Skip to main content
PLOS One logoLink to PLOS One
. 2024 Jan 16;19(1):e0291939. doi: 10.1371/journal.pone.0291939

Cloning of maize chitinase 1 gene and its expression in genetically transformed rice to confer resistance against rice blast caused by Pyricularia oryzae

Sadaf Anwaar 1,#, Nyla Jabeen 1,#, Khawaja Shafique Ahmad 2,*, Saima Shafique 3, Samra Irum 1, Hammad Ismail 4, Siffat Ullah Khan 5, Ateeq Tahir 6, Nasir Mehmood 7, Mark L Gleason 8
Editor: Maganti Sheshu Madhav9
PMCID: PMC10791007  PMID: 38227608

Abstract

Fungal pathogens are one of the major reasons for biotic stress on rice (Oryza sativa L.), causing severe productivity losses every year. Breeding for host resistance is a mainstay of rice disease management, but conventional development of commercial resistant varieties is often slow. In contrast, the development of disease resistance by targeted genome manipulation has the potential to deliver resistant varieties more rapidly. The present study reports the first cloning of a synthetic maize chitinase 1 gene and its insertion in rice cv. (Basmati 385) via Agrobacterium-mediated transformation to confer resistance to the rice blast pathogen, Pyricularia oryzae. Several factors for transformation were optimized; we found that 4-week-old calli and an infection time of 15 minutes with Agrobacterium before colonization on co-cultivation media were the best-suited conditions. Moreover, 300 μM of acetosyringone in co-cultivation media for two days was exceptional in achieving the highest callus transformation frequency. Transgenic lines were analyzed using molecular and functional techniques. Successful integration of the gene into rice lines was confirmed by polymerase chain reaction with primer sets specific to chitinase and hpt genes. Furthermore, real-time PCR analysis of transformants indicated a strong association between transgene expression and elevated levels of resistance to rice blast. Functional validation of the integrated gene was performed by a detached leaf bioassay, which validated the efficacy of chitinase-mediated resistance in all transgenic Basmati 385 plants with variable levels of enhanced resistance against the P. oryzae. We concluded that overexpression of the maize chitinase 1 gene in Basmati 385 improved resistance against the pathogen. These findings will add new options to resistant germplasm resources for disease resistance breeding. The maize chitinase 1 gene demonstrated potential for genetic improvement of rice varieties against biotic stresses in future transformation programs.

Introduction

Yield loss due to diseases and pests has been estimated at >10% for crops worldwide [1]. Rice (Oryza sativa L.) is a predominant human food source and is widely grown worldwide, especially in Asia and Africa [2]. Rice provides 20% of the dietary energy for the world’s population [3]. In Pakistan, rice is the second most important food crop after wheat. Akey export product [4, 5], it is grown on 4.2 million hectares. Pakistan is the third largest exporter and 12th largest producer of rice in the world [6], and the crop accounts for 3% of value-added agricultural returns and 0.6% of Pakistan’s gross domestic product [7].

In Pakistan, fungal diseases of rice cause the most severe yield losses [8]. Rice blast, caused by the fungus Pyricularia oryzae, is one of the most damaging fungal diseases, causing heavy losses in quality and yield [9]. Many basmati rice varieties grown in Pakistan are susceptible to blast [10].

Resistance breeding and pesticides are the two most commonly used methods to combat plant diseases. The extensive use of pesticides leads to severe environmental problems [11]. Whereas the continuous use of traditional breeding methods may limit the gene pool of a species from which cultivars are derived, making crops more susceptible to biotic and abiotic stresses, and impeding future growth [12]. The world’s population is projected to rise from 6 to 8 billion by 2020, with rice consumption expected to grow by 1.8 percent annually. As a result, rice production must be increased by 25–45 percent to meet the increasing demand [12]. Efforts are being made to develop rice to produce high-quality crops [13] genetically. The most effective alternative is genetically engineered plants with enhanced characteristics [14].

One of the most effective strategies to defend rice against blast is development and cultivation of resistant genotypes [15]. The genomes of plants, fungi, and insects encode several types of chitinase, a chitin-degrading glycosidase. These genes have been comprehensively studied owing to their significant role in plant defense responses against fungal pathogens [16, 17]. Thirty-three chitinase genes were characterized in maize (Zea mays) genome codes for producing the chitinase-like protein present in a quantitative trait locus for fungal maize ear rot resistance [18]. These studies served as a platform to use the maize chitinase gene for developing transgenic rice with fungal resistance. During the past two decades, a wide range of cloned genes, including chitinase, has been utilized to confer resistance against fungal pathogens in plants [19, 20].

Stable genetic transformation of cereal crops like maize, rice, wheat, and barley has provided new and improved varieties grown in extensive planting throughout the world [21]. Numerous methods for transferring genes into rice have been developed [22]. However, Agrobacterium-mediated methods have been widely used because of high transformation efficiency and the inclusion of transgenes with single or low copy numbers or large DNA segments with distinct ends that can be integrated readily into host genomes [23].

In view of the significance of rice in global food security and its economic importance in Pakistan, the objective of the current research was to develop a transgenic rice variety with enhanced resistance against the fungal pathogen Pyricularia oryzae by introducing the maize chitinase 1 gene through Agrobacterium-mediated transfer.

Materials and methods

Cloning of maize chitinase 1 gene

Cloning of the maize chitinase 1 gene (MCI) was carried out in the Department of Biotechnology, Plant Transformation Facility, Iowa State University (ISU), Ames, Iowa, USA. The maize chitinase 1 gene (accession number NP_001148230.1) was retrieved from the NCBI database. Based on its sequence homology with maize gene encoding class I chitinase protein, its codon was optimized according to rice using the codon optimization tool. The gene was synthesized from Gene Universal USA and was provided in standard vector pUC 57. The vector pDW3586 and all the protocols followed during this part of the research were provided by Dr. David A. Wright, ISU, with slight modifications (Fig 1); the resulting vector was named pSDF1.

Fig 1. Detailed map of vector pDW3586.

Fig 1

Competent cell formation, plasmid extraction and restriction digestion

E. coli strain DH 10B was transformed with pSDF1. The plasmid was extracted using an IBI Scientific plasmid extraction kit and digested with two pairs of endonucleases, Xba I/SpeI and XhoI/ BamHI. The digested plasmids were then run on a 0.8% gel with 2 log markers. Expected bands were 9.1 and 6kb and 13.4 and 1.8 kb, respectively. The desired plasmid band pSDF1 was purified using an IBI Scientific gel purification kit, and the DNA was sent to the ISU DNA Facility for sequencing.

After sequence confirmation of vector pSDF 1, we transformed the DH 10B strain with pSDF2. For convenience, standard vector pUC 57(with MC 1) gene was renamed pSDF2. The gene was obtained from pSDF2, integrated into pSDF1, and the product was termed pSDF3. The restriction digestion of plasmid pSDF1 and pSDF2 was done with endonucleases Spe I and Bam HI. Digested plasmids were run on a 0.8% gel. A 10-kb fragment was produced after restriction digestion of pSDF1 whereas a 0.9-kb maize chitinase 1 gene fragment was produced after restriction digestion of pSDF2. For the ligation step, vector (pSDF1), MC1 gene, T4 DNA ligase Buffer and T4 DNA ligase were mixed and incubated overnight at 16 C.

The next step was to transform E. coli with plasmid pSDF 3. Plasmid extraction was done using an IBI Scientific kit and was digested with endonuclease pair SpeI and BamHI, then run on a 0.8% agarose gel to confirm ligation. After confirmation of ligation, pSDF3 was sequenced at the ISU DNA Facility. The sequencing confirmed the results of the cloning experiment.

We then transformed a fresh culture of Agrobacterium tumefaciens strain EHA 101 with vector pSDF 3. The culture was centrifuged, and the pellet was washed three times with cold nuclease-free water. For Agrobacterium cells to lyse, 5 ul of PD2 buffer from the IBI Scientific plasmid extraction kit was added to a microcentrifuge tube. The tube was then placed into a thermocycler for incubation for 5 minutes at 60 C in order to lyse Agrobacterium. The plasmid DNA that was obtained was then used in competent cell formation of E. coli, and extraction of plasmid and digestion with the same pair of endonucleases SpeI and BamHI was performed. Afterward, the digested plasmid was run on agarose gel electrophoresis to confirm the successful transfer of pSDF3 (Fig 2) to Agrobacterium.

Fig 2. T-DNA region of plasmid pSDF3.

Fig 2

Generation of transgenic rice lines via Agrobacterium-mediated gene transformation

Oryza sativa L. indica cultivar Basmati 385 seeds were used as explants in the research work. Seeds were obtained from the National Agriculture Research Centre (NARC), Pakistan.

Agrobacterium strain and culture conditions

Five ml of a primary culture of fresh Agrobacterium was utilized to inoculate 50 ml of LB broth media to grow the Agrobacterium to an OD600 of 0.5–1.0. The culture was centrifuged at 8000 rpm for 3 minutes to form a pellet and resuspended in MS liquid (MSL) media before infection. The vector used in the study had hygromycin as the selection marker gene; thus, calli were studied for their capacity to tolerate hygromycin. Calli were grown for four weeks on agar media at four different concentrations (25, 50, 75, and 100 mg/L) of hygromycin.

Agrobacterium infection and co-cultivation

Four-week-old calli were immersed in MSL media with suspended Agrobacterium, then diluted to 0.1 to 0.2 at OD600. Infection time varied from 5 to 25 minutes, with occasional shaking. The Calli were then dried on sterilized filter paper to eliminate excess bacteria and were shifted to co-cultivation media plates. Co-cultivation media with different acetosyringone concentrations (100, 200, 300, and 400 μM) were tested. The dried infected calli were exposed to two, three or four days of co-cultivation at 22°C in darkness [24]. Excess Agrobacterium was eliminated after co-cultivation by washing the calli with the antibiotic carbenicillin. Calli were washed with sterilized distilled water and then with MS liquid containing carbenicillin (400mg/L) for 10 minutes [25].

Selection of transformed calli and regeneration of transformed plantlets

After washing, selection of transformed calli was made on two different media (Table 1). Petri plates containing calli on selection media were kept in a growth chamber for 2 to 3 weeks under 16 hrs light /8 hrs darkness at 3°C. The hygromycin-resistant calli were estimated, and the precent efficiency of callus transformation efficiency on the selection media was calculated. We followed the transformation protocol reported in [24] with slight modifications.

Table 1. Media formulations used in rice transformation.
Media Duration Components
Callogenesis 12–15 days N6 salt, 2,4-D (2 mg/L), CuO NPs (10mg/L), Sucrose 30 g/L, Phytagel 8 g/L, pH 5.8.
Bacterial suspension 2 days LB medium, sucrose 3%, Acetosyringone 200 μM, pH 7.
Infection 5- 25minutes MS salt, sucrose 3%, pH 5.8. (O.D600 of 0.1–0.2)
Co-cultivation 1–3 days MS salt, 2,4-D 2 mg/L, Sucrose 3%, Acetosyringone (100μM-400 μM), Phytagel 10g/L, pH 5.8.
Washing 2–3 minutes MS salt, sucrose 30 g/L,Carbenicillin 400mg/L, pH 5.8.
Selection 3–4 weeks MS salt, 2,4-D 2 mg/l, SMI (50 mg/L Hygro) and SMII (50 mg/L Hygro+400 Carbenicillin), Phytagel 8g/L, pH 5.8
Regeneration 5–8 weeks MS salt + (NAA 1.0 mg/L + BAP 0.5 mg/L + Kin 0.5mg/L), Sucrose 3%, Phytagel 16g/L, pH 5.8, RGMI (Hygro 25 mg/L, Carb. 400 mg/L) and RGM II (Hygro 25 mg/L, Carb. 400 mg/L, CuO- NPs 20 mg/L)

Hygromycin-resistant calli were shifted to two different regeneration media, RGM I (hygro 25 mg/L+ Carbenicillin 400 mg/L) and RGM II (Hygromycin 25 mg/L, carbenicillin 400 mg/L, CuO-NPs 20 mg/L). The calli were incubated in a growth chamber under 16 hrs light /8 hrs darkness at 28°C for four weeks. Regeneration frequency was calculated by percentage. The plants thus obtained from regeneration were subjected to molecular analysis through PCR to confirm the successful integration of MC1 gene as documented by [26] with slight modifications. The media formulations used in the transformation process are listed in Table 1.

Molecular analysis of putative transgenic rice

Basmati 385 was subjected to molecular analysis to confirm transformation. For PCR, DNA was isolated from transformants using an Invitrogen Genomic Plant DNA Purification kit, and plasmid DNA was isolated from Agrobacterium strain EHA 101 with an IBI Scientific DNA extraction kit. The protocol followed with modifications for PCR was reported previously [26]. The hygromycin phosphotransferase gene (hpt) and maize chitinase 1 gene in putative transformants were amplified using Thermo Fisher PCR master mix with the following primer pairs:

  • hpt gene FP-ACAGCGTCTCCGACC TGATGCA

        RP-AGTCAATGACCGCTGTTATGCG

  • MC1 gene FP- GGTAAGGTCTTGGCATCATTTA

         RP-TGGCCCTCTATTTCGTACTTGAAC

Primer sequences for actin gene were used as an internal control, The amplification reaction was performed with denaturation at 95°C for 2 minutes, annealing of primers at 52°C for 1 minute, and extension at 72°C for 2 minutes. The cycle was repeated 29 times to give exponential amplification of the desired DNA sequence and final extension at 72°C for 5 min.

Expressional analysis of MC1 gene in Basmati 385

After the MC1 and hpt genes were confirmed in transgenic rice, expression of MC1 was analyzed using real-time PCR at both T0 and T1 generations and at seedling and tillering stages. Total RNA extraction was done with the method of Liu et al. [27] with slight modifications and cDNA was synthesized using Thermo Fischer Revert-Aid First Strand cDNA Synthesis Kit K-1622. The analysis was performed on a Bio-Rad Real-Time PCR system, using the transformed cDNA as templates and MC1 primers to analyze the gene. The reference gene was actin (ACT 1) with to following primer sequence:

  • FP -CTTCATAGGAATGGAAGCTGCGG

  • RP -CGACCACCTTGATCTTCATGCTGCTA

To quantify the amount of dsDNA, One-Step SYBR Green Master Mix was used. The thermal setting was denaturation at 95°C for 3 minutes, followed by 39 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds and extension at 72°C for 30 seconds. The qPCR samples were run in sets of three. Actin was utilized as an internal control for data standardization. Comparative quantification of gene expression was analyzed using the delta Ct method in tested samples and the standard deviation was calculated [28]. The graphs were plotted for the relative expression of MC1 gene compared to the internal control.

Bioassay to evaluate transgenic rice response against P. oryzae

A detached leaf bioassay was carried out on control and transgenic plants to evaluate the phenotypic response of transgenic plants caused by MC1 against Pyricularia oryzae. For this purpose, the mycelium of P. oryzae was used for the inoculum preparation on PDA plates at 28°C for 48 hrs. Precisely for inoculum preparation, 10 drops of Tween 20 were added in 10 ml of water in a beaker and mixed it well by stirring. Few drops of distilled water were placed on a fungal plate using a disinfected spatula. The mixture was filtered, and spores were quantified using a hemocytometer. The conidial spore suspension was adjusted to 5x100 spores/ml in distilled water as described. This spore suspension was inoculated on the adaxial surface of detached leaves (transgenic and control plant) and transferred onto moist filter paper in glass petri plates were sealed with parafilm to retain the moisture [19]. Lesion size (length × maximum width) was measured after one week of inoculation at 28°C. The severity of blast symptoms on each leaf was rated using a qualitative scale [28] as follows: 0 = no visible lesion on the leaf, 1 = up to 10% leaf area affected, 2 = 11–25% leaf area affected, 3 = 26–50% leaf area affected, 4 = 51–75% leaf area affected, 5 = more than 75% leaf area affected. Disease severity ratings were converted into percent diseased tissue using the formula [29].

PBI=sumofallratingsNo.ofleavesXmaximumdiseasescore

Results

Cloning of maize chitinase 1 gene

E. coli strain DH 10 was transformed with pSDF1, grown in LB media amended with 100 mg/L of streptomycin. The plasmid (pDW3586) was 17.34 kb and digested with two pairs of endonucleases (Xba I and Spe I) loaded in lanes D1-D3 where D1, D2 and D3 represent restriction incubation time for 3 h, 6 h and 12 h respectively. Bands of 9.1 kb and 6kb were expected from Xba I and Spe I restriction, whereas for Xho I and Bam HI, bands of 13.4 kb and 1.8 kb were expected. From left D4 gave expected bands of 13.4 and 1.8 kb and was selected for purification and sequencing. Results of competent cell formation and plasmid digestion are shown in Fig 3.

Fig 3. (a) Competent cells of pSDF1, (b) Restriction digestion of pSDF1 with XhoI / BamHI, (c): Competent cells of pSDF2, (d) Restriction Digestion of pSDF2 BamHI / SpeI, I (e) Restriction Digestion of pSDF1 BamHI / SpeI.

Fig 3

After sequence confirmation of pSDF1, pSDF 2 (Fig 3a and 3b) carrying MC1 produced two bands—2.7 kb (pUC 57 gene) and 0.9 kb (maize chitinase 1 gene). The digest in lane 2 showed brighter bands and was subjected to gel clean-up and DNA extraction (Fig 3d). Moreover, pSDF1 was digested with the same endonucleases and run-on gel to get the desired vector (Fig 3e) for ligation of MC1.

The bands of digested pSDF 1 (from D3) and MC1 (from D2) were ligated to form pSDF 3, the desired plasmid carrying our gene of interest. To confirm successful ligation of MC1 in pSDF1, the plasmid was cloned in E. coli and digested with SpeI/Bam HI. The results of competent cell formation and digestion of pSDF3 are shown in (Fig 4a). The gel picture (Fig 4b) clearly showed the presence of both plasmid (10 kb) and MC1 (0.9 kb) bands. The plasmid digest in lane 3 (D3) showed the brightest band and was selected for sequencing. Sequencing confirmed the cloning results. When the sequence of pSDF3 was confirmed by Sanger sequencing, it was transformed into Agrobacterium strain EHA 101, competent cell formation (Fig 4c) and restriction digestion of the plasmid with the same pair of endonucleases was done (Fig 4d).

Fig 4. (a) Competent cells of pSDF3 (b) Confirmation of ligation of MC1 gene in pSDF3 through restriction digestion c): Competent cells of Agrobacterium strain EHA 101 with pSDF3 (d) Confirmation of transformation of Agro strain with pSDF3 through restriction digestion.

Fig 4

Agrobacterium-mediated transformation of Basmati 385 with MC1 gene

Table 2 represents the effects of different hygromycin concentrations on the proliferation and growth of calli. Of all the tested concentrations of hygromycin, 25 mg/L was best suited, with 82% of calli showed normal growth and proliferation. At 50 mg/L, the calli showed negligible growth and 62% turned brown, whereas oat 75 mg/L, only 5% of calli showed growth, 45% turned brown, and 50% of calli died. At a concentration of 100 mg/L, all of the calli were dead.

Table 2. Determination of the calli sensitivity to different concentrations of hygromycin.

Conc. of hygromycin (mg/L) %of calli turned brown % of calli turned dead % of calli showing proliferation Results
25 18 0 82 Strongly proliferating calli
50 62 18 20 H = Negligible growth of calli
75 45 50 05 Majority of calli died
100 0 100 0 All calli died

No of calli inoculated = 50 per concentration

Age of calli and infection time with agro strain is considered vital. The results of these factors are documented in Table 3 Four-week-old calli with infection time of 15 minutes showed the highest incidence of regeneration (59%). In comparison, 2- and 6-week-old calli with 15 minutes of infection time exhibited 36% and 33% regeneration, respectively.

Table 3. Effect of age of calli and infection time with Agrobacterium strain EHA 101 on the transformation frequency.

Callus age Infection time(min) Mean no. of calli showed growth± S.E % of transformation
2 weeks 5 15.00± 1.01c 30.00% d
15 18.34±0.55b 36.00% c
25 9.70±1.9d 19.00% e
4weeks 5 20.54±2.1b 41.00% b
15 29.7±1.17a 59.00% a
25 17.00±1.17c 34.00% c
6 weeks 5 18.33±0.79b 36.00% c
15 16.7±0.91c 33.00% c
25 5.33±1.3e 10.00% f

Each value in the table is represented as mean ± SD (n = 3). Each replication consists of 20 calli. Values with the same alphabets within columns are not significantly different at (p< 0.05).

The highest response, 64%, was recorded after a co-cultivation period of 2 days with 300 μM/L of acetosyringone, followed by 53% on 200 μM/L and 23% on both 100 and 400 μM/L (Fig 4). When the inoculation time increased to 3 days, a significant decrease in the regeneration of calli was observed; maximum regeneration was recorded at 33% on 300 μM/L of acetosyringone, followed by 22% and 15% on 200 and 100 μM/L respectively. In comparison, no response was recorded on the co-cultivation period of 4 days with all tested concentrations of acetosyringone as all the calli died and no regeneration was recorded. In our experiments, calli were best able to regenerate with 2 days of co-cultivation in 300 μM/L of acetosyringone (Table 4).

Table 4. Effects of time of co-cultivation and concentration of acetosyringone on transformation efficiency.

Co-cultivation time Conc. of acetosyringone (μM/L) Mean no. of calli proliferated ± S. E Transformation efficiency (%)
2 days 100 6.33±0.41d 23.00% d
200 16.00±0.79 b 53.00% b
300 19.33±1.11 a 64.00% a
400 6.33±1.31d 23.00% d
3 days 100 4.67±2.11 e 15.00% e
200 6.67±0.81 d 22.00% d
300 10.00±0.54 c 33.00% c
400 3.72±1.76 e 12.00% e
4 days 100 0.00±0.00 f 0.00% f
200 0.00±0.00 f 0.00% f
300 0.00±0.00 f 0.00% f
400 0.00±0.00 f 0.00% f

Each value in the table is represented as mean ± SD (n = 3). Each replication consists of 20 calli. Values with the same alphabets within columns showed no significant difference at (p< 0.05).

Calli showed proliferation of 55.5% on SMI compared to 36.7% on SMII (Table 5). Surviving calli on selection media doubled in size compared to the initial calli obtained on CIM.

Table 5. Evaluation of transformation efficiency of rice calli on selection media I & II.

Selection media Mean no. of calli proliferated ± S.E % of transformation
SM I 16.66±1.69a 55.5%a
SM II 11.12± 0.34b 36.7%b

Each value in the table is represented as mean ± SD (n = 3). Each replication consists of 20 calli. Values with the same alphabets within columns are not significantly different at (p< 0.05).

After 3 to weeks on selection media, well-developed calli were transferred to two different regeneration media, RGMI (hygromycin 25 mg/L, carbenicillin 400 mg/L) and RGM II (hygromycin 25 mg/L, carbenicillin, 400 mg/L, CuO- NPs 20 mg/L) to obtain putative transgenic plants. Table 6 represents regeneration/transformation efficiency on both regeneration media. On RGM II, 52% of plantlets were regenerated from hygromycin-resistant calli; on RGMI, in contrast, 36% of resistant calli regenerated to form plantlets. As calli withstood up to 400 mg/L carbenicillin and 25 mg/L hygromycin, these concentrations were used to stop growth of Agrobacterium in the shoot regeneration media.

Table 6. Transformation frequency of hygromycin-resistant calli on regeneration medium.

Media No. of hygro. resistant calli inoculated Putative transgenic plants Transformation frequency (%)
RGM I 25 09 36%
RGM II 25 13 52%

After the regeneration of the putative transgenic plants, molecular analysis was done. Different stages of transformation of rice cv. Basmati-385 is shown in Fig 5.

Fig 5. Different phases of Agrobacterium-mediated gene transformation of Rice cv. Basmati 385.

Fig 5

a) Callus induction b) Agro-infection c) Co-Cultivation d) Selection e) Regeneration f) shooting g) rooting and h) hardening.

Molecular analysis

Of eight tested plants from the T0 generation, six were positive for amplification of 196 bps (Fig 6a) internal sequence of MC1, and 5 out of 6 plants amplified 610 bps (Fig 6b) of hpt gene. For the T1 generation, all 10 tested plants showed the presence of MC1 gene (Fig 6c) and nine plants tested positive for the presence of the hpt gene (Fig 6d). Transgenic rice lines showing PCR-positive results were further evaluated by quantitative real-time PCR for the expression of the MC1 gene.

Fig 6.

Fig 6

(a) PCR analysis of Transgenic plants in T0 generation. Lane 1 = Marker, Lane 2 = Non-Transgenic Plants, Lane 3–9 = Transgenic plants, Lane 10 = Positive control (Plasmid DNA) (b) PCR detection of hpt gene in transgenic plants of T0 generation. Lane 1 = Marker, Lane 2 = Non-Transgenic Plant, Lane 3–7 = Transgenic Plants, Lane 8 = Positive control (Plasmid DNA), (c) PCR analysis of Transgenic plants in T1 generation. Lane 1 = Marker, Lane 2 = Positive control (Plasmid DNA), Lane 3–10 = Transgenic Plants, (d) PCR detection of hpt gene in transgenic plants of T1 generation. Lane 1 = Marker, Lane 2 = Non-Transgenic Plants, Lane 3–11 = Transgenic Plants, Lane 12 = Positive control (Plasmid DNA).

Expressional analysis of MC 1 gene

Varying levels of transgene expression were found. For example, transgenic plants of the T0 generation at tillering stage had the highest gene expression (15.41 in transgenic line 4, followed by 9.61 in transgenic line 1 and least a fold change in integrated MC1 gene was recorded in transgenic line 2 with a value of 2.95) (Fig 7a). In contrast gene expression ranged from 6 folds change to 17 folds were noted in the T0 generation at the tillering stage. Transgenic lines 4 and 1 showed the highest gene expression level of 17.22 and 16.08, respectively. The fold change in gene expression of transgenic lines 3 and 4 was 7.08 and 6.73, respectively (Fig 7b).

Fig 7. (a) Relative Expression of MC1 in regenerated stage at T0 generation, (b) Relative Expression of MC1 in tillering stage at T0 generation, (c) Relative Expression of MC1 in seedling stage at T1 generation, (d) Relative Expression of MC1 in tillering stage at T1 generation.

Fig 7

The expression of MC1 gene was also analyzed in T1 generation. Expression of the MC1 gene revealed that the highest fold change was in transgenic line 3 i-e, 19.91 (Fig 7c). In transgenic line 1 the fold change was recorded as 9.67. In transgenic lines 2 and 4, 2.49 and 3.06 increase in MC1 expression was recorded compared to the internal control (Fig 7c). Maximum expression was observed at the tillering stage of T1 generation as transgenic lines 1 and 2 with a fold change of 25.65 and 22.96, respectively; for transgenic lines 3 and 4-, 15.17- and 8.81-fold change, respectively, was recorded compared to the internal control (Fig 7d).

Bioassay to evaluate transgenic rice response against P. oryzae

Table 7 explains the results of the detached leaf assay from T1 generation of transgenic rice. The uppermost 3 leaves of mature were detached and inoculated with P. oryzae. One week post inculcation, results were recorded. Transgenic lines T1-L1, T1-L2 and T1-L3 showed the highest resistance against Blast pathogens. Meanwhile, transgenic line 4 showed moderate resistance against infected fungal pathogens. In contrast, the non-transformed rice plant was highly susceptible to fungal attack as its whole surface area of leaves became symptomatic.

Table 7. Functional validation of transgenic plants by leaf detached assay.

Rice Variety Response against P.oryzae
Lesion size± S.E(cm) % of Blast Disease Score Response
T1-L1 0.55±1.2 c 6.9 1 Highly Resistant
T1-L2 1.21±0.2 c 8.0 1 Highly Resistant
T1-L3 0.78±1.0 c 7.5 1 Highly Resistant
T1-L4 3.54±0.41b 13.2 2 Moderately Resistant
T0 8.66±1.1 a 100 5 Highly Susceptible
Control 0.00 0.00 c 0 0 Nil

Values followed by the same letter are non-significant at α 0.01, n = 3 replicates. L1-L3 represent transgenic lines

Discussion

Pathogenesis-associated (PA) proteins play a vital role against invading organisms in plant defense [30]. Despite having different PA-proteins, only plant β-1,3-glucanases and chitinases have been extensively studied [30]. Genes encoding β-1,3-glucanases and chitinases enzymes have also been cloned from the various plant [31]. Currently, determining the molecular mechanism from pathogen identification for the expression analysis of such genes is of prime interest. Several plant sources have been altered using PA genes to increase disease resistance [32]. According to the literature, the expression of PA genes and disease resistance are positively correlated [32]. Over half of the world’s population depends on rice (Oryza sativa L.) as a staple food [33]. One of the leading causes of biotic stress in rice, which results in significant productivity losses, is fungus infections. Rice blast is currently the most threatening rice disease in the world. It poses a concern to food security because of its capacity to decrease yields approximately in all geographic distributions. At every stage of development, the pathogen (Magnaporthe oryzae) attacks rice plants. It damages them, causing blast symptoms on all parts of the plant, including the collar, leaves, neck, panicle, node and grain. Each year, the fungus damages enough rice to feed approximately 60 million people, and the occurrence of blasts causes 50% of the rice production to be lost in the field. Regarding geographic coverage, rice blast is estimated to reduce significant productivity and result in a loss of millions of dollars. Although there are resistant varieties, rice blast is present wherever rice is farmed and has never been entirely eradicated, although the resistance wears off in a short period. Conventionally, rice disease management is carried out by breeding methods which are laborious and time-consuming processes. On the other hand, targeted genome editing has the potential to produce disease-resistant variants more quickly [34, 35].

Different factors can affect Agrobacterium transformation’s efficacy, which is why multiple parameters are needed to optimize to achieve maximum transformation efficiency [36]. Additional parameters like age of calli, antibiotic selection, the concentration of acetosyringone, time of agro-infection and co-cultivation period are also important factors of optimization. In our study, hygromycin concentration of 25mg/L was more effective than other concentrations. Likewise, in the case of indica rice, Yaqoob et al. [37] used 25 mg/l of hygromycin for selection and regeneration purposes. The callus’ age is crucial to achieving a high transformation frequency [36]. In our investigation, calli 2, 3, and 4 weeks old were removed and infected for 5, 15, and 25 minutes with an agrobacterium strain. The 3 week old calli that had been exposed to the agro strain for 15 minutes showed the best response. The same outcomes were seen by Rao et al. [38] in indica rice embryogenic calli at three and four weeks old. Optimal immersion time is necessary because Agrobacterium overgrowth during selection could also result from extended immersion time. Hence the ideal immersion time should be followed. Agrobacterium overgrowth can make the sub-culturing more tedious and challenging. According to several investigations, the resistant monocots, in particular, required phenolic inducers such as acetosyringone during gene transfer [39]. Therefore, it’s essential to utilize acetosyringone at the right concentration to avoid low transformation [26]. Depending on the plant type, in most of the reported studies, acetosyringone ranges from 20 to 200 M [40]. However, in the current investigation, 300 M of acetosyringone was found to be efficient, with a more than 60% regeneration rate. The findings of the current investigation are supported by the outcomes reported by Tan et al. [41]. The duration of the co-cultivation period is another crucial element that significantly affected the effectiveness of the transformation. Depending on the plant type, co-cultivation might range from a few hours to a few days [42]. Another critical factor is the co-cultivation period which showed a substantial effect on transformation efficiency. The co-cultivation time varies from hours to a few days, depending on plant species [42]. In the present research, we have found that two days of co-cultivation time was optimum for transformation, which is in the range of normal reported co-cultivation duration for rice, being two to three days [43].

Several genes that encode antifungal proteins have been effectively transgenetically expressed against various plant pathogenic fungi [44]. Amongst the pathogenesis-related proteins, chitinases represent the class of chitinolytic enzymes. Chitinases isolated from different sources show multiple ranges of antifungal activities in vitro. Mainly, chitinases class I is reported for the highest antifungal activity, which might be due to the chitin-binding domain presence [45]. Chitin-degrading enzymes in plants are plentiful and vastly diverse, including those in maize [46, 47]. A maize chitinase that has been related to fungal resistance is chitinase 2. Maize chitinase 2 has been expressed by inducing plants with A. flavus [48] and Fusarium graminearum Schwabe [49].

The goal of the current study was to clone and integrate a synthetic maize chitinase 1 gene using Agrobacterium-mediated transformation to create the transgenic rice variety (Basmati-385). Molecular analysis of putative transgenic lines in the current study was performed using PCR which confirmed the integration of MC1 gene expression cassette into the rice genomes. Progeny of selected transgenic plants showed variable expression levels of MC1 gene in qRT-PCR analysis. Expressional analysis was performed at the seedling and tillering stage on both generations (T0 and T1). MC1 gene showed higher expression than actin at seedling and tillering stages. The maximum gene expression compared to internal control was recorded in the seedling stage of T1 generation. It is reported that the prominent heterogeneity in transgene expression is frequently observed when the transgene construct is the same in different transgenic lines [17, 50, 51]. It is mainly due to the position effect [52], transgene copy [53] and various epigenetic silencing phenomena [54]. Bandopadhyay et al. [55] explained that high gene expression is linked with a single-site transgene insertion, whereas multiple sites transgene insertions may result in gene silencing. In addition, methylation of the promoter may also cause gene silencing, as extended methylation affects the gene expression level [56]. Literature reports that a higher number of cis-elements in their promoters is also associated with higher expression [57].

One of the most devastating diseases impacting the world’s rice production is rice blasts [58]. M. oryzae directly enters the cell membranes, causing mycelia to proliferate inside the cell and eventually kill the cell. Mycelia are believed to transfer to the neighboring cell before cell death, possibly by plasmodesmata. The growth of the fungus also hampers water and mineral movement in the plant’s vascular system. The fungus generates thousands of spores on conidiophores that emerge from stomata after entering the plant, and air currents can spread these spores to neighboring rice plants for prospective infection. This fungus is highly adaptable and can cause infection in its host at any stage of the growth cycle [59, 60]. Functional validation of the inserted gene was performed on transgenic plants based on the findings of the expressional study of MC1 by detached leaf bioassay with P. oryzae, the causative agent of Blast disease, to check the plant antifungal potential. Results have revealed significantly increased resistance against the tested pathogen. This resistance can be explained in terms of effector-triggered and pattern-triggered immunity. Pathogen-associated molecular patterns typically involve microbial or pathogen structures like lipopolysaccharides, flagellins, glucans and chitins recognized by specific plant receptors known as pattern recognition receptors that promote the activation of pattern-triggered immunity [61]. The variability in disease resistance of tested lines can be described as variable gene expression, as 3 tested transgenic lines were highly resistant, and one was moderately resistant. Our results follow previous findings in which the transgenic plants significantly reduced lesion area because of better penetration resistance and constrained pathogen lesion growth at infection sites [62].

The development of disease signs and higher resistance to infection by the pathogenic fungus Rhizoctonia solani were both observed in transgenic plants in published studies [63]. Various plants till now have been transformed using chitinase genes that exhibit improved disease resistance [64]. Furthermore, numerous publications state that non-plant chitinases have been introduced to model plants to assess their utility in disease resistance [65]. For example, the mycoparasitic fungus Trichoderma harzianum’s chitinase gene has been transferred to tobacco and potato plants [66]. The transgenic plants displayed improved resistance to several fungi, such as Alternaria solani, Alternaria alternata, Rhizoctonia solani and Botrytis cinerea [66]. In another study, when exposed to pathogenic fungi, a different fungal chitinase gene from Rhizopus oligosporus suppressed disease symptoms in transgenic tobacco plants [67]. Literature also reports that tobacco transformed with the chitinase gene of autograph californica multiple nucleopolyhedro viruses showed enhanced disease resistance in approximately 60% of plants [68].

In addition, the MC1 integration and expression exhibited no harmful effects on the transgenic plants and high-level resistance against blast disease, consistent with the results explaining the nontoxic effects of chitinases on host plants [69]. Therefore, chitinases restrict fungus growth by breaking down their cell walls; they also stop hyphae from growing and bud tubes from lengthening [70]. Additionally, it breaks down chitin into chitin oligosaccharides, which plants use as elicitors to activate their innate immunity [71] and subsequent host defensive mechanisms [69].

Conclusion

This is the first study to report the antifungal activity of maize chitinase 1 gene, expressed in rice cv. Basmati 385. The results showed that the constitutive expression of maize class I chitinase in rice resulted in enhanced antifungal resistance against P. oryzae. As Blast is one of the most destructive fungal diseases that cause huge yield loss per year. This work and further research will possibly add the maize chitinase 1 gene to the list of chitinases that are useful in genetic manipulation strategies for plants to develop resistance against phytopathogenic fungi.

Supporting information

S1 Raw images

(PPTX)

Acknowledgments

We thank Dr. David W. Wright, Iowa State University, Ames, Iowa, USA, for providing vector pDW3586.

Data Availability

All relevant data are within the paper and its Supporting information files.

Funding Statement

The study was supported by Higher Education Commission of Pakistan under grant number 8958, however funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Li D, Wang R, Xie C, Liu L, Zhang J, Li R, et al. A recognition method for rice plant diseases and pests video detection based on deep convolutional neural network. Sensors. 2020; 20(3): 578. doi: 10.3390/s20030578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Feng L, Wu B, Zhu S, Wang J, Su Z, Liu F, et al. Investigation on Data Fusion of Multisource Spectral Data for Rice Leaf Diseases Identification Using Machine Learning Methods. Front Plant Sci. 2020; 1: 577063. doi: 10.3389/fpls.2020.577063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zarbafi SS, Ham JH. An overview of rice QTLs associated with disease resistance to three major rice diseases: blast, sheath blight, and bacterial panicle blight. Agronomy. 2019; 9(4): 177. doi: 10.3390/agronomy9040177 [DOI] [Google Scholar]
  • 4.Chandio AA, Yuansheng J. Determinants of adoption of improved rice varieties in northern Sindh, Pakistan. Rice Sci. 2018; 25(2): 103–110. doi: 10.1016/j.rsci.2017.10.003 [DOI] [Google Scholar]
  • 5.Naseer MAR, Ashfaq M, Razzaq A, Ali Q. Comparison of water use efficiency, profitability and consumer preferences of different rice varieties in Punjab, Pakistan. Paddy Water Environ. 2019; 18: 272–282. doi: 10.1007/s10333-019-00780-9 [DOI] [Google Scholar]
  • 6.Trade Development authority of Pakistan, 2018.
  • 7.Government of Pakistan, Economic Survey of Pakistan; Ministry of Finance, Economic Division, Islamabad, Pakistan, 2019. [Google Scholar]
  • 8.Shafaullah M, Khan A, Nasir A, Khan A, Yasin S, Mahmood Y. Response of rice germplasm to blast disease under field conditions. Paki J Phytopathol. 2011; 23: 52–55. [Google Scholar]
  • 9.Yang J, Chen G, Li L, Zou L, Zhang C, Mao U. Portable rice disease spores capture and detection method using diffraction fingerprints on microfluidic chip. Micromachines. 2019; 10: 289. doi: 10.3390/mi10050289 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mustafa S, Rashid S, Ijaz M, Aamer M, Anwar MR. Screening of rice lines/varieties against rice blast (Pyricularia oryzae) disease under normal condition of district Bahawalnagar. Plant Protection. 2018; 2(1): 7–21. [Google Scholar]
  • 11.Li H, Huang J, Lu F, Liu Y, Song Y, Sun Y, et al. Impacts of carbon dots on rice plants: boosting the growth and improving the disease resistance. ACS Appl Bio Mater. 2018; 1(3): 663–672. doi: 10.1021/acsabm.8b00345 [DOI] [PubMed] [Google Scholar]
  • 12.Neeraja CN, Maghirang-Rodriguez R, Pamplona A, Heuer S, Collard BC, Septiningsih EM, et al. A marker-assisted backcross approach for developing submergence-tolerant rice cultivars. Theor Appl Genet. 2007; 115(6): 767–776. doi: 10.1007/s00122-007-0607-0 [DOI] [PubMed] [Google Scholar]
  • 13.Wagiran A, Ismail I, Che Mohd Zain CR, Abdullah R. ’Agrobacterium tumefaciens’-Mediated Transformation of the Isopentenyltransferase Gene in Japonica Rice Suspension Cell Culture. Aust J Crop Sci. 2010; 4(6): 421–429. [Google Scholar]
  • 14.Dong OX, Ronald PC. Genetic engineering for disease resistance in plants: recent progress and future perspectives. Plant Physiol. 2019; 22(2): 1–11. doi: 10.1104/pp.18.01224 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ahmad N, Khan M, Tofique M, Rauf I. Insect pests management of BT cotton through the manipulation of different eco-friendly techniques. The Nucleus. 2011; 48(3): 249–54. doi: http%3A//dx.doi.org/10.17582/journal.jis/2018/4.2.83.89 [Google Scholar]
  • 16.Zhou N, An Y, Gui Z, Xu S, He X, Gao J, et al. Identification and expression analysis of chitinase genes in Zizania latifolia in response to abiotic stress. Sci Hortic. 2020; 261: 108952. doi: 10.1016/j.scienta.2019.108952 [DOI] [Google Scholar]
  • 17.Durechova D, Jopcik M, Rajninec M, Moravcikova J, Libantova J. Expression of Drosera rotundifolia chitinase in transgenic tobacco plants enhanced their antifungal potential. Mol Biotech. 2019; 61(12): 916–928. doi: 10.1007/s12033-019-00214-1 [DOI] [PubMed] [Google Scholar]
  • 18.Hawkins LK, Mylroie JE, Oliveira DA, Smith JS, Ozkan S, Windham GL, et al. Characterization of the maize chitinase genes and their effect on Aspergillus flavus and aflatoxin accumulation resistance. Plos one. 2015; 10(6): e0126185. doi: 10.1371/journal.pone.0126185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Jabeen N, Zubeda C, Gulfraz M, Rashid H, Bushra M. Expression of rice chitinase gene in genetically engineered tomato confers enhanced resistance to Fusarium Wilt and Early Blight. Plant Pathol J. 2015; 31(3): 252–258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ali J, Jewel ZA, Mahender A, Anandan A, Hernandez J, Li Z. Molecular genetics and breeding for nutrient use efficiency in rice. Int J Mol Sci. 2018; 19(6): 1762. doi: 10.3390/ijms19061762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ji Q, Xu X, Wang K. Genetic transformation of major cereal crops. Int J Dev Biol. 2013; 57(6): 495–508. doi: 10.1387/ijdb.130244kw [DOI] [PubMed] [Google Scholar]
  • 22.Shimamoto K, Terada R, Izawa T, Fujimoto H. Fertile transgenic rice plants regenerated from transformed protoplasts. Nature. 1989; 338(6212): 274–276. doi: 10.1038/338274a0 [DOI] [Google Scholar]
  • 23.Shimizu-Sato S, Tsuda K, Nosaka-Takahashi M, Suzuki T, Ono S, Ta KN, et al. Agrobacterium-Mediated Genetic Transformation of Wild Oryza Species Using Immature Embryos. Rice. 2020; 13: 1–13. doi: 10.1186/s12284-020-00394-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sahoo KK, Tripathi AK, Pareek A, Sopory SK, Singla-Pareek SL. An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars. Plant methods. 2012; 7(1): 1–11. doi: 10.1186/1746-4811-7-49 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kutty P, Parveez G, Huyop F. Agrobacterium tumefaciens-infection strategies for greater transgenic recovery in Nicotiana tabacum cv. TAPM26. Int J Agri Res. 2011; 6(2): 119–133. [Google Scholar]
  • 26.Karthikeyan A, Pandian SK, Ramesh M. Agrobacterium-mediated transformation of leaf base derived callus tissues of popular indica rice (Oryza sativa L. subsp. indica cv. ADT 43). Plant Sci. 2012; 181:258–268. doi: 10.1016/j.plantsci.2011.05.011 [DOI] [PubMed] [Google Scholar]
  • 27.Liu L, Han R, Yu N, Zhang W, Xing L, Xie D, et al. A method for extracting high-quality total RNA from plant rich in polysaccharides and polyphenols using Dendrobium huoshanense. Plos one. 2018; 13(5):e0196592. doi: 10.1371/journal.pone.0196592 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Chaerani R, Groenwold R, Stam P, Voorrips Roeland E. Assessment of early blight (Alternaria solani) resistance in tomato using a droplet inoculation method. J Gen Plant Pathol. 2007; 73: 96–103. doi: 10.1007/s10327-006-0337-1 [DOI] [Google Scholar]
  • 29.Pandey KK, Pandey PK, Kallo G, Banerjee MK. Resistance to early blight of tomato with respect to various parameters of disease epidemics. J Gen Plant Pathol. 2003; 69: 364–371. doi: 10.1007/s10327-006-0337-1 [DOI] [Google Scholar]
  • 30.Roncero C, Vázquez de Aldana CR. Glucanases and chitinases. The Fungal Cell Wall. 2019:131–66. [DOI] [PubMed] [Google Scholar]
  • 31.Zieliński K, Dubas E, Gerši Z, Krzewska M, Janas A, Nowicka A, et al. β-1, 3-Glucanases and chitinases participate in the stress-related defence mechanisms that are possibly connected with modulation of arabinogalactan proteins (AGP) required for the androgenesis initiation in rye (Secale cereale L.). Plant Science. 2021;302:110700. [DOI] [PubMed] [Google Scholar]
  • 32.Sharma A, Sharma A, Kumar R, Sharma I, Vats AK. PR proteins: key genes for engineering disease resistance in plants. Crop Improvement: CRC Press; 2021. p. 81–98. [Google Scholar]
  • 33.Molla KA, Karmakar S, Molla J, Bajaj P, Varshney RK, Datta SK, et al. Understanding sheath blight resistance in rice: the road behind and the road ahead. Plant Biotechnol J. 2020; 18(4): 895–915. doi: 10.1111/pbi.13312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rehman A, Jingdong L, Chandio AA, Shabbir M, Hussain I. Economic outlook of rice crops in Pakistan: A time series analysis (1970–2015). Financial innovation. 2017; 3(1): 1–9. doi: 10.1186/s40854-017-0063-z [DOI] [Google Scholar]
  • 35.Bokhari S, Rasul G, Ruane A, Hoogenboom G, Ahmad A. The past and future changes in climate of the rice-wheat cropping zone in Punjab, Pakistan. Pakistan Journal of Meteorology. 2017; 13:26. [Google Scholar]
  • 36.Sawant G, Bhave S, Sawardekar S, Burondkar M, Gokhale N, Desai V. Optimization of genetic transformation method for an indica rice (Oryza sativa L.) variety Ratnagiri-711. Indian J Genet. 2020; 80(2): 147–153. [Google Scholar]
  • 37.Yaqoob U, Kaul T, Nawchoo IA. Development of an efficient protocol for Agrobacterium mediated transformation of some recalcitrant indica rice varieties. Ind J Plant Physiol. 2017; 22: 346–353. doi: 10.1007/s40502-017-0304-1 [DOI] [Google Scholar]
  • 38.Rao MVR, Rao GJN. Agrobacterium-mediated transformation of indica rice under acetosyringone-free conditions. Plant Biotechnol. 2007; 24: 507–511. [Google Scholar]
  • 39.Ozawa K. A high-efficiency Agrobacterium-mediated transformation system of rice (Oryza sativa L.). Methods Mol Biol. 2012; 847: 51–7. doi: 10.1007/978-1-61779-558-9_5 [DOI] [PubMed] [Google Scholar]
  • 40.Mishra S, Sangwan RS, Bansal S, Sangwan NS. Efficient genetic transformation of Withania coagulans (Stocks) Dunal mediated by Agrobacterium tumefaciens from leaf explants of in vitro multiple shoot culture. Protoplasma. 2013; 250:451–458. doi: 10.1007/s00709-012-0428-0 [DOI] [PubMed] [Google Scholar]
  • 41.Tan LW, Rahman ZA, Goh HH, Hwang DJ, Ismail I, Zainal Z. Production of transgenic rice (indica cv. MR219) overexpressing Abp57 gene through Agrobacterium-mediated transformation. Sains Malays. 2017; 46(5): 703–711. [Google Scholar]
  • 42.Manickavasagam M, Subramanyam K, Ishwarya R, Elayaraja D, Ganapathi A. Assessment of factors influencing the tissue culture-independent Agrobacterium-mediated in planta genetic transformation of okra [Abelmoschus esculentus (L.) Moench]. Plant Cell, Tissue and Organ Cult. 2015; 123(2): 309–320. doi: 10.1007/s11240-015-0836-x [DOI] [Google Scholar]
  • 43.Hwang HH, Yu M, Lai EM. Agrobacterium-mediated plant transformation: biology and applications. The Arabidopsis Book. 2017; 15. doi: 10.1199/tab.0186 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Moosa A, Farzand A, Sahi ST, Khan SA. Transgenic expression of antifungal pathogenesis-related proteins against phytopathogenic fungi–15 years of success. Isr J Plant Sci. 2018; 65(1–2): 38–54. 10.1080/07929978.2017.1288407 [DOI] [Google Scholar]
  • 45.Minamihata K, Tanaka Y, Santoso P, Goto M, Kozome D, Taira T, et al. Orthogonal enzymatic conjugation reactions create chitin binding domain grafted chitinase polymers with enhanced antifungal activity. Bioconjugate Chemistry. 2021;32(8):1688–98. [DOI] [PubMed] [Google Scholar]
  • 46.Shoresh M, Harman GE. Genome-wide identification, expression and chromosomal location of the genes encoding chitinolytic enzymes in Zea mays. Mol Genet Genomics. 2008; 280(2): 173–185. doi: 10.1186/1471-2229-10-136 [DOI] [PubMed] [Google Scholar]
  • 47.Kumar M, Brar A, Yadav M, Chawade A, Vivekanand V, Pareek N. Chitinases—potential candidates for enhanced plant resistance towards fungal pathogens. Agriculture. 2018; 8(7): 88. doi: 10.3390/agriculture8070088 [DOI] [Google Scholar]
  • 48.Wu S, Kriz AL, Widholm JM. Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize. Plant Physiol. 1994; 105(4): 1097–1105. doi: 10.1104/pp.105.4.1097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Dowd C, Wilson IW, McFadden H. Gene expression profile changes in cotton root and hypocotyl tissues in response to infection with Fusarium oxysporum f. sp. vasinfectum. Mol Plant Microbe Interact. 2004;17: 654–667. doi: 10.1094/MPMI.2004.17.6.654 [DOI] [PubMed] [Google Scholar]
  • 50.Iqbal MM, Nazir F, Ali S, Asif MA, Zafar Y, Iqbal J, et al. Over expression of rice chitinase gene in transgenic peanut (Arachis hypogaea L.) improves resistance against leaf spot. Mol Biotechnol. 2012; 50(2): 129–136. doi: 10.1007/s12033-011-9426-2 [DOI] [PubMed] [Google Scholar]
  • 51.Ribeiro TP, Arraes FBM, Lourenço‐Tessutti IT, Silva MS, Lisei‐de‐Sá ME, Lucena WA, et al. Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil. Plant Biotechnol J. 2017; 15(8): 997–1009. doi: 10.1111/pbi.12694 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Butaye KMJ, Cammue BPA, Delaure SL, De Bolle MFC. Approaches to minimize variation of transgene expression in plants. Mol Breed. 2005; 16(1): 79–91. [Google Scholar]
  • 53.Tizaoui K, Kchouk ME. Genetic approaches for studying transgene inheritance and genetic recombination in three successive generations of transformed tobacco. Genet Mol Biol. 2012; 35(3): 640–649. doi: 10.1590/S1415-47572012000400015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Rajeevkumar S, Anunanthini P, Ramalingam S. Epigenetic silencing in transgenic plants. Front Plant Sci. 2015; 6: 693. doi: 10.3389/fpls.2015.00693 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Bandopadhyay R, Haque I, Singh D, Mukhopadhyay K. Levels and stability of expression of transgenes. Transgenic Crop Plants. 2010; 1: 145–186. doi: 10.1007/978-3-642-04809-8_5 [DOI] [Google Scholar]
  • 56.Howarth JR, Fourcroy P, Davidian JC, Smith FW, Hawkesford MJ. Cloning of two contrasting high-affinity sulfate transporters from tomato induced by low sulfate and infection by the vascular pathogen Verticillium dahliae. Planta. 2003; 218(1): 58–64. doi: 10.1007/s00425-003-1085-5 . [DOI] [PubMed] [Google Scholar]
  • 57.Kaur A, Pati PK, Pati AM, Nagpal AK. In-silico analysis of cis-acting regulatory elements of pathogenesis-related proteins of Arabidopsis thaliana and Oryza sativa. PLoS One. 2017; 12(9): e0184523. doi: 10.1371/journal.pone.0184523 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Kihoro J, Bosco NJ, Murage H, Ateka E, Makihara D. Investigating the impact of rice blast disease on the livelihood of the local farmers in greater Mwea region of Kenya. Springerplus. 2013;2(1):1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Boddy L. Pathogens of autotrophs. The Fungi: Elsevier; 2016. p. 245–92. [Google Scholar]
  • 60.Doehlemann G, Ökmen B, Zhu W, Sharon A. Plant pathogenic fungi. Microbiology spectrum. 2017;5(1):5.1. 14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Yan J, Yuan SS, Jiang L, Ye X, Ng TB, Wu Z. Plant antifungal proteins and their applications in agriculture. Appl Microbiol Biotechnol. 2015; 99(12): 4961–4981. doi: 10.1007/s00253-015-6654-6 [DOI] [PubMed] [Google Scholar]
  • 62.Yang Y, Sossah FL, Li Z, Hyde KD, Li D, Xiao S, et al. Genome-wide Identification and Analysis of Chitinase GH18 Gene Family in Mycogone perniciosa. Front Microbiol. 2020;11: 3366. doi: 10.3389/fmicb.2020.596719 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Tiwari IM, Jesuraj A, Kamboj R, Devanna B, Botella JR, Sharma T. Host delivered RNAi, an efficient approach to increase rice resistance to sheath blight pathogen (Rhizoctonia solani). Scientific reports. 2017;7(1):1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Zhang F, Ruan X, Wang X, Liu Z, Hu L, Li C. Overexpression of a chitinase gene from Trichoderma asperellum increases disease resistance in transgenic soybean. Applied biochemistry and biotechnology. 2016;180(8):1542–58. doi: 10.1007/s12010-016-2186-5 [DOI] [PubMed] [Google Scholar]
  • 65.Segundo BS, López‐García B, Coca M. Biotechnological Approaches for Crop Protection: Transgenes for Disease Resistance in Rice. Plant Pathogen Resistance Biotechnology. 2016:245–72. [Google Scholar]
  • 66.Nicolás C, Hermosa R, Rubio B, Mukherjee PK, Monte E. Trichoderma genes in plants for stress tolerance-status and prospects. Plant Science. 2014;228:71–8. doi: 10.1016/j.plantsci.2014.03.005 [DOI] [PubMed] [Google Scholar]
  • 67.Kern MF, Maraschin SdF, Vom Endt D, Schrank A, Vainstein MH, Pasquali G. Expression of a chitinase gene from Metarhizium anisopliae in tobacco plants confers resistance against Rhizoctonia solani. Applied biochemistry and biotechnology. 2010;160(7):1933–46. [DOI] [PubMed] [Google Scholar]
  • 68.Shi J, Thomas C, King L, Hawes C, Possee R, Edwards M, et al. The expression of a baculovirus-derived chitinase gene increased resistance of tobacco cultivars to brown spot (Alternaria alternata). Annals of applied biology. 2000;136(1):1–8. [Google Scholar]
  • 69.D Dana M, Pintor-Toro JA, Cubero B. Transgenic tobacco plants overexpressing chitinases of fungal origin show enhanced resistance to biotic and abiotic stress agents. Plant Physiol. 2006; 142(2): 722–730. doi: 10.1104/pp.106.086140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Yang X, Yang J, Li H, Niu L, Xing G, Zhang Y, et al. Overexpression of the chitinase gene CmCH1 from Coniothyrium minitans renders enhanced resistance to Sclerotinia sclerotiorum in soybean. Transgenic Res. 2021; 29(2): 187–198. doi: 10.1007/s11248-020-00190-2 [DOI] [PubMed] [Google Scholar]
  • 71.Chen S, Rouse MN, Zhang W, Zhang X, Guo Y, Briggs J, et al. Wheat gene Sr60 encodes a protein with two putative kinase domains that confers resistance to stem rust. New Phytol. 2020; 225(2): 948–959. doi: 10.1111/nph.16169 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Maganti Sheshu Madhav

23 May 2022

PONE-D-21-36584Cloning of Maize Chitinase 1 gene and its expression in genetically transformed Rice: augmented resistance against pathogenic fungiPLOS ONE

Dear Dr. Ahmad,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR: 

Please give pointwise replies to the comments raised by the reviewers

Please ensure to have the language editing and check for typo errors

Discussion section is invariable need to improve

==============================

Please submit your revised manuscript by Jul 07 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Maganti Sheshu Madhav, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“We are thankful to Higher Education Commission Pakistan, for providing funding to conduct the current research. No additional external funding was received for this study.”

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

  In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Please amend your list of authors on the manuscript to ensure that each author is linked to an affiliation. Authors’ affiliations should reflect the institution where the work was done (if authors moved subsequently, you can also list the new affiliation stating “current affiliation:….” as necessary).

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. Language editing and check for typo errors is needed.

2. In line 122: are pSDF1 and pDW3586 same vectors?

3. Line 133-134: Whether pSDF1 and pSDF2 plasmids are of same size? How can you get 10 kb and 0.9 kb DNA size in both the vectors when restriction digested with Spe I and Bam HI ? pSDFF1 is pDW3586 while pSDF2 is pUC57 with MC1.

4. Please write the correct name of Agrobacterium strain. It is EHA 101 not the EH 101.

5. Fig. 2: Please show properly the T-DNA region. All components should be within LB and RB regions.

6. Line 185: Is it table 1 or 3.6

7. In Table 1, for infection formulation pH 7.0 was used which is not common for Agrobacterium transformation experiments. pH 5.2 is usually preferred.

8. Line 216-220. Denaturation in PCR at 72oC is not correct. Please verify.

9. Line 260-262: Whether plasmid pDW3586 has two sizes- 13.5 kb and 4 kb? In D1-D3 lanes 9.1 kb and 6 kb bands were inappropriate. Moreover, in D2, D3 lanes bands are absent. Mostly the gel image are not matching with the text given in results. Provide an appropriate gel image (3b).

10. Fig5. Replace with good image. Also add the rooting and hardening stage images.

11. Comment 16: In table 6, just mention as T0 or T1 lines. No need to write name of rice variety.

12. Line 419: Some text is missing in leaf detachment assay

13. Whole plant assay must be conducted along with leaf detachment assay and the results should be included.

14. Lines 424-427: Sentences are repeated from abstract and introduction sections.

15. Discussion should be improved a lot. Nowhere in the entire manuscript was mentioned regarding the significance of blast disease. What is the importance of this work? Most of the work is w.r.t. standardizing the protocol for Basmati variety. The discussion should have focused on chitinase gene and blast disease.

16. In the sentences such as “High gene expression level was explained by [69]”, authors name should be written along with the number for citation.

17. Instead of using the term parent vector, please use standard terms such as cloning vector, expression vector and binary vectors or simply a vector.

Reviewer #2: The article is of scientific interest but the article needs thorough revision. It is better to get it edited using an expert in English language. The MS is too elaborative. Fig-7 does not represent the differences of control and transgenic plants inoculated with P. oryzae. The Figure 7(a) it seems all the plants are suffering from nutrient deficiency. Similarly, Please check the Fig7. (b) there are huge differences among all the three plants as per as the nutrient supply is concerned. The first criteria of blast infection is the application of heavy dose of nitrogen to the plant which is not seen in your experiment. The species of Agrobacterium is not mentioned any where. In line 233 the authors have written "Total RNA extraction was done by method reported by [84] with slight modification": this type of sentence should be avoided. The sentence should be written as "reported by Liu et.al. [84]". Kindly modify the MS thoroughly checking even the technicality and the language. In Fig 3 why you have used two different background for the gel photography of 3.b & d?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Dr. Arup Kumar Mukherjee

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Jan 16;19(1):e0291939. doi: 10.1371/journal.pone.0291939.r003

Author response to Decision Letter 0


17 Nov 2022

Response to Academic Editor:

Please give pointwise replies to the comments raised by the reviewers

Answer: All comments are replied

Please ensure to have the language editing and check for typo errors

Answer: Manuscript has been revised and proofread completely to remove all language, grammar and typing errors.

Discussion section is invariable need to improve

Answer: Discussion part has been revised completely as per reviewers guidelines

Response to Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

Answer: Changes has been incorporated.

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

Answer: Please add the following grant number “HEC-NRPU-1854”

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

Answer: Please update our Funding Statement as following

“We are thankful to Higher Education Commission Pakistan, for providing funding to conduct the current research under grant number HEC-NRPU-1854. No additional external funding was received for this study. The funding agency had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Answer: Please add the data as supporting information.

5. Please amend your list of authors on the manuscript to ensure that each author is linked to an affiliation. Authors’ affiliations should reflect the institution where the work was done (if authors moved subsequently, you can also list the new affiliation stating “current affiliation:….” as necessary).

Answer: List of authors is linked with affiliation.  

Response to Reviewers Comments

Reviewer #1

1. Language editing and check for typo errors is needed. Manuscript has been revised and proofread completely to remove all such errors.

2. In line 122: are pSDF1 and pDW3586 same vectors? Yes, you are right this is the same vector and it has been explained in revised manuscript.

3. Line 133-134: Whether pSDF1 and pSDF2 plasmids are of same size? How can you get 10 kb and 0.9 kb DNA size in both the vectors when restriction digested with SpeI and Bam HI? pSDF1 is pDW3586 while pSDF2 is pUC57 with MC1. 10Kb fragment was produced after restriction digestion of pSDF1 while 0.9Kb fragment was produced after restriction digestion of pSDF2. Statement has been corrected in the revised manuscript.

4. Please write the correct name of Agrobacterium strain. It is EHA 101 not the EH 101. Corrections has been made in the revised manuscript.

5. Fig. 2: Please show properly the T-DNA region. All components should be within LB and RB regions. Changes has been incorporated in the revised figure.

6. Line 185: Is it table 1 or 3.6 Its table 1. Thanks for pointing out. Correction has been made in the revised manuscript.

7. In Table 1, for infection formulation pH 7.0 was used which is not common for Agrobacterium transformation experiments. pH 5.2 is usually preferred. Yes, you are right, in our experiments, pH was optimized as 5.8 and correction has been made in the revised manuscript.

8. Line 216-220. Denaturation in PCR at 72oC is not correct. Please verify. Correction has been made in the revised manuscript.

9. Line 260-262: Whether plasmid pDW3586 has two sizes- 13.5 kb and 4 kb? In D1-D3 lanes 9.1 kb and 6 kb bands were inappropriate. Moreover, in D2, D3 lanes bands are absent. Mostly the gel images are not matching with the text given in results. Provide an appropriate gel image (3b). It was typing mistake. The actual size is 17.34kb. Correction has been made in the manuscript. D1, D2 and D3 represents different time of restriction incubation and has been explained in the revised manuscript.

10. Fig5. Replace with good image. Also add the rooting and hardening stage images. Changes has been incorporated as suggested.

11. In table 7, just mention as T0 or T1 lines. No need to write name of rice variety. Changes has been incorporated as suggested.

12. Line 419: Some text is missing in leaf detachment assay Correction has been made in the revised manuscript.

13. Whole plant assay must be conducted along with leaf detachment assay and the results should be included. Thank you for your positive suggestion. Infect due to limitation of T1 generation plants, we only focused on the leaf detachment assay. We used leaf detachment assay because in literature it has been used as standard assay in multiple studies.

14. Lines 424-427: Sentences are repeated from abstract and introduction sections. Statements has been replaced in the revised version.

15. Discussion should be improved a lot. Nowhere in the entire manuscript was mentioned regarding the significance of blast disease. What is the importance of this work? Most of the work is w.r.t. standardizing the protocol for Basmati variety. The discussion should have focused on chitinase gene and blast disease. Discussion has been revised completely as per suggestions.

16. In the sentences such as “High gene expression level was explained by [69]”, authors name should be written along with the number for citation. Changes has been incorporated in the revised manuscript.

17. Instead of using the term parent vector, please use standard terms such as cloning vector, expression vector and binary vectors or simply a vector. Changes has been incorporated in the revised manuscript.

Reviewer #2:

1. The article is of scientific interest but the article needs thorough revision. It is better to get it edited using an expert in English language. The MS is too elaborative. Manuscript has been revised and proofread completely to remove all such errors.

2. Fig-7 does not represent the differences of control and transgenic plants inoculated with P. oryzae. The Figure 7(a) it seems all the plants are suffering from nutrient deficiency. Similarly, please check the Fig7. (b) there are huge differences among all the three plants as per as the nutrient supply is concerned. Thank you for your suggestion. Figure 7 represents the relative gene expression of MC1 gene in T0 and T1 generation which was quantified by real time PCR. The difference in bar represents the gene expression relative to control

3. The first criteria of blast infection is the application of heavy dose of nitrogen to the plant which is not seen in your experiment. Thank you for your insight review. Infect our main objective of the research was cloning of MC1 gene and its expression analysis so we limited our applications only on transgenic line in comparison of non-transgenic lines.

4. The species of Agrobacterium is not mentioned anywhere. Specie information has been added in the revised manuscript.

5. In line 233 the authors have written "Total RNA extraction was done by method reported by [84] with slight modification": this type of sentence should be avoided. The sentence should be written as "reported by Liu et.al. [84]".

Changes has been incorporated in the revised manuscript.

6. Kindly modify the MS thoroughly checking even the technicality and the language. Manuscript has been revised completely to remove all such errors.

7. In Fig 3 why you have used two different backgrounds for the gel photography of 3.b & d? Thank you for your time and positive feedback on our manuscript. The gel images were observed using two different instruments and we intended to provide the original images in the manuscript that’s why we added them as it.

Attachment

Submitted filename: Response to Comments.docx

Decision Letter 1

Maganti Sheshu Madhav

6 Jan 2023

PONE-D-21-36584R1Cloning of Maize Chitinase 1 gene and its expression in genetically transformed Rice: augmented resistance against pathogenic fungiPLOS ONE

Dear Dr. Ahemad,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by  14th Jan 2023 .

If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Maganti Sheshu Madhav, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Authors have addressed the concerns raised by the reviewers. But I suggest authors to improve the language of the paper by taking help of the professional English editing services.

The use of mycelial plugs from 48 hr old culture to inoculate for testing disease resistance need to substantiate...

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

Reviewer #4: No

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

Reviewer #4: No

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: The authors have incorporated all the modifications as suggested. But till then I suggest please check the spellings once more.

Reviewer #4: I have gone through the comments of earlier reviewers. While the authors have tried to address the concerns raised by the reviewers, I still believe that the authors should improve the language of the paper by taking help of the professional English editing services.

I have noted a gross methodological error committed by the authors while screening the resistance of the trasngenics expressing the chitinase gene. The use of the mycelial plugs from 48 hr old culture to inoculate rice leaves for testing their resistance is absolutely incorrect because the mycelial strands cannot penetrate and infect the aerial plant surfaces of the rice. Probably the authors are not aware about the infection biology of the blast pathogen. The infection of rice leaves invariably occurs through the conidial inoculum, which is applied to the leaves as spore suspension or as spore droplets. Infection begins when spores germinate on the leaf surface and form appressoria at the germ tube tips. Appressoria become pressurized and melanized. When tightly annealed, hydrostatic turgor acts on a penetration peg at the appressorial base, forcing it to penetrate the cuticle. It is therefore necessary to apply a conidial suspension to leaves to evaluate their resistance to blast. I am providing the references of a few papers, which report on evaluation on the resistance of transgenics expressing chitinase or other defence response genes against rice blast; in all these studies conidial suspensions have been applied to test the resistance of rice plants against leaf blast.

i. Nishizawa et al. 1999. Enhanced resistance to blast (Magnaporthe grisea) in transgenic Japonica rice by constitutive expression of rice chitinase. Theor Appl Genet. 99(3-4):383-90.

ii. Qian et al. 2014. Enhanced resistance to blast fungus in rice (Oryza sativa L.) by expressing the ribosome-inactivating protein α-momorcharin. Plant Science : an International Journal of Experimental Plant Biology. 217-218:1-7. DOI: 10.1016/j.plantsci.2013.11.012.

iii. Pokhrel et al. 2021. Transgenic Rice Expressing Isoflavone Synthase Gene from Soybean Shows Resistance Against Blast Fungus (Magnaporthe oryzae). Plant Dis. 105(10):3141-3146.

The mycelial plugs can be used to test the resistance of rice to other pathogens like Rhizoctonia solani which elaborate specialized pentation structures from mycelial strands to penetrate host surface. The same procedure cannot be applied against rice blast due to peculiar infection biology of the rice blast pathogen. The references no.12 and 28 provided by the authors in material and methods section also reported the use the conidial spore suspensions to test the resistance of the respective host species. I therefore wonder that on what premise the authors have used the mycelial plugs to test the resistance of transgenics in their study. The use of mycelial plugs for testing the resistance against leaf blast has vitiated the authenticity of the results of the present study.

I do not recommend the paper for publication in PLOS.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: Yes: Arup Kumar Mukherjee

Reviewer #4: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Jan 16;19(1):e0291939. doi: 10.1371/journal.pone.0291939.r005

Author response to Decision Letter 1


16 Jan 2023

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Answer: All references has been cross checked and corrections has been made in the revised version

Additional Editor Comments:

Authors have addressed the concerns raised by the reviewers. But I suggest authors to improve the language of the paper by taking help of the professional English editing services.

Answer: Manuscript has been revised and proofread completely by American native language speaking person (Letter attached) to remove all language, grammar and typing errors.

The use of mycelial plugs from 48 hr old culture to inoculate for testing disease resistance need to substantiate...

Answer: We agree with the reviewer comments and experiment validation has been added in the revised version.

Review Comments to the Author

Reviewer #3: The authors have incorporated all the modifications as suggested. But till then I suggest please check the spellings once more.

Answer: Thank you for your time and feedback. Manuscript has been revised and proofread completely to remove all language, grammar and typing errors.

Reviewer #4: I have gone through the comments of earlier reviewers. While the authors have tried to address the concerns raised by the reviewers, I still believe that the authors should improve the language of the paper by taking help of the professional English editing services.

Answer: Manuscript has been revised and proofread completely to remove all language, grammar and typing errors.

I have noted a gross methodological error committed by the authors while screening the resistance of the trasngenics expressing the chitinase gene. The use of the mycelial plugs from 48 hr old culture to inoculate rice leaves for testing their resistance is absolutely incorrect because the mycelial strands cannot penetrate and infect the aerial plant surfaces of the rice. Probably the authors are not aware about the infection biology of the blast pathogen. The infection of rice leaves invariably occurs through the conidial inoculum, which is applied to the leaves as spore suspension or as spore droplets. Infection begins when spores germinate on the leaf surface and form appressoria at the germ tube tips. Appressoria become pressurized and melanized. When tightly annealed, hydrostatic turgor acts on a penetration peg at the appressorial base, forcing it to penetrate the cuticle. It is therefore necessary to apply a conidial suspension to leaves to evaluate their resistance to blast. I am providing the references of a few papers, which report on evaluation on the resistance of transgenics expressing chitinase or other defence response genes against rice blast; in all these studies conidial suspensions have been applied to test the resistance of rice plants against leaf blast.

Answer: Yes, you are right. We also used the spores suspension for testing the disease resistance. Initially we added the summarized version of methodologically in which we unintendedly, missed some important steps. Thanks for your insightful review to highlight the importance and mechanism of the bioassay. The detail of methodology has been added in the revised manuscript. This revised methodology is SOP of our laboratory, as in one of the previous studies we also utilized the same methodology in which spores were utilized.

ANWAAR, SADAF, et al. "EVALUATION OF PAKISTANI RICE CULTIVARS FOR APPARENT INFECTION RATE AGAINST FUNGAL PATHOGEN Pyricularia oryzae." PLANT CELL BIOTECHNOLOGY AND MOLECULAR BIOLOGY (2021): 29-37.

Attachment

Submitted filename: Author response to reviewer comments.doc

Decision Letter 2

Maganti Sheshu Madhav

20 Mar 2023

PONE-D-21-36584R2Cloning of maize chitinase 1 gene and its expression in genetically transformed rice to confer resistance against rice blast caused by Pyricularia oryzaePLOS ONE

Dear Dr. Ahmad,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by May 04 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Maganti Sheshu Madhav, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

The article is of scientific interest, but the article needs still revision. It is better to get it edited using an expert in English language.

The manuscript is too elaborative. Figures need to be revised. Discussion needs to be improved a lot. Please go through several comments of reviewers and reply suitably.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

Reviewer #4: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

Reviewer #4: No

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

Reviewer #4: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: (No Response)

Reviewer #4: No

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: The authors have answered all the queries asked by the reviewers. My only concern is about the quality of photographs especially the gel photographs.

Reviewer #4: As has been the case with many of the queries raised by other reviewers, in the instant case also the authors knowing well that they have committed a fatal methodological error in screening of their transgenic lines, they have changed their stance and now claiming that they have the used the other screening method suggested by me to screen the transgenic lines. Their assertion is unbelievable and cannot be trusted.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: Yes: Arup Kumar Mukherjee

Reviewer #4: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Jan 16;19(1):e0291939. doi: 10.1371/journal.pone.0291939.r007

Author response to Decision Letter 2


24 Jul 2023

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Answer: Reference list has been checked carefully, it is complete and moreover no paper has been cited which is retracted.

Additional Editor Comments:

The article is of scientific interest, but the article needs still revision.

It is better to get it edited using an expert in English language.

The manuscript is too elaborative. Figures need to be revised. Discussion needs to be improved a lot. Please go through several comments of reviewers and reply suitably

Answer: Manuscript has been revised

 

Review Comments to the Author

Reviewer #3: The authors have answered all the queries asked by the reviewers. My only concern is about the quality of photographs especially the gel photographs.

Answer: Thank you for your time and feedback. Quality of manuscript has been improved in the revised manuscript.

Reviewer #4: As has been the case with many of the queries raised by other reviewers, in the instant case also the authors knowing well that they have committed a fatal methodological error in screening of their transgenic lines, they have changed their stance and now claiming that they have the used the other screening method suggested by me to screen the transgenic lines. Their assertion is unbelievable and cannot be trusted.

Answer: Thank you for your time and concern regarding methodology. Initially, revision was requested on leaf detached assay and we are thankful for the reviewer for identifying missing information. We have just added the missing information and provided the complete methodology. Additionally, we would like to add that using spore suspension is a routine methodology of our laboratory and it is our standardized SOP which can also be confirmed from our other publication “ANWAAR, SADAF, et al. "EVALUATION OF PAKISTANI RICE CULTIVARS FOR APPARENT INFECTION RATE AGAINST FUNGAL PATHOGEN Pyricularia oryzae." PLANT CELL BIOTECHNOLOGY AND MOLECULAR BIOLOGY (2021): 29-37.” Moreover, the reference we cited in the relevant section also support our methodology for using spore suspension. We just used the summary of methodology and cited the reference which ultimately means that we have followed the same method as mentioned in the reference.

Attachment

Submitted filename: Respone to reviewer comments.docx

Decision Letter 3

Maganti Sheshu Madhav

10 Sep 2023

Cloning of maize chitinase 1 gene and its expression in genetically transformed rice to confer resistance against rice blast caused by Pyricularia oryzae

PONE-D-21-36584R3

Dear Dr. Ahmad,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Maganti Sheshu Madhav, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

The authors have adequately addressed your comments raised in a previous round of review and I feel that this manuscript is now acceptable for publication.

Reviewers' comments:

Acceptance letter

Maganti Sheshu Madhav

13 Sep 2023

PONE-D-21-36584R3

Cloning of maize chitinase 1 gene and its expression in genetically transformed rice to confer resistance against rice blast caused by Pyricularia oryzae

Dear Dr. Ahmad:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Maganti Sheshu Madhav

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Raw images

    (PPTX)

    Attachment

    Submitted filename: Authors reponse to reviewer comments.docx

    Attachment

    Submitted filename: Response to Comments.docx

    Attachment

    Submitted filename: Author response to reviewer comments.doc

    Attachment

    Submitted filename: Respone to reviewer comments.docx

    Data Availability Statement

    All relevant data are within the paper and its Supporting information files.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES