Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Oophaga sylvatica) | OsABG | This paper | GenBank: OQ032869 | Consensus sequence from three individuals |
| Gene (Dendrobates tinctorius) | DtABG | This paper | GenBank: OQ032870 | Consensus sequence from three individuals |
| Gene (Epipedobates tricolor) | EtABG | This paper | GenBank: OQ032871 | Consensus sequence from three individuals |
| Strain, strain background (Escherichia coli) | TOP10 | Invitrogen | Cat# C404010 | Chemically competent cells |
| Genetic reagent (Oophaga sylvatica) |
O. sylvatica genome | This paper | GenBank: JARQOD000000000 | Annotation available with associated datadryad files |
| Genetic reagent (Allobates femoralis) |
A. femoralis genome | This paper | GenBank: JARQOC000000000 | Annotation available with associated datadryad files |
| Genetic reagent (Epipdobates tricolor) |
E. tricolor transcriptome | This paper | Available with datadryad files | |
| Genetic reagent (Dendrobates tinctorius) | D. tinctorius transcriptome | Alvarez-Buylla et al., 2022 | PMID: 35275922 | |
| Genetic reagent (Mantella aurantiaca) |
M. aurantiaca transcriptome | This paper | Available with datadryad files | |
| Cell line (Spodoptera frugiperda) | Sf9 insect cell culture | Kemp Proteins | Proprietary insect cell expression technology |
|
| Biological sample (Oophaga sylvatica) |
Captive-bred little devil poison frogs | Understory Enterprises | ||
| Biological sample (Dendrobates tinctorius) | Captive-bred dyeing poison frogs | Josh’s Frogs | ||
| Biological sample (Epipedobates tricolor) | Captive-bred phantasmal poison frogs | Josh’s Frogs | ||
| Biological sample (Allobates femoralis) |
Captive-bred brilliant-thighed poison frogs | Understory Enterprises | ||
| Biological sample (Mantella aurantiaca) |
Captive-bred golden mantella |
Josh’s Frogs | ||
| Biological sample (Homo sapiens) |
Human plasma | Innovative Research | Cat# IPLANAH | |
| Biological sample (Oophaga sylvatica) |
Field-collected little devil poison frogs |
Moskowitz et al., 2022 | doi:10.1101/2022.06.14.495949 | Tissue from 30 individuals |
| Antibody | Anti-OsABG rabbit polyclonal antibody | This paper | Generated by Pocono rabbit farm, WB dilution 1:1000, IHC dilution 1:800 |
|
| Antibody | Anti-actin mouse monoclonal antibody | Abcam | Cat# ab11003 | IHC dilution 1:800 |
| Antibody | Goat monoclonal anti-rabbit Alexa Fluor 568 |
Invitrogen | Cat# A-11011 | IHC dilution 1:400 |
| Antibody | Goat monoclonal anti-mouse Alexa Fluor 488 | Invitrogen | Cat# A-11001 | IHC dilution 1:400 |
| Recombinant DNA reagent |
pENTR plasmid | Invitrogen | Cat# K240020 | D-TOPO cloning |
| Sequence-based reagent |
OsABG_fwd | This paper | PCR primer | CACCATGAAACTTTTCGTCTACCTGTGTTTCAGC |
| Sequence-based reagent |
OsABG_rev | This paper | PCR primer | CTATTTTGTTGGGTCTACTATTCTTCCGCTG |
| Sequence-based reagent |
DtABG_fwd | This paper | PCR primer | CACCATGAAGCTTTTCGTCTTCCTATGTTTCAGCC |
| Sequence-based reagent |
DtABG_rev | This paper | PCR primer | CTATTTTGTTGGGTTTATTATTTTTCCATTCAAAATATCG |
| Sequence-based reagent |
EtABG_fwd | This paper | PCR primer | CACCATGAAGCTTTTCATCTTCCTGTGTTTGAGCC |
| Sequence-based reagent |
EtABG_rev | This paper | PCR primer | CTATTTTGTTGGGTCTATTATTCTTCCGGAGAAAAC |
| Peptide, recombinant protein |
OsABG | This paper | GenBank: OQ032869 | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
OsABG mutant 1 | This paper | Y36A + W276A + S374A + D383A | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
OsABG mutant 2 | This paper | Y36A + S268A + D273A + D383A | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
OsABG mutant 3 | This paper | D383A | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
OsABG mutant 4 | This paper | Y36F | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
OsABG mutant 5 | This paper | S374A | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
DtABG | This paper | GenBank: OQ032870 | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
EtABG | This paper | GenBank: OQ032871 | Custom expression and purification by Kemp Proteins in sf9 cell culture |
| Peptide, recombinant protein |
Bovine serum albumin (BSA) | Sigma-Aldrich | Cat# A2153-50G | |
| Commercial assay or kit | Monarch total RNA Miniprep Kit | NEB | Cat# T2010S | |
| Commercial assay or kit | Superstrand III First-Strand Synthesis kit | Invitrogen | Cat# 18080-400 | ligo(dT)20 primer used |
| Commercial assay or kit | Phusion High Fidelity DNA polymerase | Thermo Scientific | Cat# F-530 | |
| Commercial assay or kit | NucleoSpin Gel and PCR cleanup | Takara Bio | Cat# 740609.50 | |
| Commercial assay or kit | pENTR/D-TOPO kit | Invitrogen | Cat# 45-0218 | |
| Commercial assay or kit | Miniprep Kit | QIAGEN | Cat# 27106X4 | |
| Commercial assay or kit | Sanger Sequencing | Azenta Life Sciences | M13F and M13R primers used | |
| Commercial assay or kit | Red-NHS 2nd Generation Labeling Kit | Nanotemper | Cat# MO-L011 | |
| Commercial assay or kit | Tapestation RNA screentape analysis | Agilent | Cat# 5067–5576; Cat# 5067–5578; Cat# 5067–5577 |
|
| Commercial assay or kit | Qubit Broad Range RNA kit | Invitrogen | Cat# Q10210 | |
| Commercial assay or kit | NEB Directional RNA sequencing Kit |
NEB | Cat# E7765L | |
| Commercial assay or kit | Zymo RiboFree TotalRNA Library Prep Kit |
Zymo Research | Cat# R3003-B | |
| Commercial assay or kit | Tapestation D1000 screentape analysis | Agilent | Cat# 5582; Cat# 5583 | |
| Commercial assay or kit | Qubit dsDNA high sensitivity kit | Invitrogen | Cat# Q33231 | |
| Commercial assay or kit | Horse-Radish Peroxidase (HRP) substrate kit | Bio-Rad | Cat# 1721064 | |
| Chemical compound, drug | ‘PTX 251D; pumiliotoxin 251D; PTX’ | Other | Pubchem_CID:6440480 | Custom-synthesized molecule produced by PepTech (Burlington, MA, USA) |
| Chemical compound, drug | ‘decahydroquinoline; DHQ’ | Sigma-Aldrich | Cat# 125741 | |
| Chemical compound, drug | ‘epibatidine; epi’ | Sigma-Aldrich | Cat# E1145 | |
| Chemical compound, drug | ‘histrionicotoxin-like compound; HTX’ | Sigma-Aldrich | Cat# ENAH2C55884A-50MG | |
| Chemical compound, drug | ‘indolizidine; indol’ | Sigma-Aldrich | Cat# ATE24584802-100MG | |
| Chemical compound, drug | ‘nicotine; nic’ | Sigma-Aldrich | Cat# N3876-100ML | |
| Chemical compound, drug | ‘cortisol; cort’ | Sigma-Aldrich | Cat# H0888-1G | |
| Chemical compound, drug | ‘photoprobe, PB’ | Enamine | Cat# Z2866906198 | |
| Chemical compound, drug | TBTA | Fisher | Cat# H66485-03 | |
| Chemical compound, drug | Copper (II) sulfate | Fisher | Cat# BP346-500 | |
| Chemical compound, drug | Tris (2-carboxyethyl) phosphine hydrochloride | Fisher | Cat# J60316-06 | |
| Chemical compound, drug | TAMRA-N3 | Fisher | Cat# T10182 | |
| Chemical compound, drug | InstantBlue | Abcam | Cat# ISB1L | |
| Chemical compound, drug | Biotin-N3 | Click Chemistry Tools | Cat# 1265 | |
| Chemical compound, drug | Trizol | Thermo Fisher | Cat# 15596018 | |
| Chemical compound, drug | Tissue-Tek OCT | Sakura Finetek | Cat# 4583 | |
| Chemical compound, drug | FluoShield aqueous mounting media containing DAPI | Abcam | Cat# ab104139 | |
| Software, algorithm | Byronic | Protein Metrics | v4.1.5 | |
| Software, algorithm | MAFFT nucleotide sequence alignment | Benchling | ||
| Software, algorithm | Clustal Omega AA sequence alignment | Benchling | ||
| Software, algorithm | AlphaFold | Jumper et al., 2021b | PMID: 34265844 | Through google collab notebook: https://colab.research.google.com/github/deepmind/alphafold/blob/main/notebooks/AlphaFold.ipynb |
| Software, algorithm | UCSF Chimera | Pettersen et al., 2004 | PMID: 15264254 | |
| Software, algorithm | Autodock Vina | Eberhardt et al., 2021 | PMID: 34278794 | v1.2.0 |
| Software, algorithm | GraphPad Prism | GraphPad Software | ||
| Software, algorithm | GNPS mass spec deconvolution + identification |
Wang et al., 2016 | PMID: 27504778 | |
| Software, algorithm | R | CRAN | v4.0.4 | |
| Software, algorithm | Trim-galore! | Martin, 2011 | doi:https://doi.org/10.14806/ej.17.1.200 | trim_galore --paired
--phred33
--length 36 -q 30 --stringency 1 -e 0.001 |
| Software, algorithm | Kallisto | Bray et al., 2016 | PMID: 27043002 | |
| Software, algorithm | ClustalW | Thompson et al., 1994 | PMID: 7984417 | |
| Other | Nupage 4–12% Bis-Tris protein gel | Invitrogen | Cat# NP0323BOX | Pre-cast protein gels |
| Other | 3 kDa Amicon MWCO centrifuge filter | Millipore-Sigma | Cat# UFC800324 | Centrifugal molecular weight cutoff filters |
| Other | Monolith Premium Capillaries | Nanotemper | Cat# MO-K025 | Glass capillaries for microscale thermophoresis measurements |
| Other | Eclipse Plus C18 column | Agilent | Cat# 959961-902 | Chromatographic column for LC–MS/MS |
| Other | PTFE syringe filter | Thermo Scientific | Cat# 44504-NP | Consumable to filter samples prior to GC–MS analysis |
| Other | Glass vials with PTFE-lined caps |
Fisher | Cat# 60940A-2 | Consumable to store samples prior to GC–MS analysis |
| Other | Superfrost Slides | VWR | Cat# 48311-703 | Slides used for IHC staining |
| Other | Hydrophilic PAP Pen | Vector laboratories | Cat# H-4000 | Hydrophilic barrier pen used in IHC staining protocol |