Skip to main content
NCBI home page
Molecular Vision logoLink to Molecular Vision
. 2023 Oct 2;29:160–168.

Downregulation of SIRT6 and NMNAT2 is associated with proliferative diabetic retinopathy

Hui Chen 1, Xiongze Zhang 1, Nanying Liao 1, Yuying Ji 1, Lan Mi 1, Yuhong Gan 1, Yongyue Su 1, Feng Wen 1,✉
PMCID: PMC10784219  PMID: 38222451

Abstract

Purpose

To determine the expression levels of SIRT6 and NMNAT2 in diabetic retinopathy (DR).

Methods

We obtained peripheral blood mononuclear cells (PBMCs) and vitreous samples from 77 patients with type 2 diabetes mellitus: 52 with DR and 25 without DR, and 27 healthy control subjects. Western blot analysis and qRT-PCR were performed to evaluate the expression of SIRT6 and NMNAT2 in their PBMCs. The levels of IL-1β, IL-6, and TNF-α in the vitreous fluid were determined by ELISA. Immunohistochemistry was performed to detect the expression of SIRT6 and NMNAT2 in proliferative DR (PDR) and the control subjects.

Results

The expression of SIRT6 and NMNAT2 was markedly downregulated in DR patients, which was negatively correlated with the increased expression of IL-1β, IL-6 and TNF-α. Additionally, we observed decreased expression of SIRT6 and NMNAT2 in the fibrovascular membranes of PDR patients.

Conclusions

The downregulated expression of SIRT6 and NMNAT2 in PDR patients reveals a potential pathogenic association; more extended studies could verify them as potential therapeutic targets.

Introduction

Diabetic retinopathy (DR) is among the common microvascular complications of diabetes mellitus that develop after chronic hyperglycemia. Irreversible vision loss occurs in up to 80% of patients who have been affected with diabetes for 20 years or more [1,2]. While chronic hyperglycemia increases inflammation and causes neuronal and vascular injuries, such as loss of ganglion cells and generation of degenerative capillaries, the mechanism underlying the pathogenesis of DR remains elusive.

Sirtuins (SIRTs) are nicotinamide adenine dinucleotide (NAD)-dependent histone deacetylases that play a role in inflammation, energy metabolism, stress resistance, and cancer [3]. Among them, SIRT6 is localized in the nuclei and regulates a variety of biologic processes, including transcription, inflammation, carcinogenesis, metabolism, and so forth, while affecting numerous pathophysiological conditions such as diabetes mellitus and cardiovascular disorders [4,5]. A recent study demonstrated that SIRT6 was downregulated in human endothelial cells [6]. To date, the precise function of SIRT6 in DR and the mechanism underlying the regulation of type 2 diabetes mellitus (T2DM)-related metabolism by SIRT6 has yet to be determined.

Nicotinamide mononucleotide adenylyltransferase 2 (NMNAT2) catalyzes NAD synthesis [7]. NMNAT2 can serve as a sensor for monitoring intracellular redox equilibrium as well as the energy state in cells with high energy demand, such as retinal ganglion cells [8]. It has been proven that NMNAT2 participates in the regulation of SIRT6 and its downstream signaling pathways related to neuroinflammation [9-12]. Hence, it is hypothesized that NMNAT2/SIRT6 could exert a regulatory effect on inflammatory reactions in DR. Herein, we comprehensively examined the expression of SIRT6, NMNAT2, and inflammatory cytokines in various categories of DR patients and then determined their relationships.

Methods

Patients

In this study, we enrolled consecutive T2DM patients as well as nondiabetic subjects who presented to the outpatient department of the Zhongshan Ophthalmic Centre, China, from January 2021 to July 2022 (Table 1). Diagnosis was confirmed in accordance with American Diabetes Association standards (2002) [13].

Table 1. Clinical and biochemical characteristics of type 2 diabetic patients and healthy control subjects.

Variables      Control
(n=27) NDR
(n=25) NPDR
(n=26) PDR
(n=26) p
Sex (m/f)
 14/13
 13/12
 14/12
 12/14
 0.951
Age (years)
 65.7±7.6
 63.3±7.0
 62.0±6.2
 64.7±6.8
 0.249
BMI (kg/m2)
 22.2±2.5
 22.5±2.2
 23.6±1.9
 25.3±2.6
 <0.001*
Diabetes Duration (years)
 -
 7.8±3.5
 9.7±3.0
 14.3±1.9
 <0.001*
FPG (mmol/l)
 5.3±0.6
 7.8±1.8
 9.9±2.1
 12.8±1.8
 <0.001*
HbAlc (%) 5.1±0.6 7.2±1.6 9.0±1.8 11.6±1.7 <0.001*
Open in a new tab

DR: diabetic retinopathy; NDR: no apparent retinopathy; NPDR: non-proliferative retinopathy; PDR: proliferative diabetic retinopathy;BMI, Body mass index; FPG: fasting plasma glucose; HbA1c, glycated hemoglobin Data are expressed as mean±SD * p≤0.05

The study’s exclusion criteria for participation were: 1) cases complicated by infectious diseases or other disorders such as nephropathy (including stage 3 chronic kidney disease, macroalbuminuria, proteinuria, and hemodialysis patients); 2) patients who had undergone intraocular procedures, intravitreal treatments, or photocoagulation within 3 months before the study; 3) patients with a history of uveitis, trauma, vitreous hemorrhage, or retinal detachment; and 4) patients taking immuno-suppressive drugs. The assessment of DR was performed using fluorescein fundus angiography (FF450 fundus camera, Carl Zeiss Meditec AG, Germany). Body mass index (BMI) was calculated using the standard formula, weight (kg)/height (m2). Diabetics were classified into three categories: no clinically apparent retinopathy (NDR), non-proliferative diabetic retinopathy (NPDR), and proliferative diabetic retinopathy (PDR) [14].

All experiments were approved by our institutional ethical committee and conducted in compliance with the Declaration of Helsinki. Each participant provided a signed informed consent statement.

Demographic data

Age- and sex-matched samples were collected from 77 patients with T2DM (39 males and 38 females) and 27 healthy individuals (14 males and 13 females). The median ages of the patients and control subjects were 63.3 ± 6.7 years and 65.7 ± 7.6 years, respectively (p = 0.135). The diagnoses of the 77 diabetic patients were NDR (n = 25), NPDR (n = 26), and PDR (n = 26). The male to female ratios and mean ages (± SD) of NDR, NPDR, and PDR patients were 13:12 and 63.3 ± 7.0 years, 14:12 and 62.0 ± 6.2 years, and 12:14 and 64.7 ± 6.8 years, respectively.

Specimen collection

Twelve mL of whole blood was collected from each subject in a test tube with lithium heparin (Vacutainer; BD Biosciences, San Jose, CA) for quantification of protein and mRNAs, and venous blood was drawn to measure fasting plasma glucose (FPG) and glycated hemoglobin.

Isolation of PBMCs

Isolation of PBMCs from heparinized venous blood was performed using Ficoll-Hypaque density gradient centrifugation. PBMCs were incubated with lipopolysaccharide (100 ng/ml; Sigma-Aldrich Corp.,St Louis, MO) for 4 h, followed by incubation in RPMI 1640 medium with 1 mM ATP for another 15 min.

Collection of vitreous fluid

Using pars plana vitrectomy, 0.5 ml of undiluted vitreous fluid was obtained from each participant. Samples were stored at −80° C until analysis.

Quantitative real-time PCR

Total RNA was extracted from the PBMCs by the Trizol method and reverse-transcribed using the Qiagen QuantiFast SYBR Green PCR Kit on BioRad LightCycler CFX96 (Hercules, CA). The primers for human genes were designed according to the PrimerBank public database [15,16]. The following primers were used: SIRT6 sense: 5′-GCTGGAGCCCAAGGAGGAATCT- 3′, antisense: 5′-AGCCTCACCTCTGGACAACACA −3′ [15]; NMNAT2 sense: 5′- CCGCAATTGAAGGATGTTG-3′, antisense: 5′- CTCTGGCTCTTGGGATTCTG −3′; and β-actin sense: 5′-GGA CTT CGA GCA AGA GAT GG-3′, antisense: 5′-AGC ACT GTG TTG GCG TAC AG-3′. β-actin was included as a reference gene. Each assay was conducted in triplicate. The amplified products were resolved on agarose gel electrophoresis. Primer specificity was evaluated by melting curve analysis, and the 2-ΔΔCt method was employed to measure relative mRNA expression levels.

Western blot analysis

Total protein was isolated from the PBMCs. Protein extract (60 μg) was resolved on 12% SDS–PAGE and then electroblotted to a PVDF membrane. The blot was detected with anti-SIRT6 or anti-NMNAT2 antibodies (Abcam, Cambridge, UK). The target protein was visualized with the Pierce SuperSignal West Pico Substrate Kit. ImageJ software was employed to determine the protein band intensity relative to β-Actin.

ELISA

The levels of IL-1β, IL-6, and TNF-α in the vitreous fluid samples were determined with an ELISA kit (Sen-Xiong Company). Each sample, along with the standard, was measured three times. Background subtraction was applied to determine OD450, and a standard curve was made.

Immunohistochemistry

Surgical removal of fibrovascular membranes (FVMs) was performed on 26 PDR patients, and epiretinal membranes (ERMs) were resected from 27 control subjects. There were no significant differences in age among the groups (Table 1). At the same time, retinas from mice and cadaver eyes served as positive controls (Appendix 1).

Surgically resected FVMs and idiopathic ERMs (3-μm thickness) were subjected to fixation with 4% paraformaldehyde, followed by paraffin embedding. Thereafter, the samples were deparaffinized and exposed to 3% H2O2 in methanol for 15 min to inhibit endogenous peroxidase activity. After being blocked in blocking solution for 10 min, the sections were incubated with polyclonal antibodies for SIRT6 (1:150; Abcam, Cambridge, USA) or NMNAT2 (1:100; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 30 min, followed by incubation with HRP polymer (Thermo Scientific, Santa Cruz, CA) for 30 min at room temperature. Signal detection was performed using the AEC chromogen system (Thermo Scientific). Reactions were developed with diaminobenzidine (DAB), followed by hematoxylin counterstaining. Negative controls were isotype-matched. Images were captured by an Olympus BX60 microscope and analyzed with the use of Image Pro Plus 4.5 software (Media Cybertics). The H-score was used to evaluate the intensity of each signal.

Statistics

Statistical analyses were performed using SPSS version 19.0. Differences between the patients and control subjects were examined using multivariate ANCOVA (MANCOVA) or the nonparametric Kruskal–Wallis test based on assumptions of normality and homogeneity of variance. Mann–Whitney U tests or Student’s t tests were performed to determine variations among all groups. The study parameters were compared using Spearman’s correlation analysis. GraphPad Prism version 5 was used to draw graphs. A p value of less than 0.05 indicated significant difference.

Results

Clinical characteristics

The clinical and laboratory parameters of the patients are summarized in Table 1. No significant differences in age and gender (p = 0.249 and p = 0.951, respectively) were observed among the different groups. T2DM patients had a significantly higher body mass index than the control subjects (p < 0.001). Compared with the NPDR and NDR groups, the mean extent of diabetes was markedly increased in the PDR group (p < 0.001). Normal HbA1c values ranged between 4.27% and 6.07%. Notably, the PDR group displayed a significantly higher level of HbA1c and fasting glucose than the NPDR and NDR groups (p < 0.001 for both).

Expression of SIRT6 and NMNAT2 in DR patients

We performed qRT-PCR assays to examine the expression levels of SIRT6 and NMNAT2 in both the patients and the control subjects. As depicted in Figure 1, the mRNA expression of NMNAT2 and SIRT6 was markedly decreased in PBMCs of NPDR and PDR cases as compared to those of NDR patients and control subjects (p < 0.001 for all comparisons).

Figure 1.

Figure 1

Open in a new tab

The mRNA levels of SIRT6 and NMNAT2 were downregulated in DR patients. The mRNA expression of SIRT6 and NMNAT2 in the PBMCs was quantified by real-time PCR and normalized to the level of β-actin. (PDR, n = 26; NPDR, n = 26; NDR, n = 25; controls, n = 27). Values are presented as fold-changes when compared with the controls. *p < 0.05, **p < 0.01, and ***p < 0.001.

We next investigated whether SIRT6 and NMNAT2 were downregulated at the protein level in DR patients. Western blot analysis revealed that the protein levels of SIRT6 and NMNAT2 in NPDR and PDR patients were significantly lower than those in NDR cases and control subjects (p < 0.001 for all comparisons; Figure 2). Collectively, these data indicate that the mRNA and protein expression of SIRT6 and NMNAT2 were significantly decreased in the PBMCs of patients with DR.

Figure 2.

Figure 2

Open in a new tab

The protein expression of SIRT6 and NMNAT2 was decreased in DR patients (PDR, n = 26; NPDR, n = 26; NDR, n = 25; controls, n = 27). Western blot analysis (lane 1, the control; lane 2, NDR; lane 3, NPDR; lane 4, PDR) and quantification of SIRT6 and NMNAT2 expression in PBMCs. β-actin was included as a reference. *p < 0.05, **p < 0.01, and ***p < 0.001.

Concentrations of inflammatory cytokines in vitreous fluid

We further analyzed the level of IL-1β, IL-6 and TNF-α to determine the inflammatory activity in T2DM patients. As shown in Figure 3, elevated production of cytokines was evident in PDR and NPDR cases as compared to NDR patients and control subjects.

Figure 3.

Figure 3

Open in a new tab

Concentrations of IL-1β, IL-6, and TNF-α in the vitreous fluid of T2DM patients and non-diabetic controls (PDR, n = 26; NPDR, n = 26; NDR, n = 25; controls, n = 27). The comparison was made by the Kruskal–Wallis test with Dunn’s multiple comparison test. *p < 0.001.

Correlation analysis

Correlation analysis showed a positive correlation between protein and mRNA expressions of SIRT6 and NMNAT2 in DR patients (r = -0.246, p < 0.01).

As shown in Table 2, there was a linear regression between the expressions of SIRT6 and NMNAT2 and different variables. Moreover, we found that while the expression level of SIRT in PBMCs was significantly inversely correlated with vitreous concentrations of IL-1β and TNF-α, the expression levels of SIRT6 and NMNAT2 were all negatively correlated with FPG and HbA1c levels.

Table 2. Spearman’s correlation between the expression levels of the studied genes in the PBMCs and clinical characteristics of the studied groups.

Studied gene mRNA/protein level SIRT6
mRNA SIRT6
protein NMNAT2
mRNA NMNAT2
protein IL-1β
Vitreous IL-6
Vitreous TNF-α
Vitreous FBG HbA1c
SIRT6
mRNA
 -
 0.732***
 0.377***
 -
 −0.742***
 −0.666***
 −0.749***
 −0.801***
 −0.792***
 
 protein
 0.732***
 -
 -
 0.593***
 −0.694***
 −0.736***
 −0.829***
 −0.767***
 −0.770***
NMNAT2
mRNA
 0.377***
 -
 -
 0.334***
 −0.511***
 −0.507***
 −0.512***
 −0.487***
 −0.523***
  protein - 0.593*** 0.334*** - −0.607*** −0.567*** −0.649*** −0.645*** −0.632***
Open in a new tab

***p<0.001

Expression of SIRT6 and NMNAT2 in patients with DR

We performed immunohistochemical staining to detect the expression of SIRT6 and NMNAT2 in the FVMs of PDR patients. The stained area for SIRT6 or NMNAT2 was significantly reduced in PDR patients compared with the controls (p < 0.001 for both), as indicated by computer-assisted image analysis (Figure 4).

Figure 4.

Figure 4

Open in a new tab

Immunohistochemistry staining reveals a significantly reduced expression of SIRT6 and NMNAT2 in FVMs of PDR patients (×200) compared with the epiretinal membrane subjects (control group). *p < 0.001.

Discussion

As a progressive, chronic microvascular complication of T2DM, DR can cause visual impairment and legal blindness [17]. Although inflammatory cytokines and nitric oxide have been found to be involved in DR pathogenesis, the exact mechanism remains to be addressed [18,19]. Herein, we comparatively examined the expression of SIRT6 and NMNAT2 at both protein and mRNA levels in DR patients and healthy controls. We found that the expression of the two factors was markedly downregulated in the patients (p < 0.01). Moreover, immunofluorescent staining revealed a decreased expression of the two factors in PDR. Notably, we identified an association between the decreased expression of the two factors and the elevated level of inflammatory cytokines in DR (p < 0.05).

The SIRT family of histone deacetylases plays a role in controlling numerous cellular functions, including proliferation, differentiation, programmed cell death, metabolism, and aging [20,21]. SIRT6, a NAD+-dependent deacylase capable of regulating glucose metabolism, has recently been demonstrated to be critically involved in the physiopathological processes of T2DM [4,22]. High expression of SIRT6 has also been found in the retina, while SIRT6 retinal levels were significantly decreased in non-obese diabetic (NOD) mice compared to NOD normoglycemic littermates [23]. In line with this finding, decreased SIRT6 levels in pancreatic islets from diabetic mice [24] and in the carotid plaques of asymptomatic diabetic patients [25] have also been observed. Moreover, SIRT6-overexpressing mice were found to be protected from developing high caloric diet-induced hyperglycemia and glucose intolerance [26], and SIRT6 deficiency results in major defects in retinal transmission, while altering the expression of glucose homeostasis-related genes and glutamate receptors [23,27]. All these observations led us to propose that hyperglycemia may elicit downregulation of SIRT6 and upregulation of inflammatory cytokines [23].

SIRT6 protein and mRNA expression levels have been found to be significantly reduced in colorectal cancer tissues; it was previously demonstrated that deletion of SIRT6 may activate an energy metabolism program that promotes tumorigenesis [28]. However, SIRT6’s roles as a metabolic enzyme and a potential regulator of cancer cell metabolism remain to be investigated. It has been established that maintaining intracellular NAD levels is crucial for several biologic processes, such as energy metabolism and the activity of SIRTs [29-31]. It was also reported that NMNAT2 mRNA was mainly expressed in high energy consumption organs, including the brain, heart, and skeletal muscle, while there was nearly no NMNAT2 detected in kidney, lung, spleen, and testis [32]. Emerging evidence suggests that a decline in redox factor NAD+ is a hallmark of aging and neurodegenerative diseases [12,33]. NMNAT2 is significantly decreased in glaucomatous retinal ganglion cells [28,34]. A decrease in the expression of NMNAT2 and SIRT6 was also observed in the spinal cord of amyotrophic lateral sclerosis patients [33]. Given the critical role of NMNAT2 in cellular metabolism, its expression may be downregulated in endothelial cells in DR [32,35]. In this study, we found that NMNAT2 expression was significantly reduced in DR patients. Other studies have revealed that decreased NMNAT2 expression was markedly correlated with downregulation of SIRT6 expression in DR. It has been reported that high glucose-induced endothelial damage is related to NAD depletion in cells [36]. A study on cardiac hypertrophy showed that SIRT6 participated in the anti-hypertrophic signals of NMNAT2 overexpression, which suggested that upon activation of SIRT6 via intracellular NAD, the protein level and enzymatic activity of NMNAT2 were dramatically reduced [9]. Low SIRT/NMNAT2 pathway expression in adipose tissue of BMI-discordant monozygotic twins was reported [12], which highlights a strong relationship of reduced SIRT/NMNAT2 pathway expression with insulin resistance and inflammation. Immunohistochemical studies have provided data suggesting an association between decreased NMNAT2 expression and SIRT6 downregulation in PDR. Validation of the association of SIRT6 with NMNAT2 in DR may help to determine how DR’s progression is inhibited by modulating the metabolism of retinal cells.

Elevated production of IL-1β, IL-6 and TNF-α has been found to be correlated with decreased expression of SIRT6 and NMNAT2 in PDR and NPDR patients. In rat models, SIRT6 functions as an immune regulatory factor responding to renal injury in diabetic nephropathy [37]. It has also been shown that low expression of SIRT6 and high expression of NF-κB are linked to the inflammatory pathway in the abdominal subcutaneous fat of obese and pre-DM patients [38]. In central nervous system conditionally deleted SIRT6 knockout mice, increased vascular endothelial growth factor levels, decreased brain-derived neurotrophic factor levels in retinas, and a significant reduction in the whole retinal thickness were observed [23]. Taken together, the findings in the present study demonstrate that decreased expression of SIRT6 may aggravate the proinflammatory response in the progression of PDR [39].

The present study suggests that HbA1c levels are negatively correlated with the levels of SIRT6 and NMNAT2 in cases of DR. Given that the above correlation has also been observed in previous studies on animal models, we conclude that glycemic control is vital for the immune response of diabetic patients.

There are certain limitations in the current study. First, this study was a preliminary attempt that needs to be verified. Second, potential confoundment of the reported splice variant of SIRT6 should be considered for future study, although whether this variant can be translated to protein and function needs to be identified experimentally [40]. Last, further studies with a larger sample of DR patients from more diverse populations are required.

In conclusion, we found downregulation of SIRT6 and NMNAT2 in patients with PDR. These findings indicate the role of SIRT6 and NMNAT2 in the pathogenesis of PDR. Moreover, downregulation of SIRT6 and NMNAT2 may lead to an increase in the expression of inflammatory cytokines. Future studies will be directed at investigating the potential of NMNAT2 and SIRT6 as diagnostic and prognostic indicators, as well as therapeutic targets for PDR.

Acknowledgments

This work was granted by National Natural Science Foundation of China (No. 81970813), Natural Science Foundation of Guangdong Province (No. 2023A1515011198) and Guangzhou Municipal Science and Technology Program (No. SL2022A03J00553).

Appendix 1. The positive control for the immunohistochemistry staining of SIRT6 and NMNAT2 in retinas from mouse and cadaver eyes (×400).

To access the data, click or select the words “Appendix 1.” (Top) Positive SIRT6 and NMNAT2 expression in cadaver retina with negative control; (Bottom) Positive SIRT6 and NMNAT2 expression in retina from mouse along with negative control.

References

  • 1.Ogurtsova K, da Rocha Fernandes JD, Huang Y, Linnenkamp U, Guariguata L, Cho NH, Cavan D, Shaw JE, Makaroff LE. IDF Diabetes Atlas: Global estimates for the prevalence of diabetes for 2015 and 2040. Diabetes Res Clin Pract. 2017;128:40–50. doi: 10.1016/j.diabres.2017.03.024. [DOI] [PubMed] [Google Scholar]
  • 2.Flaxman SR, Bourne RRA, Resnikoff S, Ackland P, Braithwaite T, Cicinelli MV, Das A, Jonas JB, Keeffe J, Kempen JH, Leasher J, Limburg H, Naidoo K, Pesudovs K, Silvester A, Stevens GA, Tahhan N, Wong TY, Taylor HR. Vision Loss Expert Group of the Global Burden of Disease S. Global causes of blindness and distance vision impairment 1990-2020: a systematic review and meta-analysis. Lancet Glob Health. 2017;5:e1221–34. doi: 10.1016/S2214-109X(17)30393-5. [DOI] [PubMed] [Google Scholar]
  • 3.Ng F, Tang BL. Sirtuins’ modulation of autophagy. J Cell Physiol. 2013;228:2262–70. doi: 10.1002/jcp.24399. [DOI] [PubMed] [Google Scholar]
  • 4.Bae EJ. Sirtuin 6, a possible therapeutic target for type 2 diabetes. Arch Pharm Res. 2017;40:1380–9. doi: 10.1007/s12272-017-0989-8. [DOI] [PubMed] [Google Scholar]
  • 5.Sebastián C, Satterstrom FK, Haigis MC, Mostoslavsky R. From sirtuin biology to human diseases: an update. J Biol Chem. 2012;287:42444–52. doi: 10.1074/jbc.R112.402768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liu R, Liu H, Ha Y, Tilton RG, Zhang W. Oxidative stress induces endothelial cell senescence via downregulation of Sirt6. BioMed Res Int. 2014;2014:902842. doi: 10.1155/2014/902842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ryu KW, Nandu T, Kim J, Challa S, DeBerardinis RJ, Kraus WL. Metabolic regulation of transcription through compartmentalized NAD(+) biosynthesis. Science. 2018;360:603–4. doi: 10.1126/science.aan5780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Niu J, Sanders SS, Jeong HK, Holland SM, Sun Y, Collura KM, Hernandez LM, Huang H, Hayden MR, Smith GM, Hu Y, Jin Y, Thomas GM. Coupled Control of Distal Axon Integrity and Somal Responses to Axonal Damage by the Palmitoyl Acyltransferase ZDHHC17. Cell Reports. 2020;33:108365. doi: 10.1016/j.celrep.2020.108365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cai Y, Yu SS, Chen SR, Pi RB, Gao S, Li H, Ye JT, Liu PQ. Nmnat2 protects cardiomyocytes from hypertrophy via activation of SIRT6. FEBS Lett. 2012;586:866–74. doi: 10.1016/j.febslet.2012.02.014. [DOI] [PubMed] [Google Scholar]
  • 10.Cai Y, Yu SS, He Y, Bi XY, Gao S, Yan TD, Zheng GD, Chen TT, Ye JT, Liu PQ. EGCG inhibits pressure overload-induced cardiac hypertrophy via the PSMB5/Nmnat2/SIRT6-dependent signalling pathways. Acta Physiol (Oxf) 2021;231:e13602. doi: 10.1111/apha.13602. [DOI] [PubMed] [Google Scholar]
  • 11.Ko KW, Milbrandt J, DiAntonio A. SARM1 acts downstream of neuroinflammatory and necroptotic signaling to induce axon degeneration. J Cell Biol. 2020;219:e201912047. doi: 10.1083/jcb.201912047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jukarainen S, Heinonen S, Ramo JT, Rinnankoski-Tuikka R, Rappou E, Tummers M, Muniandy M, Hakkarainen A, Lundbom J, Lundbom N, Kaprio J, Rissanen A, Pirinen E, Pietilainen KH. Obesity Is Associated With Low NAD(+)/SIRT Pathway Expression in Adipose Tissue of BMI-Discordant Monozygotic Twins. J Clin Endocrinol Metab. 2016;101:275–83. doi: 10.1210/jc.2015-3095. [DOI] [PubMed] [Google Scholar]
  • 13.Expert Committee on the D Clasification of Diabetes M. American Diabetes Association: clinical practice recommendations 2002. Diabetes Care. 2002;25(Suppl 1):S1–147. doi: 10.2337/diacare.25.2007.s1. [DOI] [PubMed] [Google Scholar]
  • 14.Wilkinson CP, Ferris FL, 3rd, Klein RE, Lee PP, Agardh CD, Davis M, Dills D, Kampik A, Pararajasegaram R, Verdaguer JT. Global Diabetic Retinopathy Project G. Proposed international clinical diabetic retinopathy and diabetic macular edema disease severity scales. Ophthalmology. 2003;110:1677–82. doi: 10.1016/S0161-6420(03)00475-5. [DOI] [PubMed] [Google Scholar]
  • 15.Wu T, Liu YH, Fu YC, Liu XM, Zhou XH. Direct evidence of sirtuin downregulation in the liver of non-alcoholic fatty liver disease patients. Ann Clin Lab Sci. 2014;44:410–8. [PubMed] [Google Scholar]
  • 16.Wang X, Spandidos A, Wang H, Seed B. PrimerBank: a PCR primer database for quantitative gene expression analysis, 2012 update. Nucleic Acids Res. 2012;40:D1144–9. doi: 10.1093/nar/gkr1013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cheung N, Mitchell P, Wong TY. Diabetic retinopathy. Lancet. 2010;376:124–36. doi: 10.1016/S0140-6736(09)62124-3. [DOI] [PubMed] [Google Scholar]
  • 18.Fukai T, Ushio-Fukai M. Cross-Talk between NADPH Oxidase and Mitochondria: Role in ROS Signaling and Angiogenesis. Cells. 2020;9:1849. doi: 10.3390/cells9081849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sahajpal NS, Goel RK, Chaubey A, Aurora R, Jain SK. Pathological Perturbations in Diabetic Retinopathy: Hyperglycemia, AGEs, Oxidative Stress and Inflammatory Pathways. Curr Protein Pept Sci. 2019;20:92–110. doi: 10.2174/1389203719666180928123449. [DOI] [PubMed] [Google Scholar]
  • 20.Michan S, Sinclair D. Sirtuins in mammals: insights into their biological function. Biochem J. 2007;404:1–13. doi: 10.1042/BJ20070140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sauve AA, Wolberger C, Schramm VL, Boeke JD. The biochemistry of sirtuins. Annu Rev Biochem. 2006;75:435–65. doi: 10.1146/annurev.biochem.74.082803.133500. [DOI] [PubMed] [Google Scholar]
  • 22.Kuang J, Chen L, Tang Q, Zhang J, Li Y, He J. The Role of Sirt6 in Obesity and Diabetes. Front Physiol. 2018;9:135. doi: 10.3389/fphys.2018.00135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zorrilla-Zubilete MA, Yeste A, Quintana FJ, Toiber D, Mostoslavsky R, Silberman DM. Epigenetic control of early neurodegenerative events in diabetic retinopathy by the histone deacetylase SIRT6. J Neurochem. 2018;144:128–38. doi: 10.1111/jnc.14243. [DOI] [PubMed] [Google Scholar]
  • 24.Xiong X, Sun X, Wang Q, Qian X, Zhang Y, Pan X, Dong XC. SIRT6 protects against palmitate-induced pancreatic beta-cell dysfunction and apoptosis. J Endocrinol. 2016;231:159–65. doi: 10.1530/JOE-16-0317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Balestrieri ML, Rizzo MR, Barbieri M, Paolisso P, D’Onofrio N, Giovane A, Siniscalchi M, Minicucci F, Sardu C, D’Andrea D, Mauro C, Ferraraccio F, Servillo L, Chirico F, Caiazzo P, Paolisso G, Marfella R. Sirtuin 6 expression and inflammatory activity in diabetic atherosclerotic plaques: effects of incretin treatment. Diabetes. 2015;64:1395–406. doi: 10.2337/db14-1149. [DOI] [PubMed] [Google Scholar]
  • 26.Anderson JG, Ramadori G, Ioris RM, Galie M, Berglund ED, Coate KC, Fujikawa T, Pucciarelli S, Moreschini B, Amici A, Andreani C, Coppari R. Enhanced insulin sensitivity in skeletal muscle and liver by physiological overexpression of SIRT6. Mol Metab. 2015;4:846–56. doi: 10.1016/j.molmet.2015.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Silberman DM, Ross K, Sande PH, Kubota S, Ramaswamy S, Apte RS, Mostoslavsky R. SIRT6 is required for normal retinal function. PLoS One. 2014;9:e98831. doi: 10.1371/journal.pone.0098831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Qi J, Cui C, Deng Q, Wang L, Chen R, Zhai D, Xie L, Yu J. Downregulated SIRT6 and upregulated NMNAT2 are associated with the presence, depth and stage of colorectal cancer. Oncol Lett. 2018;16:5829–37. doi: 10.3892/ol.2018.9400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pillai JB, Isbatan A, Imai S, Gupta MP. Poly(ADP-ribose) polymerase-1-dependent cardiac myocyte cell death during heart failure is mediated by NAD+ depletion and reduced Sir2alpha deacetylase activity. J Biol Chem. 2005;280:43121–30. doi: 10.1074/jbc.M506162200. [DOI] [PubMed] [Google Scholar]
  • 30.Cantó C, Gerhart-Hines Z, Feige JN, Lagouge M, Noriega L, Milne JC, Elliott PJ, Puigserver P, Auwerx J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature. 2009;458:1056–60. doi: 10.1038/nature07813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zima AV, Copello JA, Blatter LA. Effects of cytosolic NADH/NAD(+) levels on sarcoplasmic reticulum Ca(2+) release in permeabilized rat ventricular myocytes. J Physiol. 2004;555:727–41. doi: 10.1113/jphysiol.2003.055848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mouchiroud L, Houtkooper RH, Auwerx J. NAD(+) metabolism: a therapeutic target for age-related metabolic disease. Crit Rev Biochem Mol Biol. 2013;48:397–408. doi: 10.3109/10409238.2013.789479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Harlan BA, Killoy KM, Pehar M, Liu L, Auwerx J, Vargas MR. Evaluation of the NAD(+) biosynthetic pathway in ALS patients and effect of modulating NAD(+) levels in hSOD1-linked ALS mouse models. Exp Neurol. 2020;327:113219. doi: 10.1016/j.expneurol.2020.113219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Fang F, Zhuang P, Feng X, Liu P, Liu D, Huang H, Li L, Chen W, Liu L, Sun Y, Jiang H, Ye J, Hu Y. NMNAT2 is downregulated in glaucomatous RGCs, and RGC-specific gene therapy rescues neurodegeneration and visual function. Mol Ther. 2022;30:1421–31. doi: 10.1016/j.ymthe.2022.01.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. Nat Rev Cancer. 2011;11:85–95. doi: 10.1038/nrc2981. [DOI] [PubMed] [Google Scholar]
  • 36.Fan C, Ma Q, Xu M, Qiao Y, Zhang Y, Li P, Bi Y, Tang M. Ginsenoside Rb1 Attenuates High Glucose-Induced Oxidative Injury via the NAD-PARP-SIRT Axis in Rat Retinal Capillary Endothelial Cells. Int J Mol Sci. 2019;20:4936. doi: 10.3390/ijms20194936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ji L, Chen Y, Wang H, Zhang W, He L, Wu J, Liu Y. Overexpression of Sirt6 promotes M2 macrophage transformation, alleviating renal injury in diabetic nephropathy. Int J Oncol. 2019;55:103–15. doi: 10.3892/ijo.2019.4800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.D’Onofrio N, Pieretti G, Ciccarelli F, Gambardella A, Passariello N, Rizzo MR, Barbieri M, Marfella R, Nicoletti G, Balestrieri ML, Sardu C. Abdominal Fat SIRT6 Expression and Its Relationship with Inflammatory and Metabolic Pathways in Pre-Diabetic Overweight Patients. Int J Mol Sci. 2019;20:1153. doi: 10.3390/ijms20051153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Thandavarayan RA, Garikipati VN, Joladarashi D, Suresh Babu S, Jeyabal P, Verma SK, Mackie AR, Khan M, Arumugam S, Watanabe K, Kishore R, Krishnamurthy P. Sirtuin-6 deficiency exacerbates diabetes-induced impairment of wound healing. Exp Dermatol. 2015;24:773–8. doi: 10.1111/exd.12762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jin D, Tan HJ, Lei T, Gan L, Chen XD, Long QQ, Feng B, Yang ZQ. Molecular cloning and characterization of porcine sirtuin genes. Comp Biochem Physiol B Biochem Mol Biol. 2009;153:348–58. doi: 10.1016/j.cbpb.2009.04.004. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES