., 2007). These organs were selected based on previous reports associated with TMUV pathogenicity in avian species. The results demonstrated the presence of viral load in various organs of both the inoculated and contact chicks. In the inoculated group, viral load was detected in all collected organs at 7 dpi and was higher than that at 14 dpi. In the contact group, viral load was detected in most organs, except for the thymus. All organs of the inoculated chicks exhibited significantly lower ΔCt values compared to those of the contact chicks at 7 dpi. The highest viral load was observed in the brains and spleens. No virus load was detected in any serum samples from both the inoculated and contact groups (Figures 6A and 6B).

Figure 6.

Figure 6

Open in a new tab

Real-time RT-PCR assay targeting TMUV NS5 gene in various organs of day-old specific-pathogen-free (SPF) chicks post-NTU/C225/2020 infection. The viral load of different tissues at 7 dpi (A) and 14 dpi (B) was evaluated with ΔCt values, indicating cycle threshold values of the TMUV NS5 gene normalized to 28S rRNA, a chicken housekeeping gene. The data were shown as mean value ± SEM and asterisks indicate a significant difference between the inoculated group and the contact group. Abbreviations: LoD, limit of detection; nd, not done; ns, not significant. **P < 0.01, ***P < 0.001, ****P < 0.0001.

Histopathological Evaluation in NTU/C225/2020-Infected Chicks

Microscopic examination revealed lesions in various organs of both the inoculated and contact chicks. In the brains, the inoculated chicks exhibited severe nonpurulent encephalitis, characterized by multifocal perivascular cuffing and local glial cell proliferation. The contact chicks mainly displayed multifocal perivascular cuffing. In the hearts, the inoculated chicks showed degeneration and necrosis of myocardial fibers with lymphoid infiltration. Mild myocardial necrosis was also observed in the contact chicks. In the livers, both the inoculated and contact chicks displayed multifocal lymphoid infiltration with mild degeneration and necrosis of hepatic parenchyma. In the spleens, the white pulp of the inoculated chicks showed lymphoid depletion. In the kidneys and pancreas, interstitial inflammation was observed in both the inoculated and contact chicks. The vesicular and granular degeneration of renal tubules was only observed in the inoculated chicks. In the thymus, mild hemorrhages scattered in the parenchyma were observed in both the inoculated and contact chicks. Taken together, NTU/C225/2020 caused damage to multiple tissues, mainly characterized by inflammatory cell infiltration (Figure 7A). IHC staining targeting the TMUV envelope protein revealed the presence of TMUV antigen in the brains and hearts of both the inoculated and contact chicks. In the brains, the virus antigen was detected in the cytoplasm of oligodendrocytes at 7 and 14 dpi. In the hearts, the TMUV antigen was detected in the myocardial cells at 7 and 14 dpi (Figure 7B).

Figure 7.

Figure 7

Open in a new tab

Histopathological findings in day-old specific pathogen-free (SPF) chicks post NTU/C225/2020 infection. (A) Microscopic examination through hematoxylin and eosin staining. Brain: nonpurulent encephalitis with perivascular cuffing (arrows) and local glial cell proliferation (arrowheads), 7 dpi. Scale bar, 50 µm. Heart: degeneration and necrosis of myocardial fibers (arrows), 7 dpi. Scale bar, 50 µm. Liver: multifocal lymphoid infiltration (arrows). Scale bar, 50 µm. Spleen: lymphoid depletion in the white pulp in both inoculated and contact chicks, 14 dpi. Scale bar, 250 µm. Kidney: interstitial nephritis with lymphoid infiltration and epithelial degeneration (arrows), 14 dpi. Vesicular and granular degeneration of renal tubules was particularly observed in inoculated chicks (arrowheads). Scale bar, 50 µm. (B) Immunohistochemical 9E-1 antibody staining against TMUV envelope antigen. Scale bar, 50 µm. Brain: positive signals in oligodendrocytes (arrows), 7 dpi. Heart: positive signals in myocardial cells (arrows), 7 dpi.

DISCUSSION

The TMUV outbreak has resulted in a substantial economic impact on poultry farms across various regions of Asia. The expanding host range of TMUVs raises concerns about the possibility of cross-species transmission. With the successive outbreaks in laying hen flocks in the neighboring country (Yan et al., 2022; Yu et al., 2022), an understanding of the infection dynamics of TMUV Taiwanese isolates in chickens is urgently required. The in vitro and in vivo investigations in our study provided valuable insights into the pathogenicity and host range of a novel TMUV strain. To our knowledge, this is the first in vivo study of a Taiwanese TMUV in experimental animals, particularly in chickens.

The phylogenetic tree based on nucleotide sequences of the ORF highlighted that the clustering of TMUVs was not dependent on the host species. The hosts of the TMUV lineages in each cluster were not limited to certain single species. Our phylogenetic analysis demonstrated that TMUV might be prone to cause cross-species emergence, from mosquitoes to various avian species. Previous research also indicated that TMUV did not exhibit a species barrier in avian species according to the phylogeny (Lei et al., 2017). According to the phylogenetic tree, NTU/C225/2020 was classified into cluster 4, together with the Sitiawan virus, which was from Malaysia and is known to cause encephalitis and growth retardation in chicks. This finding underscored the importance of investigating the potential impact of NTU/C225/2020 on chicken populations. In addition, the composition of TMUV cluster 4 raised the intriguing possibility of TMUV evading geographic barriers through long-distance spreading facilitated by migratory birds from Southeast Asia to Taiwan. This concept has been postulated in a recent study (Fang et al., 2023), adding further support to the notion of potential virus dissemination through wild bird migration.

A comparative analysis of multiple alignments of different protein regions showed that the most significant amino acid differences were observed in the NS1 and NS2A proteins while comparing NTU/C225/2020 to cluster 1 and 2 TMUVs, which consisted of most reported avian TMUVs. Several conserved functional regions have been found in flavivirus nonstructural proteins, such as NS2B-NS3 protease, NS3 RNA helicase, and NS5 polymerase (Wu et al., 2005). As our current knowledge stands, the NS1 protein of flaviviruses plays crucial roles in viral replication, immune system evasion, and pathogenesis. Although discussions concerning the hypervariable regions of TMUV NS1 remain limited, 1 study has hinted at these regions and speculated that they could be strategies employed by the virus to evade host immune responses, driving genetic evolution (Yu et al., 2018). Others have discussed and supported the view that the inter-cluster mutations of NS1 might be associated with immune evasion, particularly the wing domain, which is on the outer surface of the NS1 structure and is more likely to elicit an immune response. Conversely, the β-roll domain, primarily forming a hydrophobic surface on the inner aspect of NS1, has been regarded as associated with membrane interaction (Akey et al., 2015; Brown et al., 2016). Our study yielded unexpected findings in the higher percent differences of inter-cluster sequences within the β-roll domain, a region conventionally deemed to be conserved in comparison to the other 2 domains. In summary, our genomic findings from this study hold unexpected and significant implications, especially as nonstructural proteins in flaviviruses were traditionally deemed conserved regions, and hold promise for therapeutic and diagnostic antibody development. Further investigations into the potential ramifications of these mutations are required.

Previous pathogenicity analyses of TMUV were primarily carried out in ducks and ducklings, utilizing relatively high infectivity titers in the range 105–107 PFU/individual in various studies (Feng et al., 2020; Yu et al., 2022; Huang et al., 2023). In contrast, we chose to inoculate 1-day-old chicks with a lower dose of only 1,000 PFU of NTU/C225/2020 via the intramuscular route, simulating the circumstance of young chicken infection via mosquito bites. The result revealed that the goose-derived TMUV strain exhibited pathogenicity in day-old chicks even at this low dosage, leading to delayed growth and hyperthermia. Flaviviruses are known to multiply in the vascular epithelium systemically, causing fever (Thomas et al., 2014). Consistent with previous studies on duck-derived TMUV infections in avian hosts, including chicks, ducklings, egg-laying chickens, and shelducks (Chen et al., 2014), we also observed elevated body temperature in the infected day-old chicks. This finding highlights the potential use of body temperature as a physiological parameter for the presumptive diagnosis of TMUV infection in poultry hosts. Furthermore, it is noteworthy that serum samples from the infected chicks at 7 and 14 dpi tested negative in TMUV real-time RT-PCR. A recent study showed that no virus was detected in the serum of the MM1775-infected ducklings at 3, 5, and 7 dpi (Wang et al., 2023). Similarly, Yan et al. (Yan et al., 2018) found that MM1775 was not detectable in the serum of 12 to 15-wk-old ducks through intramuscular or intranasal routes at 3 dpi, and they further went on to identify the specific amino acid residues accounting for the divergence in TMUV tissue tropism. They found that the absence of glycosylation modification at position N154 in the MM1775 envelope protein, which is an attachment region, can significantly influence tissue tropism and transmissibility. Given the close relationship between NTU/C225/2020 and MM1775, further investigation is needed to discover whether NTU/C225/2020 shares a similar envelope protein conformation, resulting in an undetectable virus in the serum. In our study, we took into consideration the tender age of the experimental chicks. To minimize potential stress induced by human handling, we opted to conduct blood collection exclusively on the sacrificed days. However, given that multiple studies have indicated TMUV viremia is typically detectable at from 1 to 7 dpi, an analysis of the data within this duration is required to understand viremia dynamics. Other research has further shown the efficient spread of TMUV among ducks through direct contact and aerosol transmission (Liu et al., 2012; Li et al., 2015). Our molecular analysis showed a wide distribution of NTU/C225/2020 in tissues of naïve chicks housed together with intramuscularly infected chicks, confirming the direct chick-to-chick contact transmission of TMUV. In conjunction with previous evidence, our findings supported the perspective that TMUV disease is a nonseasonal infectious disease that can occur at a large scale even in winter, potentially transmitted by wild house sparrows (Tang et al., 2013a).

Collectively, the animal infection experiments in this study illuminated the impact of TMUV on the growth performance of young chickens. The potential economic losses associated with multiple transmission routes underscored the need for ongoing surveillance and strict biosecurity measures in different avian flocks. Protective immune response to TMUV infection in young chickens can also be evaluated via an antibody examination. Additionally, investigating the impact of NTU/C225/2020 on adult egg-laying chickens can enhance our understanding of its implications for egg production performance in TMUV-infected chickens. It is also crucial to confirm whether NTU/C225/2020 can truly reproduce the disease in geese by performing a challenge study in the future.

ACKNOWLEDGMENTS

The authors acknowledge the financial support received from the National Taiwan University (NTU) and the National Science and Technology Council, Taiwan. Acknowledgment is further extended to the Joint Center for Instruments and Research, College of Bioresources and Agriculture at NTU, for the technical assistance provided in the acquisition of transmission electron micrographs. Gratitude is also expressed to the Graduate Institute of Molecular and Comparative Pathobiology at NTU, for the preparation of histopathology sections.

DISCLOSURES

The authors declare the absence of any potential conflict of interest arising from commercial or financial relationships. Each named author contributed to sample collection, experimental work, and manuscript preparation.

Footnotes

The nucleotide sequence data reported in this paper have been submitted to GenBank nucleotide sequence database and have been assigned the accession number MW821486.1.

REFERENCES

  1. Akey D.L., Brown W.C., Dutta S., Konwerski J., Jose J., Jurkiw T.J., DelProposto J., Ogata C.M., Skiniotis G., Kuhn R.J., Smith J.L. Flavivirus NS1 structures reveal surfaces for associations with membranes and the immune system. Science. 2014;343:881–885. doi: 10.1126/science.1247749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akey D.L., Brown W.C., Jose J., Kuhn R.J., Smith J.L. Structure-guided insights on the role of NS1 in flavivirus infection. Bioessays. 2015;37:489–494. doi: 10.1002/bies.201400182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brown W.C., Akey D.L., Konwerski J.R., Tarrasch J.T., Skiniotis G., Kuhn R.J., Smith J.L. Extended surface for membrane association in Zika virus NS1 structure. Nat. Struct. Mol. Biol. 2016;23:865–867. doi: 10.1038/nsmb.3268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chao D.Y., Davis B.S., Chang G.J. Development of multiplex real-time reverse transcriptase PCR assays for detecting eight medically important flaviviruses in mosquitoes. J. Clin. Microbiol. 2007;45:584–589. doi: 10.1128/JCM.00842-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen S., Wang S., Li Z., Lin F., Cheng X., Zhu X., Wang J., Chen S., Huang M., Zheng M. Isolation and characterization of a Chinese strain of Tembusu virus from Hy-Line brown layers with acute egg-drop syndrome in Fujian. China. Arch. Virol. 2014;159:1099–1107. doi: 10.1007/s00705-013-1931-0. [DOI] [PubMed] [Google Scholar]
  6. Chen Y.P., Shih Y.H., Lee F., Chiou C.J. The first identification of Tembusu virus in a Pekin duck farm in Taiwan. J. Appl. Anim. Res. 2022;50:86–92. [Google Scholar]
  7. Fang Y., Hang T., Yang L.M., Xue J.B., Fujita R., Feng X.S., Jiang T.G., Zhang Y., Li S.Z., Zhou X.N. Long-distance spread of Tembusu virus, and its dispersal in local mosquitoes and domestic poultry in Chongming Island. China. Infect. Dis. Poverty. 2023;12:52. doi: 10.1186/s40249-023-01098-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Feng C., Jin M., Yang L., Lv J., Qu S., Meng R., Yang B., Wang X., Zhang D. Pathogenicity of a Jinding duck-origin cluster 2.1 isolate of Tembusu virus in 3-week-old Pekin ducklings. Vet. Microbiol. 2020;251 doi: 10.1016/j.vetmic.2020.108870. [DOI] [PubMed] [Google Scholar]
  9. Hayne H., Rovee-Collier C., Gargano D. Ambient temperature effects on energetic relations in growing chicks. Physiol. Behav. 1986;37:203–212. doi: 10.1016/0031-9384(86)90222-2. [DOI] [PubMed] [Google Scholar]
  10. Homonnay Z.G., Kovacs E.W., Banyai K., Albert M., Feher E., Mato T., Tatar-Kis T., Palya V. Tembusu-like flavivirus (Perak virus) as the cause of neurological disease outbreaks in young Pekin ducks. Avian Pathol. 2014;43:552–560. doi: 10.1080/03079457.2014.973832. [DOI] [PubMed] [Google Scholar]
  11. Huang Y., Hu Z., Dong J., Li L., Zhang J., Kuang R., Gao S., Sun M., Liao M. Chicken-origin cluster 3.2 Tembusu virus exhibits higher infectivity than duck-origin cluster 2 Tembusu virus in chicks. Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1152802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kono Y., Tsukamoto K., Abd Hamid M., Darus A., Lian T.C., Sam L.S., Yok C.N., Di K.B., Lim K.T., Yamaguchi S., Narita M. Encephalitis and retarded growth of chicks caused by Sitiawan virus, a new isolate belonging to the genus Flavivirus. Am. J. Trop. Med. Hyg. 2000;63:94–101. doi: 10.4269/ajtmh.2000.63.94. [DOI] [PubMed] [Google Scholar]
  13. Lei W., Guo X., Fu S., Feng Y., Tao X., Gao X., Song J., Yang Z., Zhou H., Liang G. The genetic characteristics and evolution of Tembusu virus. Vet. Microbiol. 2017;201:32–41. doi: 10.1016/j.vetmic.2017.01.003. [DOI] [PubMed] [Google Scholar]
  14. Li C.J., Huang P.H., Chen H.W., Chang S.C. Development and characterization of mouse monoclonal antibodies targeting to distinct epitopes of Zika virus envelope protein for specific detection of Zika virus. Appl. Microbiol. Biotechnol. 2021;105:4663–4673. doi: 10.1007/s00253-021-11364-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li S., Li X., Zhang L., Wang Y., Yu X., Tian K., Su W., Han B., Su J. Duck Tembusu virus exhibits neurovirulence in BALB/c mice. Virol. J. 2013;10:260. doi: 10.1186/1743-422X-10-260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li X., Shi Y., Liu Q., Wang Y., Li G., Teng Q., Zhang Y., Liu S., Li Z. Airborne transmission of a novel Tembusu virus in ducks. J. Clin. Microbiol. 2015;53:2734–2736. doi: 10.1128/JCM.00770-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Liang T., Liu X., Qu S., Lv J., Yang L., Zhang D. Pathogenicity of egg-type duck-origin isolate of Tembusu virus in Pekin ducklings. BMC Vet. Res. 2019;15:362. doi: 10.1186/s12917-019-2136-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu M., Chen S., Chen Y., Liu C., Chen S., Yin X., Li G., Zhang Y. Adapted Tembusu-like virus in chickens and geese in China. J. Clin. Microbiol. 2012;50:2807–2809. doi: 10.1128/JCM.00655-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lv J., Yang L., Qu S., Meng R., Li Q., Liu H., Wang X., Zhang D. Detection of neutralizing antibodies to Tembusu virus: implications for infection and immunity. Front. Vet. Sci. 2019;6:442. doi: 10.3389/fvets.2019.00442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Nguyen L.T.N., Han G., Yang H., Ikeda H., Eltahan H.M., Chowdhury V.S., Furuse M. Dried watermelon rind mash diet increases plasma l-citrulline level in chicks. J. Poult. Sci. 2019;56:65–70. doi: 10.2141/jpsa.0180018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Olson J.G., Ksiazek T.G., Gubler D.J., Lubis S.I., Simanjuntak G., Lee V.H., Nalim S., Juslis K., See R. A survey for arboviral antibodies in sera of humans and animals in Lombok, Republic of Indonesia. Ann. Trop. Med. Parasitol. 1983;77:131–137. doi: 10.1080/00034983.1983.11811687. [DOI] [PubMed] [Google Scholar]
  22. Peng S.H., Su C.L., Chang M.C., Hu H.C., Yang S.L., Shu P.Y. Genome analysis of a novel Tembusu virus in Taiwan. Viruses. 2020;12:567. doi: 10.3390/v12050567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Platt G.S., Way H.J., Bowen E.T., Simpson D.I., Hill M.N., Kamath S., Bendell P.J., Heathcote O.H. Arbovirus infections in Sarawak, October 1968–February 1970 Tembusu and Sindbis virus isolations from mosquitoes. Ann. Trop. Med. Parasitol. 1975;69:65–71. doi: 10.1080/00034983.1975.11686984. [DOI] [PubMed] [Google Scholar]
  24. Shen H.Q., Lin W.C., Wang Z.X., Zhang K., Yan Z.Q., Zhou Q.F., Qin J.P., Xie Q.M., Bi Y.Z., Chen F. Pathogenicity and genetic characterization of a duck Tembusu virus associated with egg-dropping in Muscovy ducks. Virus Res. 2016;223:52–56. doi: 10.1016/j.virusres.2016.06.016. [DOI] [PubMed] [Google Scholar]
  25. Su J., Li S., Hu X., Yu X., Wang Y., Liu P., Lu X., Zhang G., Hu X., Liu D., Li X., Su W., Lu H., Mok N.S., Wang P., Wang M., Tian K., Gao G.F. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus. PLoS One. 2011;6:e18106. doi: 10.1371/journal.pone.0018106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Tan H., Zhang S., Tan W., Hu T., He Y., Wu Z., Wang M., Jia R., Zhu D., Liu M., Zhao X., Yang Q., Wu Y., Zhang S., Huang J., Ou X., Gao Q., Sun D., Cheng A., Chen S. Linear epitope identification of monoclonal antibodies against the duck Tembusu virus NS1. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Tang Y., Diao Y., Yu C., Gao X., Ju X., Xue C., Liu X., Ge P., Qu J., Zhang D. Characterization of a Tembusu virus isolated from naturally infected house sparrows (Passer domesticus) in northern China. Transbound. Emerg. Dis. 2013;60:152–158. doi: 10.1111/j.1865-1682.2012.01328.x. [DOI] [PubMed] [Google Scholar]
  28. Tang Y., Gao X., Diao Y., Feng Q., Chen H., Liu X., Ge P., Yu C. Tembusu virus in human. China. Transbound. Emerg. Dis. 2013;60:193–196. doi: 10.1111/tbed.12085. [DOI] [PubMed] [Google Scholar]
  29. Thomas S.J., Martinez L.J., Endy T.P. In: Viral Infections of Humans: Epidemiology and Control. Kaslow R.A., Stanberry L.R., Le Duc J.W., editors. Springer US; Boston, MA: 2014. Flaviviruses: Yellow fever, Japanese B, West Nile, and others; pp. 383–415. [Google Scholar]
  30. Thontiravong A., Ninvilai P., Tunterak W., Nonthabenjawan N., Chaiyavong S., Angkabkingkaew K., Mungkundar C., Phuengpho W., Oraveerakul K., Amonsin A. Tembusu-related flavivirus in ducks, Thailand. Emerg. Infect. Dis. 2015;21:2164–2167. doi: 10.3201/eid2112.150600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang X., He Y., Guo J., Wu Z., Merits A., Wang M., Jia R., Zhu D., Liu M., Zhao X., Yang Q., Wu Y., Zhang S., Huang J., Ou X., Gao Q., Sun D., Cheng A., Chen S. Comparative study of the pathogenicity of the mosquito origin strain and duck origin strain of Tembusu virus in ducklings and three-week-old mice. Virol. Sin. 2023;38:827–831. doi: 10.1016/j.virs.2023.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wu J., Bera A.K., Kuhn R.J., Smith J.L. Structure of the flavivirus helicase: implications for catalytic activity, protein interactions, and proteolytic processing. J. Virol. 2005;79:10268–10277. doi: 10.1128/JVI.79.16.10268-10277.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yan D., Li X., Wang Z., Liu X., Dong X., Fu R., Su X., Xu B., Teng Q., Yuan C., Zhang Z., Liu Q., Li Z. The emergence of a disease caused by a mosquito origin cluster 3.2 Tembusu virus in chickens in China. Vet. Microbiol. 2022;272 doi: 10.1016/j.vetmic.2022.109500. [DOI] [PubMed] [Google Scholar]
  34. Yan D.W., Shi Y., Wang H.W., Li G.X., Li X.S., Wang B.B., Su X., Wang J.H., Teng Q.Y., Yang J.M., Chen H.J., Liu Q.F., Ma W.J., Li Z.J. A Single mutation at position 156 in the envelope protein of Tembusu virus is responsible for virus tissue tropism and transmissibility in ducks. J. Virol. 2018;92:e00427–18. doi: 10.1128/JVI.00427-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yan P., Zhao Y., Zhang X., Xu D., Dai X., Teng Q., Yan L., Zhou J., Ji X., Zhang S., Liu G., Zhou Y., Kawaoka Y., Tong G., Li Z. An infectious disease of ducks caused by a newly emerged Tembusu virus strain in mainland China. Virology. 2011;417:1–8. doi: 10.1016/j.virol.2011.06.003. [DOI] [PubMed] [Google Scholar]
  36. Yu G., Lin Y., Tang Y., Diao Y. Evolution of Tembusu virus in ducks, chickens, geese, sparrows, and mosquitoes in northern China. Viruses. 2018;10:485. doi: 10.3390/v10090485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yu Z., Ren H., Sun M., Xie W., Sun S., Liang N., Wang H., Ying X., Sun Y., Wang Y., Zheng Y., Hu X., Su J. Tembusu virus infection in laying chickens: evidence for a distinct genetic cluster with significant antigenic variation. Transbound. Emerg. Dis. 2022;69:e1130–e1141. doi: 10.1111/tbed.14402. [DOI] [PubMed] [Google Scholar]
  38. Yun T., Zhang D., Ma X., Cao Z., Chen L., Ni Z., Ye W., Yu B., Hua J., Zhang Y., Zhang C. Complete genome sequence of a novel flavivirus, duck Tembusu virus, isolated from ducks and geese in China. J. Virol. 2012;86:3406–3407. doi: 10.1128/JVI.07132-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhang W., Chen S., Mahalingam S., Wang M., Cheng A. An updated review of avian-origin Tembusu virus: a newly emerging avian flavivirus. J. Gen. Virol. 2017;98:2413–2420. doi: 10.1099/jgv.0.000908. [DOI] [PubMed] [Google Scholar]
  40. Zhang Y., Li X., Chen H., Ti J., Yang G., Zhang L., Lu Y., Diao Y. Evidence of possible vertical transmission of Tembusu virus in ducks. Vet. Microbiol. 2015;179:149–154. doi: 10.1016/j.vetmic.2015.06.004. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES