TRAF3 gene regulates macrophage migration and activation by lung epithelial cells infected with Aspergillus fumigatus

Shumi Shang; Dan He; Cong Liu; Xinyuan Bao; Shuaishuai Han; Li Wang

doi:10.1128/spectrum.02699-23

. 2023 Nov 29;12(1):e02699-23. doi: 10.1128/spectrum.02699-23

TRAF3 gene regulates macrophage migration and activation by lung epithelial cells infected with Aspergillus fumigatus

Shumi Shang ¹, Dan He ¹, Cong Liu ², Xinyuan Bao ¹, Shuaishuai Han ³, Li Wang ^1,^✉

Editor: Lea Atanasova⁴

Reviewed by: Andrew Wagner⁵, Benjamin P Knox⁶

PMCID: PMC10783100 PMID: 38018974

ABSTRACT

Aspergillus fumigatus is an opportunistic pathogen that infects immunocompromised patients and imposes a heavy burden on global health. Searching for key genes in host resistance to A. fumigatus infection can help us understand the mechanisms of A. fumigatus-host interactions and provide new targets for the treatment of fungal infections. TRAF3 is one of the intracellular adapter proteins of the innate immune response that regulates signaling in various cellular processes, including host defense against pathogens. However, the defense mechanism of TRAF3 against A. fumigatus infection remains unknown. In this study, we found that TRAF3 overexpression led to the adhesion and internalization of more spores of A. fumigatus in lung epithelial cells and thus greater host immune surveillance evasion. Meanwhile, TRAF3 was able to regulate the expression of pro-inflammatory cytokines in lung epithelial cells infected with A. fumigatus through the negative regulation of NF-κB and MAPK signaling pathways. In this study, we also examined the effects of TRAF3 in the interaction between lung epithelial cells, macrophages, and A. fumigatus spores, and the results showed that TRAF3-overexpressing lung epithelial cells reduced the migration and activation of macrophages after A. fumigatus infection. In vivo experiments using TRAF3-overexpressing transgenic zebrafish larvae revealed that TRAF3 overexpression increased the fungal load and mortality of zebrafish infected with A. fumigatus. In conclusion, the TRAF3 gene can negatively regulate the resistance of lung epithelial cells to A. fumigatus, which plays an important role in the early infection processes of A. fumigatus.

IMPORTANCE

Aspergillus fumigatus can infect immunocompromised individuals and cause chronic and fatal invasive fungal infections. A better understanding of the molecular mechanisms of A. fumigatus-host interactions may provide new references for disease treatment. In this study, we demonstrated that the TRAF3 gene plays an important role in the early infection of A. fumigatus by regulating the resistance of lung epithelial cells to A. fumigatus. Macrophages are the most abundant innate immune cells in the alveoli; however, few studies have reported on the interactions between lung epithelial cells and macrophages in response to A. fumigatus invasion. In our study, it was demonstrated that the TRAF3 gene reduces migration to macrophages and cytokine production by negatively regulating lung epithelial cell adhesion and internalization of A. fumigatus spores. Together, our results provide new insights into lung epithelial cell-macrophage interactions during A. fumigatus infection.

KEYWORDS: TRAF3, Aspergillus fumigatus, lung epithelial cells, macrophage, zebrafish

INTRODUCTION

Aspergillus fumigatus infection of immunocompromised patients (e.g., those with hereditary immunodeficiency, those who use immunosuppressive drugs, and transplant and AIDS patients) causes invasive aspergillosis (IA). According to reports, more than 300,000 new cases of invasive aspergillosis are reported each year worldwide, with a mortality rate of 30% to 95% (1). On 25 October 2022, A. fumigatus was listed in the critical priority group of the World Health Organization fungal priority pathogens list (2). A. fumigatus is widely present in the natural environment, and humans inhale large numbers of A. fumigatus spores every day. However, A. fumigatus infections rarely occur in immunocompetent individuals, suggesting that the body’s immune system is capable of recognizing and clearing A. fumigatus spores to avoid infection (3, 4).

Lung epithelial cells are situated within the alveoli and cover 95% of the alveolar surface and are organisms’ first line of defense against A. fumigatus spores (5). In immunocompetent hosts infected with A. fumigatus, lung epithelial cells provide a physical barrier and participate in the clearance of spores using mucosal cilia, preventing spores from colonizing the lungs. However, in immunocompromised patients, lung epithelial cells have a reduced ability to clear spores, leading to increased adhesion and germination of A. fumigatus (6). Some studies have shown that A. fumigatus infects lung epithelial cells in vitro, first adhering to the cell surface, followed by internalization into the cell, and after 6 h of infection, its spores begin to germinate budding tubes, known as small hyphae, which in turn cause an invasive infection and recruit professional phagocytes such as macrophages and neutrophils to the site of infection (7, 8).

Alveolar macrophages make up 5% of the total cells in the alveoli, making them the primary resident innate immune cells in the alveoli. Their major role is to phagocytize and kill A. fumigatus spores through oxidative mechanisms and non-oxidative mechanisms of phagosomal acidification and to release cytokines and chemokines to regulate the inflammatory response (9 – 11). Lung epithelial cells and alveolar macrophages coexist in the alveoli and are capable of participating together in the immune response when exposed to inhalation stimuli (12). However, there are few reports on the influence of lung epithelial cells on macrophages in the host response to A. fumigatus infection.

Tumor necrosis factor receptor-associated factor 3 (TRAF3), a member of the TRAF family with E3 ubiquitin ligase activity, is a key node of innate and adaptive immune receptor signaling. It has been shown that TRAF3 is a versatile adapter protein that can participate in the formation of multiple protein complexes and can positively regulate the production of type I interferon while negatively regulating MAPK and NF-κB signaling pathways (13, 14). It has been demonstrated that TRAF3 plays a role in the development of various inflammatory and pathogenic microbial infections, but the function of TRAF3 in anti-infective immunity to A. fumigatus is not clear (15, 16).

A detailed understanding of the molecular mechanisms of A. fumigatus-host interactions could help provide new insights into how to treat A. fumigatus. In this study, we investigated the function of TRAF3 in the early stages of infection with A. fumigatus using lung epithelial cells (A549) in vitro. Furthermore, macrophages were added to the A. fumigatus-lung epithelial cell co-culture model to analyze the effects of changes in TRAF3 gene expression in lung epithelial cells on macrophage migration and cytokine expression. This study provides a new reference for the molecular mechanisms behind the interactions between A. fumigatus, lung epithelial cells, and macrophages.

RESULTS

Expression of TRAF3 in lung epithelial cells

To investigate the role of the TRAF3 gene in A. fumigatus infection of lung epithelial cells, the expression levels of TRAF3 were analyzed after 6 h of infection. The results of qRT-PCR and western blot analysis showed a significant decrease in TRAF3 mRNA and protein expression levels in A549 cells infected with A. fumigatus compared to the control group (Fig. 1A through C). Immunofluorescence analysis was conducted to detect the expression and localization of TRAF3 in A549 cells. The results showed that TRAF3 was expressed in both the nucleus and cytoplasm. However, when the cells were stimulated by A. fumigatus, the expression of TRAF3 was significantly decreased (Fig. 1D and E). These results suggest that the TRAF3 gene is sensitive to early infection by A. fumigatus, and lung epithelial cells respond to early infection by A. fumigatus by down-regulating TRAF3 expression.

Fig 1 — Lung epithelial cell TRAF3 expression is down-regulated under *A. fumigatus* infection. Expression of TRAF3 was detected in A549 cells stimulated or unstimulated with *A. fumigatus* by qRT-PCR and western blot (**A, B, C**). The expression and localization of TRAF3 in A549 cells were determined by immunofluorescence (D, E). Results are expressed as the mean ± SD from three independent experiments. **P < 0.01, ***P < 0.001. Scale bars: 50 µm.

Effect of TRAF3 on adhesion and internalization of A. fumigatus spores in lung epithelial cells

To study the role of TRAF3 in early infection with A. fumigatus, a pIRES-TRAF3-EGFP plasmid was used to induce TRAF3 overexpression in A549 cells, and pIRES-EGFP plasmid transfection was used as a control. Compared with the control cells, A549 cells transfected with the TRAF3 overexpression plasmid showed an increased expression of TRAF3 by at least 140-fold at the mRNA level (Fig. 2A) and nearly 2.5-fold at the protein level (Fig. 2B and C).

Fig 2 — TRAF3 overexpression promotes lung epithelial cell adhesion and internalization of *A. fumigatus* spores. A549 cells were transfected with pIRES-TRAF3-EGFP plasmid (TRAF3) and control pIRES-EGFP plasmid (Vector). mRNA (A) and protein (**B, C**) expression of TRAF3 were determined by qRT-PCR and western blot. *A. fumigatus* spores were co-incubated with A549 cells with or without TRAF3 overexpression for 6 h. *A. fumigatus* spores were labeled with fluorescent white (CFW), then fixed with 4% paraformaldehyde. Cells were dead after fixation and then Annexin-V-stained cell membrane; the number of *A. fumigatus* spores adhered to lung epithelial cells was determined by fluorescence (D). (E) is the number of *A. fumigatus* spores adhered to each cell. The number of internalized *A. fumigatus* spores with or without TRAF3 overexpression in A549 cells was determined by nystatin protection assay (F). Results are expressed as the mean ± SD of three independent experiments. **P < 0.01, ***P < 0.001. Scale bars: 50 µm.

The number of cells adhering to A. fumigatus spores was measured, and the results showed that TRAF3 overexpression significantly increased the ability of A549 to adhere to A. fumigatus spores (Fig. 2D and E). Subsequently, this study examined the effect of TRAF3 on the internalization of A. fumigatus spores by A549 cells, and the results of the nystatin protection assay showed that TRAF3 overexpression increased the internalization rate of A549 cells to 30% compared with a rate of 24% in the control group (Fig. 2F).

Effect of TRAF3 on the inflammatory response induced by A. fumigatus infection of lung epithelial cells

We further evaluated the function of TRAF3 in controlling the inflammatory response of lung epithelial cells to A. fumigatus infection. We stably overexpressed TRAF3 in lung epithelial cells, A549, with or without A. fumigatus stimulation and detected changes in IL-1β, TNF-α, IL-6, and IL-8 mRNA levels in the A549 cells by quantitative real-time PCR and the secretion of the cytokines by ELISA. The results showed that the mRNA and protein levels of these pro-inflammatory cytokines were significantly up-regulated by A. fumigatus stimulation, regardless of whether the TRAF3 gene was overexpressed in A549 cells. Meanwhile, TRAF3 overexpression in A549 cells did not enhance the basal production of these cytokines but was able to inhibit the increase in mRNA and protein levels of pro-inflammatory cytokines induced by A. fumigatus (Fig. 3). These results indicate that TRAF3 inhibits the A. fumigatus-induced production of pro-inflammatory cytokines.

Fig 3 — TRAF3 inhibits the inflammatory response of *A. fumigatus*-stimulated activated lung epithelial cells. IL-1β (A), TNF-α (C), IL-6 (E), IL-8 (G) mRNA levels were detected by quantitative real-time PCR in A549 cells stably overexpressing TRAF3 or vector control with or without *A. fumigatus* stimulation for 6 h; the secretion of IL-1β (B), TNF-α (D), IL-6 (F), and IL-8 (H) was detected by ELISA in A549 cell culture supernatants. Results are expressed as the mean ± SD of three independent experiments. *, # P < 0.05; **, ## P < 0.01; ***P < 0.001.

Role of TRAF3 in the interaction between lung epithelial cells and macrophages in A. fumigatus infection

During the early stages of A. fumigatus infection, macrophages are key phagocytes required for the clearance of A. fumigatus spores (17). To assess whether TRAF3 plays a role in lung epithelial cell interactions with macrophages after infection with A. fumigatus, we constructed an in vitro A. fumigatus spore-A549-macrophage co-culture model (Fig. 4A). The results showed that TRAF3 overexpression in A549 cells inhibited the migration of macrophages upon A. fumigatus infection (Fig. 4B and C) and inhibited cytokine production by macrophages (Fig. 4D). In contrast, conditioned medium collected from A. fumigatus co-cultured with TRAF3 overexpression or control A549 cells failed to promote the migration of macrophages and had no obvious effect on their cytokine expression (Fig. S1). These results suggest that the migration of macrophages and the induction of cytokine expression require the presence of A. fumigatus spores. Furthermore, to confirm that macrophage migration was not due to direct injury to lung epithelial cells, cell viability was assessed by detecting 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide conversion. And cell membrane integrity was assessed by measuring lactate dehydrogenase release (18). The results showed that cell viability was significantly decreased, but cell membrane integrity was not altered after 6 h of A. fumigatus infection of A549 cells, regardless of whether TRAF3 was overexpressed. Moreover, TRAF3 overexpression in A549 cells did not affect cell viability and cell membrane integrity (Fig. S2).

Fig 4 — TRAF3 inhibits macrophage migration and macrophage cytokine production by lung epithelial cells infected with *A. fumigatus*. (A) Schematic of co-culture of *A. fumigatus*, lung epithelial cells, and macrophages. Macrophages that migrated to the lower chamber were fixed with 4% paraformaldehyde, stained with Giemsa staining solution, and counted (**B, C**). The expression of cytokines in the macrophages in the upper chamber of Transwell was analyzed by quantitative real-time PCR (D). Fluorescent staining and nystatin protection assay were performed on lung epithelial cells at the bottom of 24-well plates to detect A549 cells adhesion (**E, F**) and internalization of *A. fumigatus* spores (G). Results are expressed as the mean ± SD of three independent experiments. *, # P < 0.05; **, ## P < 0.01; ***, ### P < 0.001. Scale bars: 50 µm.

The effect of macrophages on lung epithelial cell adhesion and the internalization of spores were examined by fluorescent staining and nystatin protection assay. The results showed that the presence of macrophages reduced the adhesion ratio of A549 cells with A. fumigatus spores from 0.17 to 0.04 and the internalization rate from 23.5% to 8.4%, while the adhesion ratio of TRAF3-overexpressing A549 cells with A. fumigatus spores was reduced from 0.39 to 0.08 and the internalization rate reduced from 31.1% to 11.7% (Fig. 4E through G). These results indicate that macrophages were able to significantly inhibit the adhesion and internalization of most spores to A549 cells, and TRAF3 overexpression was able to enhance the adhesion and internalization of A549 cells to A. fumigatus, regardless of the presence of macrophages.

Effect of TRAF3 on NF-κB and MAPK signaling pathways in A. fumigatus-induced lung epithelial cells

To explore the molecular mechanisms by which TRAF3 regulates lung epithelial cell adhesion, internalizes A. fumigatus spores, and produces inflammatory factors, we analyzed the effects of TRAF3 on MAPK and NF-κB signaling pathways in lung epithelial cells. The results showed that A549 cells stimulation by A. fumigatus significantly promoted the phosphorylation of p65 and IκBα, but the phosphorylation of p65 and IκBα was inhibited by TRAF3 overexpression in A549 cells infected with A. fumigatus (Fig. 5A and B). The p65 nuclear translocation is key to activation of the NF-κB signaling pathway. Overexpression in TRAF3 reduced the accumulation of p65 in the nuclei of A. fumigatus-stimulated induced A549 cells (Fig. 5C and D). Furthermore, immunofluorescence analysis showed that TRAF3 overexpression in A549 cells inhibited the A. fumigatus-induced nuclear translocation of p65 (Fig. 5E). Detection of MAPK signaling pathway-related proteins showed that TRAF3 overexpression decreased the expression of JNK, p-ERK, and p-AKT induced by A. fumigatus in A549 cells (Fig. 5F and G).

Fig 5 — TRAF3 overexpression inhibits the activation of NF-κB and MAPK signaling pathways in *A. fumigatus*-infected lung epithelial cells. Protein expression of p-p65, p65, p-IκBα, IκBα, JNK, p-ERK, ERK, p-AKT, and AKT was detected by western blot for 6 h in A549 cells stimulated with or without TRAF3 overexpression by *A. fumigatus* (**A, B, F, G**). The protein expression of p65 in the nucleus and cytoplasm of A549 cells was detected by western blotting (**C, D**). The expression and localization of p65 in A549 cells were determined by immunofluorescence (E). Results are expressed as the mean ± SD of three independent experiments. ns stands for no statistically significant difference; *, # P < 0.05; **, ## P < 0.01; ***P < 0.001. Scale bars: 50 µm.

Role of TRAF3 in zebrafish resistance to A. fumigatus infection

In order to investigate the role played by TRAF3 during A. fumigatus infection, transgenic zebrafish overexpressing TRAF3 were established, and zebrafish larvae were selected to be infected with A. fumigatus by immersion method (19). The Tol2 transposable plasmid with ubiquitous expression of green fluorescent protein was mixed with transposase mRNA at a mass ratio of 1:1 and microinjected into zebrafish one-cell stage embryos. Transgenic zebrafish with TRAF3 overexpression were screened by fluorescence microscopy (Fig. 6A). The results of qRT-PCR showed that the expression of TRAF3 was significantly decreased according to the time of infection of zebrafish larvae with A. fumigatus (Fig. 6B). Survival analysis showed that the survival rate of TRAF3-overexpressing transgenic zebrafish (31%) after infection was significantly lower than that of wild-type zebrafish (51%) (Fig. 6C). In addition, the fungal load results showed that the number of spores swallowed by TRAF3-overexpressing transgenic zebrafish larvae immersed in E2 medium containing A. fumigatus spores was not significantly different from that of wild-type zebrafish within 2 h, indicating that the infection model was successfully established. After transferring the infected zebrafish to sterile E2 medium, the fungal load in TRAF3-overexpressing transgenic zebrafish was significantly higher than that in wild-type zebrafish at all time points post-infection as infection time increased (Fig. 6D).

Fig 6 — TRAF3 overexpression reduces survival and promotes fungal load *in vivo* in *A. fumigatus*-infected zebrafish. (A) Images of zebrafish larvae transgenic for TRAF3 and expressing EGFP at 3 dpf. qRT-PCR was used to detect the transcriptional expression levels of TRAF3 at various time points after zebrafish infection with *A. fumigatus* (B). Zebrafish larvae were immersed in E2 medium containing 1 × 10⁷ *A. fumigatus* spores and replaced with sterile E2 medium after 2 h. The effect of TRAF3 on the survival rate of zebrafish larvae infected with *A. fumigatus* (C) and the fungal load of zebrafish larvae at various time points (D) were examined.The expression levels of pro-inflammatory cytokines (E–H) in zebrafish infected with *A. fumigatus* at various time points were measured by qRT-PCR. ns stands for no statistically significant difference; *, # P < 0.05; **P < 0.01; ***P < 0.001. Scale bars: 50 µm.

Pro-inflammatory cytokines are rapidly produced in response to infection and promote autoimmune inflammation in the organism. Therefore, qRT-PCR was used to examine the expression of relevant pro-inflammatory cytokines in zebrafish larvae at various time points after infection with A. fumigatus. The results showed that the expression of IL-1β, TNF-α, IL-6, and IL-8 pro-inflammatory cytokines was significantly down-regulated in TRAF3-overexpressing transgenic zebrafish compared with wild-type zebrafish (Fig. 6E through H).

DISCUSSION

A. fumigatus infection can lead to an inflammatory response in the host (20). Research has indicated that TRAF3 plays an active role in inflammation-related diseases such as multiple myeloma, systemic lupus erythematosus, and herpes simplex encephalitis (16, 21, 22). TRAF3 is a key node of innate and adaptive immune receptor signaling and is primarily involved in regulating inflammation, antiviral responses, and cell apoptosis (13). However, the impact of TRAF3 on host resistance to A. fumigatus infection and its related mechanisms remain unclear and worth exploring.

The clearance of A. fumigatus spores from the lungs is linked to the activation of the inflammatory response and secretion of pro-inflammatory cytokines (23). Research has shown that TRAF3 knockout mice die in the early stages of life, indicating that this gene has an important biological function in postnatal development and in maintaining normal immune system function. Currently, there are no agonists or inhibitors available to investigate the TRAF3 gene (24, 25). This study demonstrated that TRAF3 expression decreased after A. fumigatus infection of lung epithelial cells. Therefore, experiments were designed for the overexpression of the TRAF3 gene in vivo and in vitro models to, in turn, demonstrate the function played by the TRAF3 gene during the early infection of A. fumigatus. Furthermore, TRAF3-overexpressing lung epithelial cells showed increased adherence to and internalization of A. fumigatus spores, but their expression of pro-inflammatory cytokines was significantly suppressed. This suggests that TRAF3 has an active role in the host immune response to A. fumigatus infection.

Lung epithelial cells and other stromal cells can adhere to and internalize A. fumigatus spores, but not all the spores are killed, and they can remain latent within the cells, where they evade immune recognition, thus increasing the chance of A. fumigatus spore germination and infection (26, 27). In this study, we found that TRAF3-overexpressing A549 cells adhered to and internalized more A. fumigatus spores than control A549 cells; however, they induced a 23.5% decrease in the migration rate of macrophages and a decrease in the expression of macrophage cytokines. Therefore, it was hypothesized that the internalization of A. fumigatus spores by lung epithelial cells increased, leading to reduced exposure of the spores to immune cells. Macrophage recognition of A. fumigatus spores was therefore reduced, reducing macrophage migration (Fig. 7). Additionally, the study found that medium from a co-culture of A549 cells and A. fumigatus failed to induce macrophage migration, suggesting that the TRAF3-induced pro-inflammatory cytokines expressed by lung epithelial cells infected with A. fumigatus exerted less influence on lung epithelial cell-macrophage interactions.

Fig 7 — Schematic representation of epithelial cells infected with *A. fumigatus* affecting the migration of macrophages. (Left) When lung epithelial cells are infected with *A. fumigatus* spores, a large number of macrophages migrate to the infection site. (Right) TRAF3 overexpression causes lung epithelial cells to adhere to and internalize a large number of *A. fumigatus* spores; fewer *A. fumigatus* spores are recognized by macrophages, and only a small number of macrophages migrate to the infection site.

Through bioinformatics analysis of TRAF3 gene-related signaling pathways, it was discovered that TRAF3 is located upstream of the NF-κB and MAPK signaling pathways. The activation of NF-κB and MAPK signaling pathways is essential for the production of A. fumigatus-induced inflammation in epithelial cells. The activation of these two signaling pathways is mainly associated with the expression of Dectin-1 and Sky genes (7, 28, 29). In this study, it was found that TRAF3 could inhibit the activation of NF-κB and MAPK signaling pathways, thus reducing the release of epithelial cell inflammatory factors induced by A. fumigatus. Therefore, it is speculated that the TRAF3 gene plays a key role in initiating the activation of related signaling pathways after A. fumigatus infection of epithelial cells.

Animal models used to study pathogenic microbial infestations and infections include nematodes, mice, rabbits, zebrafish, etc. Compared to nematodes, zebrafish possess more of the basic characteristics of the human immune system (30). Compared to animal models such as mice and rabbits, zebrafish are genetically easier to manipulate, optically transparent, and possess multiple functional organ systems early in development (31). Therefore, the zebrafish is an ideal model for studying A. fumigatus-host interactions. In this study, we took advantage of the properties of zebrafish to construct a transgenic zebrafish with TRAF3 systemic overexpression and determined the success of the transgenic zebrafish construction by detecting fluorescent protein expression, which saved a lot of time and money in the study.

The construction of A. fumigatus-infected zebrafish models was performed by microinjection of A. fumigatus spores into the hindbrain ventricle (32). A. fumigatus often infects the lungs through the respiratory tract in clinical practice, thus by referring to the construction of a bacterial infection model by Laanto et al., we used a static immersion method to establish a zebrafish model of A. fumigatus infection in this study (23, 33). Zebrafish can be infected with A. fumigatus spores when they open their mouths and gills during respiratory movements, and their infection mode is more likely to mimic clinical infection. In addition, this method is simple to operate and requires less instrumentation than the microinjection method of infection. The fungal load experiment in this study showed that the infection model established by the static immersion method was stable and reproducible. It is suggested that this infection method can not only be used to construct fungal infection models but also for drug development and testing.

In conclusion, this study highlights the significance of the TRAF3 gene in lung epithelial cells during early A. fumigatus infections. This gene negatively regulates NF-κB and MAPK signaling pathways, which in turn affect the expression of pro-inflammatory cytokines in lung epithelial cells after A. fumigatus infection. Additionally, TRAF3 influences macrophage migration and related cytokine expression by modifying epithelial cell adhesion and internalizing A. fumigatus spores. These findings suggest that the TRAF3 gene is a potential therapeutic target for diseases associated with A. fumigatus infection.

MATERIALS AND METHODS

A. fumigatus culture

The A. fumigatus strain IFM40808 used in this study was a clinical isolate gifted from the Medical Mycology Research Center of Chiba University, Japan, and was stored in the laboratory. A. fumigatus strains were grown on potato dextrose agar (PDA) slants and at 37°C for 4 days. The slants were rinsed with saline containing 0.01% Tween 20, the spore suspension was collected, and the hyphae were filtered out using a sterile cell strainer and counted using a hemocytometer.

Cell cultures

Human lung type II lung epithelial cells (A549) and human monocytes (THP-1) used for these experiments were purchased from the American Type Culture Collection. The cells were grown in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and cultured in a 37°C, 5% CO₂ cell culture incubator. THP-1 cells were derived from patients with acute monocytic leukemia and could differentiate into macrophage-like cells by exposure to phorbol 12-myristate 13-acetate (PMA). Before the experiment, THP-1 cells were induced with 100 ng/mL PMA (Absin, Shanghai, China) for 72 h to differentiate into THP-1-like macrophages (34).

Cell transfection

The TRAF3 overexpression plasmid plRES-EGFP (plRES-EGFP-CMV-MCS-EGFP-Neo) used for cell transfection was purchased from Beijing Syngentech Co., Ltd., China. A549 cells were seeded into well plates and cultured overnight, washed three times with RPMI-1640 medium, and transfected according to the instructions for Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific). The enhanced fluorescence of green fluorescent protein was observed with an Olympus Model IX71 fluorescent microscope (Evident Olympus, Tokyo, Japan) at 48 h post-transfection.

Internalization

Internalization of A. fumigatus spores by A549 was assayed using the nystatin protection assay (35). A549 cells were seeded at 5 × 10⁴ cells/well into 24-well plates (Corning, Costar, New York, USA) and cultivated overnight in a cell incubator at 37°C with 5% CO₂. A. fumigatus spores were co-cultured with A549 cells at MOI = 10:1 for 6 h. After discarding the supernatant, the cells were washed three times with PBS, and RPMI-1640 medium containing 20 µg/mL nystatin was added and incubated for 4 h to kill extracellular spores. Cells were then washed three times with PBS and incubated with 0.25% Triton X-100 (Boster Biotechnology, China) for 15 min to lyse the cells. The lysates were diluted 100-fold and inoculated onto PDA plates, and individual colony-forming units (CFUs) were counted after culture for 48 h in a 37°C incubator. The spore internalization rate was calculated with this formula: Internalization rate = intracellular conidia colonies/initial inoculum of conidia × 100% (36).

Adherence

Adhesion values represent the percentage of total conidia bound to A549 cells (26, 37). Coverslips (15 mm) (Corning, Costar, New York, USA) were put in the bottom of 24-well plates, which were subsequently seeded with A549 cells. After the cells were adhered with 90% confluence, A. fumigatus spores were cultured with the A549 cells at MOI = 10:1 for 6 h in a cell incubator at 37°C with 5% CO₂. The cells were washed three times with PBS to remove spores that were not bound to the cells. Adherent spores were labeled with 0.003% Calcofluor-white (Sigma, USA) and incubated for 5 min in the dark. Then, the cells were washed three times with PBS, and 4% paraformaldehyde was added for 20 min at room temperature to fix the cells. After the cells were fixed, the cell membranes were labeled with Annexin V-PE staining solution (Beyotime Biotechnology, China) and incubated for 10 min in the dark. Excess staining solution was washed off with PBS, and the coverslips removed from the wells. Subsequently, coverslips were mounted on glass slides using Anti-Fluorescence Attenuating Sealer (Solarbio Science & Technology, China). In order to determine the total number of spores adhered to lung epithelial cells, 12 randomly selected fields of the coverslips were photographed with a BX53 microscope (Evident Olympus, Tokyo, Japan). The number of spores adhered to A549 cells was counted using Image J software.

ELISA

TRAF3-overexpression or control A549 cells were co-cultured with A. fumigatus spores for 6 h. The supernatant was removed and centrifuged at 4°C, 5,000 rpm for 5 min. The supernatant was transferred into a new 1.5-mL EP tube. Levels of IL-1β, TNF-α, IL-6, and IL-8 in supernatants were measured by ELISA kits (Servicebio, Wuhan, China) according to the reagent manufacturer’s protocol.

Cells were washed three times with pre-cooled PBS, lysed in 6-well plates with radioactive immunoprecipitation assay buffer containing 1 mM phenylmethylsulfonyl fluoride, and centrifuged at 12,000 rpm for 20 min, and the supernatant was aspirated and used to detect total cellular protein. Nuclear and Cytoplasmic Protein Extraction Kit was purchased from Absin, Shanghai, China. Protein concentration was measured via BCA Protein Assay Kit (Beyotime Biotechnology, China). The 10% SDS-PAGE gels were prepared using the PAGE Gel Rapid Preparation Kit (Shanghai Epizyme Biomedical Technology Co., Ltd). Then, 15 µg of sample protein was loaded into each well for electrophoresis. Subsequently, the proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, USA), blocked with Western high-performance blocking solution (Genefirst, Shanghai, China) for 10 min, washed three times with TBST for 5 min each time, and incubated with primary antibody overnight at 4°C; then the wash steps were repeated, and the cells were incubated with secondary antibody at room temperature (Absin, Shanghai China) for 2 h. After repeating the washing steps, immunoblots were developed with enhanced chemiluminescence ECL kit (Biosharp, China) detection reagents, and images were acquired using a Tanon 4200 chemiluminescence imaging system (Tanon, Shanghai, China). The gray values of the images were analyzed with ImageJ software. The antibodies p65 (1∶1,000), IκBα (1∶2,000), JNK (1∶1,000), p-ERK (1∶2,000), ERK (1∶2,000), AKT (1∶1,000), and GAPDH (1∶2,000) used in this experiment were purchased from PTM Biolabs, Hangzhou, China. The antibodies TRAF3 (1∶1,000), p-p65 (1∶1,000), p-IκBα (1∶1,000), p-AKT (1∶1,000), and LaminB (1∶1,000) used in this experiment were purchased from Wanleibio, Shenyang, China.

Western blotting

Polymerase chain reaction

For cellular RNA extraction, 400 µL TRIzol was added to the cell culture wells for lysis. For zebrafish RNA extraction, 10 zebrafish were placed into 1.5-mL EP tubes, and 400 µL TRIzol added for lysis (38). RNA was isolated and purified according to the manufacturer’s instructions for the use of TRIzol reagent (TaKaRa, Japan). RNA was reverse transcribed into cDNA using a cDNA Reverse Transcription Kit (Monad, Shanghai, China). Real-time quantitative PCR (RT-qPCR) analysis was performed using SYBR Green PCR Mix (Monad, Shanghai, China) in the ABI QuantStudio 3 PCR system (Applied Biosystems, Waltham, MA, USA). The primers used are listed in Table 1.

TABLE 1.

Primers used for qPCR

Human	Forward	Reverse
TRAF3	TGACCAGATGCTGAGTGTGC	CTGGCTGTAAAGGGACAGGG
IL-1β	ACGATGCACCTGTACGATCA	TCTTTCAACACGCAGGACAG
TNF-α	AACCTCCTCTCTGCCATCAA	CCAAAGTAGACCTGCCCAGA
IL-6	TACCCCCAGGAGAAGATTCC	TTTTCTGCCAGTGCCTCTTT
IL-8	TGTGAAGGTGCAGTTTTGCC	ACCCAGTTTTCCTTGGGGTC
GAPDH	CAAATTCCATGGCACCGTCA	GGACTCCACGACGTACTCAG
CCL5	ATGACTCCCGGCTGAACAAG	GCCTCCCAAGCTAGGACAAG
CCL17	ACTTCAAGGGAGCCATTCCC	TGTTGGGGTCCGAACAGATG

Open in a new tab

Macrophage migration and co-culture in Transwell

TRAF3-overexpressing A549 or control A549 cells with A. fumigatus spores were seeded into the lower chambers of Transwell plates (Corning, Costar, New York, USA) containing polyethylene terephthalate membrane inserts with a pore size of 5 µm (or 0.4 µm). The THP-1-like macrophages were digested, centrifuged, and resuspended in RPMI-1640, and the cell concentration was adjusted to 1 × 10⁶ cells/mL. Then, 200 µL of cells was inoculated into the upper chambers of Transwell plates, which were cultured for a total of 6 h at 37°C in a 5% CO₂ cell culture incubator. Cells in the upper chamber of 5 µm Transwell plates were fixed with 4% paraformaldehyde and stained with Giemsa staining solution (Beyotime Biotechnology, China). The suspended cells on the upper layer of the polyethylene terephthalate membrane were cleaned out, photographed with an IX71 microscope, and analyzed with Image J software to calculate the number of migrated cells. Cells in the upper chamber of 0.4-µm Transwell plates were harvested for quantitative polymerase chain reaction, and A549 cells in the lower chamber were used for the detection of conidia in internalization and adhesion assays.

Immunofluorescence

A549 cells were seeded into 24-well plates containing 15-mm coverslips and co-cultured with A. fumigatus spores for 6 h. Cells were fixed with 4% paraformaldehyde and washed three times with PBS for 5 min each. We added 0.2% Triton-100 (Boster Biotechnology, China) to break down the membranes at room temperature for 30 min. The washing step was repeated, and 10% albumin (Solarbio Science & Technology, China) added and incubated for 1 h at room temperature. The washing step was repeated, and the primary antibody added and incubated overnight at 4°C. The washing step was repeated, and the secondary antibody added and incubated at room temperature for 1 h. Then 30 µL of anti-fluorescence quenching blocker containing DAPI was added (Absin, Shanghai, China) dropwise to the coverslip; the coverslip was removed from the well plate, the surface with the cells side placed onto a coverslip, and pictures were taken with a fluorescence microscope BX53. Primary antibodies, such as TRAF3 (1∶50) was purchased from Wanleibio, Shenyang, China, and p65(1∶50) was purchased from PTM Biolabs, Hangzhou, China. Secondary Cy3-labeled goat anti-mouse IgG antibodies were purchased from Servicebio, Wuhan, China; FITC-labeled goat anti-mouse IgG antibodies were purchased from Absin, Shanghai, China.

Transgenic zebrafish construction

Wild-type AB zebrafish (ZFIN ID: ZDB-GENO-960809-7) were used in this study, and all experiments were approved by the Ethics Committee of Jilin University. The Tol2-EF1α:EGFP and Tol2-EF1α:TRAF3-EGFP plasmids and Tol2 transposase messenger RNA used in this study were purchased from Hunter Biotech, China. Transposase mRNA was mixed with Tol2-EF1α:EGFP or Tol2-EF1α:TRAF3-EGFP plasmids in equal proportions (39). Zebrafish embryos were arranged on a mold and injected into animal poles with a glass needle under a microscope (ASI MPPI-3). Injected zebrafish embryos were cultured in a constant temperature incubator at 28°C with 14-h/10-h light-dark cycle. Injected zebrafish embryos were cultured in a constant temperature incubator at 28°C with 14-h/10-h light and darkness. Zebrafish embryos 3 days post fertilization were screened for EGFP fluorescence, indicating the expression of transgenic lines.

Static immersion infection model

The A. fumigatus spore suspension was prepared at a concentration of 10⁷ CFU/mL. Zebrafish larvae at 3 days post fertilization were placed in a 96-well plate with one fish per well. Spore suspension (100 µL) was added to the well plate containing the zebrafish and soaked for 2 h. The spore suspension was replaced with E2 culture medium, and the survival rate was recorded every 24 h.

Fungal burden determination

Six zebrafish were homogenized in sterile E2 culture medium. The homogenate was diluted 10-fold with PBS, and 50 µL was spread onto PDA plates and incubated in an incubator at 37°C for 48 h. The fungal burden of zebrafish was calculated by counting CFU.

Statistical analysis

At least three independent replicates of each experiment were performed in this study, and data are expressed as mean ± standard deviation. Statistical analyses were performed using GraphPad Prism software version 8.0 (Dotmatics, San Diego, CA, USA). An unpaired two-tailed t-tests were used for comparisons between two groups. And one-way ANOVA followed by t-test was used for comparison between three or more groups. P < 0.05 was considered to indicate a statistically significant difference.

Supplementary Material

Reviewer comments

reviewer-comments.pdf^{(1.5MB, pdf)}

ACKNOWLEDGMENTS

We thank Suzanne Leech, Ph.D., from Edanz for editing a draft of this manuscript.

This study was supported by grants from the National Natural Science Foundation of China (81772162 and U1704283) and a grant from the Science and Technology Department of Jilin Province (20230203015SF).

Contributor Information

Li Wang, Email: wli99@jlu.edu.cn.

Lea Atanasova, University of Natural Resources and Life Sciences Vienna, Wien, Austria .

Andrew Wagner, University of Wisconsin-Madison, Madison, Wisconsin, USA .

Benjamin P. Knox, University of Wisconsin-Madison, Madison, Wisconsin, USA

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/spectrum.02699-23.

Fig. S1 and S2. spectrum.02699-23-s0001.docx.

Fig. S1: Role of TRAF3 in the interaction between lung epithelial cells and macrophages in A. fumigatus infection. Fig. S2: Effect of TRAF3 to the viability and cell membrane integrity of lung epithelial cells infected with A. fumigatus.

Click here for additional data file.^{(528.5KB, docx)}

DOI: 10.1128/spectrum.02699-23.SuF1

OPEN PEER REVIEW. reviewer-comments.pdf.

An accounting of the reviewer comments and feedback.

Click here for additional data file.^{(1.5MB, pdf)}

DOI: 10.1128/spectrum.02699-23.SuF2

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1. Fernandes CM, Normile TG, Fabri J, Brauer VS, de S Araújo GR, Frases S, Nimrichter L, Malavazi I, Del Poeta M. 2022. Vaccination with live or heat-killed Aspergillus fumigatus ΔsglA Conidia fully protects immunocompromised mice from invasive aspergillosis. mBio 13:e0232822. doi: 10.1128/mbio.02328-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Organization GWH . 2022. WHO fungal priority pathogens list to guide research, development and public health action. Licence: CC BY-NC-SA 3.0 IGO
3. Rosowski EE, Raffa N, Knox BP, Golenberg N, Keller NP, Huttenlocher A. 2018. Macrophages inhibit Aspergillus fumigatus germination and neutrophil-mediated fungal killing. PLoS Pathog 14:e1007229. doi: 10.1371/journal.ppat.1007229 [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Wassano NS, Goldman GH, Damasio A. 2020. Aspergillus fumigatus. Trends Microbiol 28:594–595. doi: 10.1016/j.tim.2020.02.013 [DOI] [PubMed] [Google Scholar]
5. Donati Y, Blaskovic S, Ruchonnet-Métrailler I, Lascano Maillard J, Barazzone-Argiroffo C. 2020. Simultaneous isolation of endothelial and alveolar epithelial type I and type II cells during mouse lung development in the absence of a transgenic reporter. Am J Physiol Lung Cell Mol Physiol 318:L619–L630. doi: 10.1152/ajplung.00227.2019 [DOI] [PubMed] [Google Scholar]
6. Speirs JJ, van der Ent CK, Beekman JM. 2012. Effects of Aspergillus fumigatus colonization on lung function in cystic fibrosis. Curr Opin Pulm Med 18:632–638. doi: 10.1097/MCP.0b013e328358d50b [DOI] [PubMed] [Google Scholar]
7. Sun H, Xu X, Tian X, Shao H, Wu X, Wang Q, Su X, Shi Y. 2014. Activation of NF-ΚB and respiratory burst following Aspergillus fumigatus stimulation of macrophages. Immunobiology 219:25–36. doi: 10.1016/j.imbio.2013.06.013 [DOI] [PubMed] [Google Scholar]
8. Zhang W, He D, Wei Y, Shang S, Li D, Wang L. 2022. Suppression of Aspergillus fumigatus germination by neutrophils is enhanced by endothelial-derived CSF3 production. Front Microbiol 13:837776. doi: 10.3389/fmicb.2022.837776 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Earle K, Valero C, Conn DP, Vere G, Cook PC, Bromley MJ, Bowyer P, Gago S. 2023. Pathogenicity and virulence of Aspergillus fumigatus. Virulence 14:2172264. doi: 10.1080/21505594.2023.2172264 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Shlezinger N, Hohl TM. 2021. Mitochondrial reactive oxygen species enhance alveolar macrophage activity against Aspergillus fumigatus but are dispensable for host protection. mSphere 6:e0026021. doi: 10.1128/mSphere.00260-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Margalit A, Kavanagh K. 2015. The innate immune response to Aspergillus fumigatus at the alveolar surface. FEMS Microbiol Rev 39:670–687. doi: 10.1093/femsre/fuv018 [DOI] [PubMed] [Google Scholar]
12. van de Veerdonk FL, Gresnigt MS, Romani L, Netea MG, Latgé J-P. 2017. Aspergillus fumigatus morphology and dynamic host interactions. Nat Rev Microbiol 15:661–674. doi: 10.1038/nrmicro.2017.90 [DOI] [PubMed] [Google Scholar]
13. He JQ, Oganesyan G, Saha SK, Zarnegar B, Cheng G. 2007. TRAF3 and its biological function. Adv Exp Med Biol 597:48–59. doi: 10.1007/978-0-387-70630-6_4 [DOI] [PubMed] [Google Scholar]
14. Lin M, Ji X, Lv Y, Cui D, Xie J. 2023. The roles of TRAF3 in immune responses. Dis Markers 2023:7787803. doi: 10.1155/2023/7787803 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Chen F, Chen L, Li Y, Sang H, Zhang C, Yuan S, Yang J. 2022. TRAF3 positively regulates host innate immune resistance to influenza A virus infection. Front Cell Infect Microbiol 12:839625. doi: 10.3389/fcimb.2022.839625 [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Sun XQ, Liu WS, Zhang HM, Xuan CY, Wang Y, Fu BB. 2022. TRAF3 plays a role in lupus nephritis by regulating Th17 cell and Treg cell balance as well as NF-ΚB signaling pathway in mice. Gen Physiol Biophys 41:151–158. doi: 10.4149/gpb_2022005 [DOI] [PubMed] [Google Scholar]
17. Margalit A, Kavanagh K. 2015. The innate immune response to Aspergillus fumigatus at the alveolar surface. FEMS Microbiol Rev 39:670–687. doi: 10.1093/femsre/fuv018 [DOI] [PubMed] [Google Scholar]
18. Feldman MB, Dutko RA, Wood MA, Ward RA, Leung HM, Snow RF, De La Flor DJ, Yonker LM, Reedy JL, Tearney GJ, Mou H, Hurley BP, Vyas JM. 2020. Aspergillus fumigatus cell wall promotes apical airway epithelial recruitment of human neutrophils. Infect Immun 88:e00813-19. doi: 10.1128/IAI.00813-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Zou PF, Nie P. 2017. Zebrafish as a model for the study of host-virus interactions. Methods Mol Biol 1656:57–78. doi: 10.1007/978-1-4939-7237-1_2 [DOI] [PubMed] [Google Scholar]
20. Croft CA, Culibrk L, Moore MM, Tebbutt SJ. 2016. Interactions of Aspergillus fumigatus conidia with airway epithelial cells: a critical review. Front Microbiol 7:472. doi: 10.3389/fmicb.2016.00472 [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Edwards SK, Han Y, Liu Y, Kreider BZ, Liu Y, Grewal S, Desai A, Baron J, Moore CR, Luo C, Xie P. 2016. Signaling mechanisms of bortezomib in TRAF3-deficient mouse B lymphoma and human multiple myeloma cells. Leuk Res 41:85–95. doi: 10.1016/j.leukres.2015.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Pérez de Diego R, Sancho-Shimizu V, Lorenzo L, Puel A, Plancoulaine S, Picard C, Herman M, Cardon A, Durandy A, Bustamante J, Vallabhapurapu S, Bravo J, Warnatz K, Chaix Y, Cascarrigny F, Lebon P, Rozenberg F, Karin M, Tardieu M, Al-Muhsen S, Jouanguy E, Zhang SY, Abel L, Casanova JL. 2010. Human TRAF3 Adaptor molecule deficiency leads to impaired toll-like receptor 3 response and susceptibility to herpes simplex encephalitis. Immunity 33:400–411. doi: 10.1016/j.immuni.2010.08.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Hasenberg M, Behnsen J, Krappmann S, Brakhage A, Gunzer M. 2011. Phagocyte responses towards Aspergillus fumigatus. Int J Med Microbiol 301:436–444. doi: 10.1016/j.ijmm.2011.04.012 [DOI] [PubMed] [Google Scholar]
24. Xu Y, Cheng G, Baltimore D. 1996. Targeted disruption of TRAF3 leads to postnatal lethality and defective T-dependent immune responses. Immunity 5:407–415. doi: 10.1016/s1074-7613(00)80497-5 [DOI] [PubMed] [Google Scholar]
25. Ai Q, Lin X, Xie H, Li B, Liao M, Fan H. 2021. Proteome analysis in PAM cells reveals that African swine fever virus can regulate the level of intracellular Polyamines to facilitate its own replication through ARG1. Viruses 13:1236. doi: 10.3390/v13071236 [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Escobar N, Ordonez SR, Wösten HA, Haas PJ, de Cock H, Haagsman HP. 2016. Hide, keep quiet, and keep low: properties that make Aspergillus fumigatus a successful lung pathogen. Front Microbiol 7:438. doi: 10.3389/fmicb.2016.00438 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Wasylnka JA, Moore MM. 2003. Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J Cell Sci 116:1579–1587. doi: 10.1242/jcs.00329 [DOI] [PubMed] [Google Scholar]
28. Zhao GQ, Lin J, Hu L-T, Yin XN, Wang Q, Xu Q, Li H. 2016. The role of Dectin-1/Raf-1 signal cascade in innate immune of human corneal epithelial cells against Aspergillus fumigatus infection. Int J Ophthalmol 9:1371–1375. doi: 10.18240/ijo.2016.10.01 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Liu Y, Li Z, Wang S, Zhang C, Han L, Sun Q, Han X. 2021. Aspergillus fumigatus induces the release of IL-8 and MCP-1 by activating nuclear transcription through Dectin-1 and Cr3 receptors in alveolar epithelial cells. Curr Microbiol 78:3474–3482. doi: 10.1007/s00284-021-02534-5 [DOI] [PubMed] [Google Scholar]
30. Paulussen C, Boulet GA, Cos P, Delputte P, Maes L. 2014. Animal models of invasive aspergillosis for drug discovery. Drug Discov Today 19:1380–1386. doi: 10.1016/j.drudis.2014.06.006 [DOI] [PubMed] [Google Scholar]
31. Rosowski EE, Knox BP, Archambault LS, Huttenlocher A, Keller NP, Wheeler RT, Davis JM. 2018. The Zebrafish as a model host for invasive fungal infections. J Fungi (Basel) 4:136. doi: 10.3390/jof4040136 [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Schoen TJ, Huttenlocher A, Keller NP. 2021. Guide to the larval Zebrafish-Aspergillus infection model. Curr Protoc 1:e317. doi: 10.1002/cpz1.317 [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Laanto E, Bamford JK, Laakso J, Sundberg LR. 2012. Phage-driven loss of virulence in a fish pathogenic bacterium. PLoS One 7:e53157. doi: 10.1371/journal.pone.0053157 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Ji Q, Wang L, Liu J, Wu Y, Lv H, Wen Y, Shi L, Qu B, Szentmáry N. 2021. Correction To: Aspergillus fumigatus-stimulated human corneal epithelial cells induce pyroptosis of THP-1 macrophages by secreting TSLP. Inflammation 44:682–692. doi: 10.1007/s10753-021-01502-2 [DOI] [PubMed] [Google Scholar]
35. Zhang C, Chen F, Liu X, Han X, Hu Y, Su X, Chen Y, Sun Y, Han L. 2019. Gliotoxin induces cofilin phosphorylation to promote actin cytoskeleton dynamics and internalization of Aspergillus fumigatus into type II human pneumocyte cells. Front Microbiol 10:1345. doi: 10.3389/fmicb.2019.01345 [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Zhang X, He D, Gao S, Wei Y, Wang L. 2020. iTRAQ-based Proteomic analysis of the interaction of A549 human lung epithelial cells with Aspergillus fumigatus conidia. Mol Med Rep 22:4601–4610. doi: 10.3892/mmr.2020.11582 [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Gravelat FN, Ejzykowicz DE, Chiang LY, Chabot JC, Urb M, Macdonald KD, al-Bader N, Filler SG, Sheppard DC. 2010. Aspergillus fumigatus meda governs adherence, host cell interactions and virulence. Cell Microbiol 12:473–488. doi: 10.1111/j.1462-5822.2009.01408.x [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Jiang J, Tang S, Xia J, Wen J, Chen S, Shu X, Huen MSY, Deng Y. 2018. C9orf140, a novel Axin1-interacting protein, mediates the negative feedback loop of WNT/β-catenin signaling. Oncogene 37:2992–3005. doi: 10.1038/s41388-018-0166-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Carter SP, Moran AL, Matallanas D, McManus GJ, Blacque OE, Kennedy BN. 2020. Genetic deletion of Zebrafish Rab28 causes defective outer segment shedding, but not retinal degeneration. Front Cell Dev Biol 8:136. doi: 10.3389/fcell.2020.00136 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Reviewer comments

reviewer-comments.pdf^{(1.5MB, pdf)}

Fig. S1 and S2. spectrum.02699-23-s0001.docx.

Click here for additional data file.^{(528.5KB, docx)}

DOI: 10.1128/spectrum.02699-23.SuF1

OPEN PEER REVIEW. reviewer-comments.pdf.

An accounting of the reviewer comments and feedback.

Click here for additional data file.^{(1.5MB, pdf)}

DOI: 10.1128/spectrum.02699-23.SuF2

[B1] 1. Fernandes CM, Normile TG, Fabri J, Brauer VS, de S Araújo GR, Frases S, Nimrichter L, Malavazi I, Del Poeta M. 2022. Vaccination with live or heat-killed Aspergillus fumigatus ΔsglA Conidia fully protects immunocompromised mice from invasive aspergillosis. mBio 13:e0232822. doi: 10.1128/mbio.02328-22 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2. Organization GWH . 2022. WHO fungal priority pathogens list to guide research, development and public health action. Licence: CC BY-NC-SA 3.0 IGO

[B3] 3. Rosowski EE, Raffa N, Knox BP, Golenberg N, Keller NP, Huttenlocher A. 2018. Macrophages inhibit Aspergillus fumigatus germination and neutrophil-mediated fungal killing. PLoS Pathog 14:e1007229. doi: 10.1371/journal.ppat.1007229 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Wassano NS, Goldman GH, Damasio A. 2020. Aspergillus fumigatus. Trends Microbiol 28:594–595. doi: 10.1016/j.tim.2020.02.013 [DOI] [PubMed] [Google Scholar]

[B5] 5. Donati Y, Blaskovic S, Ruchonnet-Métrailler I, Lascano Maillard J, Barazzone-Argiroffo C. 2020. Simultaneous isolation of endothelial and alveolar epithelial type I and type II cells during mouse lung development in the absence of a transgenic reporter. Am J Physiol Lung Cell Mol Physiol 318:L619–L630. doi: 10.1152/ajplung.00227.2019 [DOI] [PubMed] [Google Scholar]

[B6] 6. Speirs JJ, van der Ent CK, Beekman JM. 2012. Effects of Aspergillus fumigatus colonization on lung function in cystic fibrosis. Curr Opin Pulm Med 18:632–638. doi: 10.1097/MCP.0b013e328358d50b [DOI] [PubMed] [Google Scholar]

[B7] 7. Sun H, Xu X, Tian X, Shao H, Wu X, Wang Q, Su X, Shi Y. 2014. Activation of NF-ΚB and respiratory burst following Aspergillus fumigatus stimulation of macrophages. Immunobiology 219:25–36. doi: 10.1016/j.imbio.2013.06.013 [DOI] [PubMed] [Google Scholar]

[B8] 8. Zhang W, He D, Wei Y, Shang S, Li D, Wang L. 2022. Suppression of Aspergillus fumigatus germination by neutrophils is enhanced by endothelial-derived CSF3 production. Front Microbiol 13:837776. doi: 10.3389/fmicb.2022.837776 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Earle K, Valero C, Conn DP, Vere G, Cook PC, Bromley MJ, Bowyer P, Gago S. 2023. Pathogenicity and virulence of Aspergillus fumigatus. Virulence 14:2172264. doi: 10.1080/21505594.2023.2172264 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Shlezinger N, Hohl TM. 2021. Mitochondrial reactive oxygen species enhance alveolar macrophage activity against Aspergillus fumigatus but are dispensable for host protection. mSphere 6:e0026021. doi: 10.1128/mSphere.00260-21 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Margalit A, Kavanagh K. 2015. The innate immune response to Aspergillus fumigatus at the alveolar surface. FEMS Microbiol Rev 39:670–687. doi: 10.1093/femsre/fuv018 [DOI] [PubMed] [Google Scholar]

[B12] 12. van de Veerdonk FL, Gresnigt MS, Romani L, Netea MG, Latgé J-P. 2017. Aspergillus fumigatus morphology and dynamic host interactions. Nat Rev Microbiol 15:661–674. doi: 10.1038/nrmicro.2017.90 [DOI] [PubMed] [Google Scholar]

[B13] 13. He JQ, Oganesyan G, Saha SK, Zarnegar B, Cheng G. 2007. TRAF3 and its biological function. Adv Exp Med Biol 597:48–59. doi: 10.1007/978-0-387-70630-6_4 [DOI] [PubMed] [Google Scholar]

[B14] 14. Lin M, Ji X, Lv Y, Cui D, Xie J. 2023. The roles of TRAF3 in immune responses. Dis Markers 2023:7787803. doi: 10.1155/2023/7787803 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Chen F, Chen L, Li Y, Sang H, Zhang C, Yuan S, Yang J. 2022. TRAF3 positively regulates host innate immune resistance to influenza A virus infection. Front Cell Infect Microbiol 12:839625. doi: 10.3389/fcimb.2022.839625 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16. Sun XQ, Liu WS, Zhang HM, Xuan CY, Wang Y, Fu BB. 2022. TRAF3 plays a role in lupus nephritis by regulating Th17 cell and Treg cell balance as well as NF-ΚB signaling pathway in mice. Gen Physiol Biophys 41:151–158. doi: 10.4149/gpb_2022005 [DOI] [PubMed] [Google Scholar]

[B17] 17. Margalit A, Kavanagh K. 2015. The innate immune response to Aspergillus fumigatus at the alveolar surface. FEMS Microbiol Rev 39:670–687. doi: 10.1093/femsre/fuv018 [DOI] [PubMed] [Google Scholar]

[B18] 18. Feldman MB, Dutko RA, Wood MA, Ward RA, Leung HM, Snow RF, De La Flor DJ, Yonker LM, Reedy JL, Tearney GJ, Mou H, Hurley BP, Vyas JM. 2020. Aspergillus fumigatus cell wall promotes apical airway epithelial recruitment of human neutrophils. Infect Immun 88:e00813-19. doi: 10.1128/IAI.00813-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19. Zou PF, Nie P. 2017. Zebrafish as a model for the study of host-virus interactions. Methods Mol Biol 1656:57–78. doi: 10.1007/978-1-4939-7237-1_2 [DOI] [PubMed] [Google Scholar]

[B20] 20. Croft CA, Culibrk L, Moore MM, Tebbutt SJ. 2016. Interactions of Aspergillus fumigatus conidia with airway epithelial cells: a critical review. Front Microbiol 7:472. doi: 10.3389/fmicb.2016.00472 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21. Edwards SK, Han Y, Liu Y, Kreider BZ, Liu Y, Grewal S, Desai A, Baron J, Moore CR, Luo C, Xie P. 2016. Signaling mechanisms of bortezomib in TRAF3-deficient mouse B lymphoma and human multiple myeloma cells. Leuk Res 41:85–95. doi: 10.1016/j.leukres.2015.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22. Pérez de Diego R, Sancho-Shimizu V, Lorenzo L, Puel A, Plancoulaine S, Picard C, Herman M, Cardon A, Durandy A, Bustamante J, Vallabhapurapu S, Bravo J, Warnatz K, Chaix Y, Cascarrigny F, Lebon P, Rozenberg F, Karin M, Tardieu M, Al-Muhsen S, Jouanguy E, Zhang SY, Abel L, Casanova JL. 2010. Human TRAF3 Adaptor molecule deficiency leads to impaired toll-like receptor 3 response and susceptibility to herpes simplex encephalitis. Immunity 33:400–411. doi: 10.1016/j.immuni.2010.08.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Hasenberg M, Behnsen J, Krappmann S, Brakhage A, Gunzer M. 2011. Phagocyte responses towards Aspergillus fumigatus. Int J Med Microbiol 301:436–444. doi: 10.1016/j.ijmm.2011.04.012 [DOI] [PubMed] [Google Scholar]

[B24] 24. Xu Y, Cheng G, Baltimore D. 1996. Targeted disruption of TRAF3 leads to postnatal lethality and defective T-dependent immune responses. Immunity 5:407–415. doi: 10.1016/s1074-7613(00)80497-5 [DOI] [PubMed] [Google Scholar]

[B25] 25. Ai Q, Lin X, Xie H, Li B, Liao M, Fan H. 2021. Proteome analysis in PAM cells reveals that African swine fever virus can regulate the level of intracellular Polyamines to facilitate its own replication through ARG1. Viruses 13:1236. doi: 10.3390/v13071236 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26. Escobar N, Ordonez SR, Wösten HA, Haas PJ, de Cock H, Haagsman HP. 2016. Hide, keep quiet, and keep low: properties that make Aspergillus fumigatus a successful lung pathogen. Front Microbiol 7:438. doi: 10.3389/fmicb.2016.00438 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Wasylnka JA, Moore MM. 2003. Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J Cell Sci 116:1579–1587. doi: 10.1242/jcs.00329 [DOI] [PubMed] [Google Scholar]

[B28] 28. Zhao GQ, Lin J, Hu L-T, Yin XN, Wang Q, Xu Q, Li H. 2016. The role of Dectin-1/Raf-1 signal cascade in innate immune of human corneal epithelial cells against Aspergillus fumigatus infection. Int J Ophthalmol 9:1371–1375. doi: 10.18240/ijo.2016.10.01 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Liu Y, Li Z, Wang S, Zhang C, Han L, Sun Q, Han X. 2021. Aspergillus fumigatus induces the release of IL-8 and MCP-1 by activating nuclear transcription through Dectin-1 and Cr3 receptors in alveolar epithelial cells. Curr Microbiol 78:3474–3482. doi: 10.1007/s00284-021-02534-5 [DOI] [PubMed] [Google Scholar]

[B30] 30. Paulussen C, Boulet GA, Cos P, Delputte P, Maes L. 2014. Animal models of invasive aspergillosis for drug discovery. Drug Discov Today 19:1380–1386. doi: 10.1016/j.drudis.2014.06.006 [DOI] [PubMed] [Google Scholar]

[B31] 31. Rosowski EE, Knox BP, Archambault LS, Huttenlocher A, Keller NP, Wheeler RT, Davis JM. 2018. The Zebrafish as a model host for invasive fungal infections. J Fungi (Basel) 4:136. doi: 10.3390/jof4040136 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32. Schoen TJ, Huttenlocher A, Keller NP. 2021. Guide to the larval Zebrafish-Aspergillus infection model. Curr Protoc 1:e317. doi: 10.1002/cpz1.317 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Laanto E, Bamford JK, Laakso J, Sundberg LR. 2012. Phage-driven loss of virulence in a fish pathogenic bacterium. PLoS One 7:e53157. doi: 10.1371/journal.pone.0053157 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Ji Q, Wang L, Liu J, Wu Y, Lv H, Wen Y, Shi L, Qu B, Szentmáry N. 2021. Correction To: Aspergillus fumigatus-stimulated human corneal epithelial cells induce pyroptosis of THP-1 macrophages by secreting TSLP. Inflammation 44:682–692. doi: 10.1007/s10753-021-01502-2 [DOI] [PubMed] [Google Scholar]

[B35] 35. Zhang C, Chen F, Liu X, Han X, Hu Y, Su X, Chen Y, Sun Y, Han L. 2019. Gliotoxin induces cofilin phosphorylation to promote actin cytoskeleton dynamics and internalization of Aspergillus fumigatus into type II human pneumocyte cells. Front Microbiol 10:1345. doi: 10.3389/fmicb.2019.01345 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36. Zhang X, He D, Gao S, Wei Y, Wang L. 2020. iTRAQ-based Proteomic analysis of the interaction of A549 human lung epithelial cells with Aspergillus fumigatus conidia. Mol Med Rep 22:4601–4610. doi: 10.3892/mmr.2020.11582 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Gravelat FN, Ejzykowicz DE, Chiang LY, Chabot JC, Urb M, Macdonald KD, al-Bader N, Filler SG, Sheppard DC. 2010. Aspergillus fumigatus meda governs adherence, host cell interactions and virulence. Cell Microbiol 12:473–488. doi: 10.1111/j.1462-5822.2009.01408.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Jiang J, Tang S, Xia J, Wen J, Chen S, Shu X, Huen MSY, Deng Y. 2018. C9orf140, a novel Axin1-interacting protein, mediates the negative feedback loop of WNT/β-catenin signaling. Oncogene 37:2992–3005. doi: 10.1038/s41388-018-0166-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Carter SP, Moran AL, Matallanas D, McManus GJ, Blacque OE, Kennedy BN. 2020. Genetic deletion of Zebrafish Rab28 causes defective outer segment shedding, but not retinal degeneration. Front Cell Dev Biol 8:136. doi: 10.3389/fcell.2020.00136 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

TRAF3 gene regulates macrophage migration and activation by lung epithelial cells infected with Aspergillus fumigatus

Shumi Shang

Dan He

Cong Liu

Xinyuan Bao

Shuaishuai Han

Li Wang

Roles

ABSTRACT

IMPORTANCE

INTRODUCTION

RESULTS

Expression of TRAF3 in lung epithelial cells

Fig 1.

Effect of TRAF3 on adhesion and internalization of A. fumigatus spores in lung epithelial cells

Fig 2.

Effect of TRAF3 on the inflammatory response induced by A. fumigatus infection of lung epithelial cells

Fig 3.

Role of TRAF3 in the interaction between lung epithelial cells and macrophages in A. fumigatus infection

Fig 4.

Effect of TRAF3 on NF-κB and MAPK signaling pathways in A. fumigatus-induced lung epithelial cells

Fig 5.

Role of TRAF3 in zebrafish resistance to A. fumigatus infection

Fig 6.

DISCUSSION

Fig 7.

MATERIALS AND METHODS

A. fumigatus culture

Cell cultures

Cell transfection

Internalization

Adherence

ELISA

Western blotting

Polymerase chain reaction

TABLE 1.

Macrophage migration and co-culture in Transwell

Immunofluorescence

Transgenic zebrafish construction

Static immersion infection model

Fungal burden determination

Statistical analysis

Supplementary Material

ACKNOWLEDGMENTS

Contributor Information

SUPPLEMENTAL MATERIAL

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases