Skip to main content
NCBI home page
Aging Medicine logoLink to Aging Medicine
. 2023 Oct 10;6(4):379–385. doi: 10.1002/agm2.12267

Icariin attenuates the calcification of vascular smooth muscle cells through ERα – p38MAPK pathway

Jieyu He 1, Yanjiao Wang 1, Junkun Zhan 1, Shuang Li 1, Yuqing Ni 1, Wu Huang 1, Limin Long 1, Pan Tan 1, Yi Wang 1,✉, Youshuo Liu 1
PMCID: PMC10792338  PMID: 38239714

Abstract

Objective

To investigate the relationship between icariin and the osteoblastic differentiation of vascular smooth muscle cells (VSMCs) and the signal pathway involved.

Methods

We applied a universally accepted calcification model of VSMCs induced by β glycerophosphate. Then the VSMCs calcification was observed by treatment with icariin and/or inhibitors of estrogen receptors (ERs) and p38‐mitogen‐activated protein kinase (MAPK) signaling.

Results

Icariin inhibited osteoblastic differentiation and mineralization of VSMCs due to decreased ALP activity and Runx2 expression. Further study demonstrated that icariin exerted this suppression effect through activating p38‐MAPK but not extracellular‐regulated kinase, JNK or Akt. An inhibitor of p38‐MAPK partially reversed the inhibitory effects of icariin on osteoblastic differentiation. Interestingly, treatment of VSMCs with an ER antagonist ICI182780 and a selective ERα receptor antagonist PPT attenuated icariin‐mediated inhibition effect of VSMCs calcification, associated with suppression of p38‐MAPK phosphorylation.

Conclusions

Icariin inhibited the osteoblastic differentiation of VSMCs, and that the inhibitory effects were mediated by p38‐MAPK pathways through ERα.

Keywords: estrogen receptor, icariin, mitogen‐activated protein kinase, vascular calcification, vascular smooth muscle cells

Icariin exerted suppression of calcification of vascular smooth muscle cells through activating p38 MAPK. Blockage of estrogen receptor (ER) α impairs the suppression effect by icariin vis p38 MAPK.

graphic file with name AGM2-6-379-g004.jpg

1. INTRODUCTION

Vascular calcification is a major pathological alteration in atherosclerosis, diabetes, renal failure, and aortic stenosis. 1 , 2 , 3 It is an important risk factor for cardiovascular morbidity and mortality. 4 , 5 Substantial evidence showed that vascular calcification resembles the process of osteogenesis, which shares common factors regulating bone mineralization in calcified plaques. 6 , 7 , 8 , 9 , 10 , 11 Enhanced expressions of several osteoblast phenotype genes, including alkaline phosphatase (ALP), core binding factor a1 (Cbfα 1, or Runx2), osteocalcin, and osteopontin are observed in the process of calcification. Previous studies have demonstrated that vascular smooth muscle cells (VSMCs) played a pivotal role in the activation of vascular calcification by acquisition of the phenotype of osteoblast like cells. 6 , 7 , 8 , 9 , 10 , 11 To investigate the mechanisms of vascular calcification, we have applied the calcification model of beta glycerophosphate (β‐GP)‐induced VSMCs 6 , 12 in this study.

Epimedium, a traditional Chinese herbal medicine, is well known for its effect as “nourishing the kidneys and strengthening the bones” translated from traditional Chinese medical theory. A number of studies have demonstrated its therapeutic efficacy on osteoporosis, cardiovascular diseases, and immunoregulation. Icariin is the major pharmacological active component extracted from this herb. Several studies confirmed that icariin promoted osteogenic differentiation of bone marrow stromal cells and MC3T3E1. 13 , 14 In addition, icariin also has been shown to have beneficial effects on cardiovascular diseases, such as atherosclerosis. 15 , 16 In another recent study, icariin protect against oxidative stress‐induced calcification in mouse VSMCs (mVSMCs) by suppressing ATF4 and eIF2α‐downstream pathway. 17 Because the calcification model was induced by high glucose and hydrogen peroxide simultaneously, it activates oxidative stress, and the possibility could not be ruled out that icariin might exert a protective role in addition to estrogen receptor (ER) stress.

In view of this, we have conducted the present study to elucidate the impact of icariin on osteoblastic differentiation of VSMCs in another model. We reported that icariin can inhibit osteoblastic differentiation of VSMCs via p38‐MAPK pathways through estrogen receptor α (ERα).

2. MATERIALS AND METHODS

2.1. Cell culture and reagents

Mouse vascular smooth muscle cells (mVSMC) were acquired from 8‐week‐old female C57/BL6 mice, as previous described, 6 and was approved by the Committee of the Second Xiangya Hospital of Central South University, China. Briefly, the adventitia was removed before the isolation of tunica media from the mouse aortas. Then, the tissue was fragmented (1–2 mm3). The aortas were minced and digested in 5 mL of digestion solution (0.125 mg/mL elastase, 0.25 mg/mL soybean trypsin inhibitor, 10 mg/mL collagenase I, 2.0 mg/mL crystallized bovine albumin, and 15 mmol/L HEPES) at 37°C for 45 minutes. The cellular digests were filtered through sterile 100‐mMnylon mesh, centrifuged at 1000 revolutions per minute (rpm) for 10 minutes, and washed twice in Dulbecco's Modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS; Gibico‐BRL Corp.) before culture in the same medium. Experiments were carried on cells between passages 3 and 8 from the primary culture. Immunocytochemical examination showed positive staining in all cells for α‐smooth muscle actin. The mVSMCs were cultured in DMEM containing 4.5 g/L of glucose, 10% FBS, and 10 mmol/L sodium pyruvate and the medium was refreshed every 2–3 days. After seeding for 24 hours, the cells were washed once and treated with 10 mmol/L β‐GP (Sigma) to induce the osteoblastic differentiation of VSMCs. The reagents used in cell treatment were icariin (Sigma; 56601), p38 special inhibitor SB203580 (Sigma; S8307), ER inhibitors Fulvestrant (ICI182780; Sigma; v900926), ERα antagonist propyl pyrazole triol and ERβ antagonist diarylpropionitrile (DPN; Selleck; S6810).

2.2. Reverse transcription and real‐time polymerase chain reaction analysis

Total RNAs were prepared with TRIzol reagent and reverse transcribed to cDNA (Thermo Fisher; #11766050) following the manufacturer's instructions. Quantitative real‐time polymerase chain reaction (RT‐PCR) was performed using gene expression assays and gene expression master mix. The changes in gene expression of Runx2 (F 5′‐ATGGCGGGTAACGATGAAAAT‐3′, and R 5′‐ACGGCGGGGAGACTGTG‐3′) were normalized to GAPDH (F, 5′‐ATCACTGCCACTCAGAA and R 3′‐ACATTGGGGGAGGAACAC).

2.3. Immunoblotting

Cell extracts were collected after treatment for the indicated times. The total protein extracts of cultured cell were prepared with RIPA lysate (Beyotime) and equal amounts of protein were submitted to SDS‐PAGE and transferred onto 0.45 mm PVDF membranes (Pall). Then, the membranes were incubated successively with 5% milk and stained with primary antibodies anti‐RUNX2 (1:500; Santa Cruz; sc390351), anti‐p‐p38, anti‐p38, anti‐p‐JNK, anti‐JNK, anti‐p‐ERK, anti‐ERK, anti‐p‐AKT, anti‐AKT, and anti‐β‐actin (sc166182, sc81621, sc6254, sc7345, sc377400, sc271269, and sc47778; Santa Cruz). The membranes were then incubated with goat anti‐mouse or anti‐rabbit IgG antibody conjugated with horseradish peroxidase in 2% milk for 1 hour, and ECL developing kits (#1705060; Bio‐Rad). The images were taken by Bio‐Rad Molecular Imager ChemiDoc XRS+.

2.4. Analysis of alkaline phosphatase activity

For measuring alkaline phosphatase activity, treated cells were homogenized into a solution containing 20 mmol/L Tris–HCl, pH 8.0, and 150 mmol/L NaCl, 1% Triton X‐100, 0.02% NaN3, and 1 mmol/L PMSF and centrifuged at 12,000 g for 10 minutes. The supernatant was removed for ALP and protein concentration assay. The ALP activity was measured by spectrophotometer on p‐nitrophenol release at 37°C. ALP activity was normalized to the total protein content of the cell layer. Results were normalized to the levels of the total protein.

2.5. Statistical analysis

The results of the experiments were presented as means ± SD, and the analysis was performed with Statistical Product and Service Solutions (SPSS) software (version 17.0). Comparisons between values of more than two groups were evaluated by one‐way analysis of variance (ANOVA). A level of P < 0.05 was considered statistically significant.

3. RESULTS

3.1. Icariin attenuated the osteoblastic differentiation of mVSMCs

To determine whether icariin could affect osteoblastic differentiation of mVSMCs, β‐GP‐induced mVSMCs were treated with different concentration of icariin for 48 hours and assayed for ALP activity, a phenotypic marker for osteoblastic differentiation, 18 and for expression of Runx2, a transcription factor for osteoblastic differentiation. 19 Estrogen was used as a positive control, which has been proved to prohibit calcification of mVSMCs. 20 , 21 In our study, we confirmed that β‐GP increased the ALP activity (Figure 1A) and the expression of Runx2 determined by RT‐PCR and Western blotting (Figure 1B,C) in mVSMCs. Treatment with icariin significantly inhibited ALP activity in a dose‐dependent manner, whereas the peak effect was observed in the concentration of 10 mmol/L (Figure 1C). The expression of Runx2 was similar to that of ALP in mVSMCs cultured with β‐GP (Figure 1B,C). These data suggest that Icariin could inhibit the osteoblastic differentiation of VSMCs.

FIGURE 1.

FIGURE 1

Open in a new tab

Icariin attenuated the osteoblastic differentiation of mVSMCs. (A) The mVSMCs were cultured with 10 mmol/L β‐GP for 0, 3, 6 and 9 days. ALP activity was measured. The effect of β‐GP on ALP activity. ALP activity was measured by an ALP kit presented in time‐dependent manner. *P < .05 compared with cells untreated with β‐GP. (B) RT‐PCR analysis of Runx2 levels in mVSMCs treated with β‐GP for different duration. *P < .05 compared with cells untreated with β‐GP. (C) Western blot analysis of Runx2 levels in mVSMCs treated with β‐GP or icariin or estrogen at different concentration for 48h.

3.2. Icariin attenuated osteoblastic differentiation of mVSMCs through the p38‐MAPK signaling pathway

It was widely accepted that Mitogen‐activated protein kinases (MAPKs) and PI3K‐AKT signaling pathway play a vital role in cell differentiation, and both pathways are involved in osteoblastic differentiation of mVSMC. 22 , 23 To determine whether these signaling pathways exert inhibitory effects of icariin, expression of AKT and three distinct MAPK molecules ERK, JNK, and p38, were assessed by Western blot analysis in β‐GP‐induced VSMCs with treatment of icariin. In response to icariin, only p38‐MAPK was phosphorylated (Figure 2A) except ERK (Figure 2B), JNK (Figure 2C), or Akt (Figure 2D). The p38‐MAPK was promptly phosphorylated in 5 minutes with the peak at 15 minutes (Figure 2A).

FIGURE 2.

FIGURE 2

Open in a new tab

Icariin attenuated osteoblastic differentiation of mVSMCs via p38‐MAPK signaling pathway. mVSMCs were treated with 10 mmol//L icariin for indicated times. The phosphorylation of p38 (A), JNK (B), ERK(C) and Akt (D) were determined by Western‐blot. Then β‐GP‐induced mVSMCs were pretreated with 1 μmol/L SB203580 before treatment with 10 mM icariin for indicated time. The phosphorylation of p38 (E) and expression of Runx2 (F) were determined by Western‐blot when treated with icariin for five minutes.

To further confirm the role of p38‐MAPK signaling pathway in this model, β‐GP‐induced mVSMCs were pretreated with SB203580 (p38 MAPK inhibitor) for 30 minutes, and then treated with icariin for 5 minutes to assess p‐p38 level, or for 48 hours to assess ALP activity and Runx2 expression. Phosphorylation of p38 induced by icariin was blocked by SB203580 (10 μM; Figure 2E). Calcification level of mVSMCs treated with icariin worsened to the control level in the presence of SB203580. As shown in (Figure 2F,G), Runx2 expression and ALP activity elevated in the presence of SB203580 compared with cells only treated with icariin. The above observations strongly suggest that icariin inhibit calcification of VSMCs via p38‐MAPK signaling pathway.

3.3. Effects of ER antagonist on the calcification inhibition of icariin in mVSMCs

Because icariin resembles estrogen (E2) in chemical structure, whereas E2 mainly targets cells via two ERs, it is assumed that icariin inhibited mVSMCs calcification similar to E2 via binding to ERs. Once pretreated with PPT (ERα antagonist), DPN (Erβ antagonists), or Fulvestrant (ICI182780; antagonist for both ERα and ERβ) for 30 min, β‐GP‐induced mVSMCs were treated with icariin. Expression of Runx2 and ALP activity was enhanced by ICI182 780 and PPT, which counteracted icariin‐induced alterations (Figure 3A,B). In contrast, administration of DPN had no obvious effect on mVSMCs (Figure 3B). It is indicated that icariin induced the activation effect of p38‐MAPK signaling pathway through ERα, but not ERβ.

FIGURE 3.

FIGURE 3

Open in a new tab

Effects of ER antagonist on the calcification inhibition of icariin in mVSMCs. Before β‐GP induction and icariin treatment, mVSMCs were pretreated with several ER antagonist, including PPT (ERα antagonist), DPN (Erβ antagonists) or Fulvestrant (ICI182780) (antagonist for both ERα and ERβ) separately for 30 minutes. (A) ALP activity was measured. *P < 0.01 compared with cells treated with β‐GP. The level of Runx2 (B) and phosphorylation of p38 (C) were determined by Western‐blot.

4. DISCUSSION

Clarification of the definite mechanisms on vascular calcification and development of effective therapeutic strategies are both challenging currently. It has been considered vascular calcification is a passive process of calcium and phosphate deposit in arteries. 6 , 7 , 8 , 9 , 10 , 11 However, recent studies reveal that vascular calcification is an actively regulated process which is similar with osteogenesis, and the osteoblastic differentiation of VSMCs played a pivotal role in vascular calcification. In the present study, mVSMCs were induced by β‐GP as the well accepted cell models 6 to study osteoblastic differentiation of mVSMCs. This cell model produces cells that have a typical osteoblast phenotype, for which they can express ALP and Runx2. Our data showed that icariin decreased the activity of ALP, which are well‐recognized as early markers of osteoblastic differentiation and increased during the differentiation of VSMCs. Our quantitative RT‐PCR and Western blot analysis also demonstrated that icariin decreased the expression of Runx2 induced by β‐GP, which is an important osteoblast differentiation transcription factor. It has been demonstrated by our group and other studies that treatment with apelin, 24 ghrelin, and estrogens 20 , 21 decreased the ALP activity of mVSMCs significantly and inhibited osteoblastic differentiation of mVSMCs, accompanied by suppression of Runx2 expression. Our present experiment demonstrated that icariin, which might act in a similar manner to these reagents, inhibited osteoblastic differentiation of mVSMCs.

Mitogen‐activated protein kinases (MAPKs), one of the major pathways involved in eukaryotic cell regulation, play an essential role in cell differentiation, which consisted of four major cascades: the ERK, the p38 kinase, the JNK, and ERK5. The MAPK signaling pathway is known to be involved in osteoblastic differentiation of VSMCs. 22 , 23 Icariin has been shown to activate the MAPK signaling pathway. Besides that, a previous study also demonstrated that icariin stimulates the osteogenic differentiation of bone marrow stromal cells via activating the PI3K‐AKT signal pathway. In addition, icariin has a cardioprotective effect through the activation of PI3K‐Akt signaling pathway. 25 , 26 In the present study, we explored whether MAPK and PI3K‐AKT signaling pathway was involved in the effect of icariin on osteoblastic differentiation. In our present study, we showed the osteoblastic differentiation of mVSMCs is associated with a concomitant activation of p‐p38 MAPK. Then the relationship between mVSMCs osteoblastic differentiation and icariin activated p‐38 MAPK signal pathway was evident from the results that a special p‐38 inhibitor significantly alleviated the protective effect of icariin on osteoblastic differentiation in mVSMCs, indicating that phosphorylation of p38 was one target of icariin in suppressing osteoblastic differentiation of mVSMCs. Additionally, activation of the other kinases, including JNK and ERK, was not observed in our study. Here, the PI3K‐AKT signal pathway was not induced by icariin, whereas a converse finding was reported in osteogenic differentiation of bone marrow stromal cells and MC3T3E1. 13 , 14 Our present study suggested that icariin inhibited osteoblastic differentiation of mVSMCs via the MAPK p38 signaling pathway. Because recent studies reported ERK5 promoted osteogenic differentiation and mineralization, 27 , 28 , 29 whether ERK5 is involved in osteoblastic differentiation of mVSMCs remains unclear.

Icariin, as a large group of heterocyclic phenolic compounds with chemical structure similar to that of estrogen, has received intense attention. It is now widely accepted that the influence of estrogen on target tissues are mainly mediated by two estrogen receptors, ERα and Erβ. 30 ERs play crucial roles in proliferation, differentiation, migration, and apoptosis, by modulating distinct genomic and/or nongenomic pathways. In present study, we explored the mediate role of ERs in the effect of icariin on osteoblastic differentiation of mVSMCs. The role of ERα in suppressing mVSMCs proliferation has been well established for decades. 31 Our results also showed that the inhibitive effect on osteogenesis by icariin vanished when treated with ERs receptor antagonism or ERα antagonism. These data suggest that the effect of icariin on inhibition of osteoblastic differentiation of mVSMCs was mediated partially by estrogen receptor signaling. It has enriched the mechanisms that icariin suppresses ER stress found in another calcification model. 17 Typically, the majority of ERα or ERβ are found in the cytoplasm and nucleus, whereas small amounts are expressed on cell membrane. Estrogen can induce rapid effects through membrane‐bound estrogen receptors, via activating ERK, JNK, and p38 MAPK signaling pathways to induce gene expressions concerning osteoblast survival and differentiation. Here, we found that ER antagonist ICI182780 and ERα antagonist PPT could significantly reduce icariin induced p‐38 phosphorylation and activation. Thus, we speculated that icariin behaved as a phytoestrogen that signals through ERα but not ERβ.

In conclusion, we have revealed that icariin could directly attenuate osteoblastic differentiation of mVSMCs by activating p38‐MAPK pathway through ERα. We also demonstrated that icariin can act as a phytoestrogen to activate the ERα signaling pathway. These findings may provide a new insight into the effect of icariin on calcification of mVSMCs and the future prevention and treatment of vascular calcification.

AUTHOR CONTRIBUTIONS

Youshuo Liu and Yi Wang designed and supervised the study. Jieyu He, Shuang Li, Pan Tan, and Yuqing Ni conducted the experiments and collected the data. Yanjiao Wang, Limin Long, and Junkun Zhan analyzed the data. All authors participated in the manuscript writing and revision.

ACKNOWLEDGEMENT

The authors have nothing to report.

FUNDING INFORMATION

This work was funded by National Natural Science Foundation of China (82101663), the Key Project of Health Care Fund of Hunan Province (A2019‐02), Hunan Provincial Administration of Traditional Chinese Medicine Project (D2022102), and the Scientific Research Program of Hunan Provincial Health Commission (D202303107884).

CONFLICT OF INTEREST STATEMENT

Youshuo Liu is the Editorial Board member of Aging Medicine and co‐author of this paper. To minimize bias, they were excluded from all editorial decision making related to the acceptance of this paper for publication. Other authors have nothing to disclose.

He J, Wang Y, Zhan J, et al. Icariin attenuates the calcification of vascular smooth muscle cells through ERα – p38MAPK pathway. Aging Med. 2023;6:379‐385. doi: 10.1002/agm2.12267

REFERENCES

  • 1. Fadini GP, Albiero M, Menegazzo L, et al. Widespread increase in myeloid calcifying cells contributes to ectopic vascular calcification in type 2 diabetes. Circ Res. 2011;108(9):1112‐1121. doi: 10.1161/CIRCRESAHA.110.234088 [DOI] [PubMed] [Google Scholar]
  • 2. Ferguson JF, Matthews GJ, Townsend RR, et al. Candidate gene association study of coronary artery calcification in chronic kidney disease: findings from the CRIC study (Chronic Renal Insufficiency Cohort). J Am Coll Cardiol. 2013;62(9):789‐798. doi: 10.1016/j.jacc.2013.01.103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Tsao CW, Pencina KM, Massaro JM, et al. Cross‐sectional relations of arterial stiffness, pressure pulsatility, wave reflection, and arterial calcification. Arterioscler Thromb Vasc Biol. 2014;34(11):2495‐2500. doi: 10.1161/ATVBAHA.114.303916 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Santos RD, Rumberger JA, Budoff MJ, et al. Thoracic aorta calcification detected by electron beam tomography predicts all‐cause mortality. Atherosclerosis. 2010;209(1):131‐135. doi: 10.1016/j.atherosclerosis.2009.08.025 [DOI] [PubMed] [Google Scholar]
  • 5. Kiu Weber CI, Duchateau‐Nguyen G, Solier C, et al. Cardiovascular risk markers associated with arterial calcification in patients with chronic kidney disease stages 3 and 4. Clin Kidney J. 2014;7(2):167‐173. doi: 10.1093/ckj/sfu017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Cui RR, Li SJ, Liu LJ, et al. MicroRNA‐204 regulates vascular smooth muscle cell calcification in vitro and in vivo. Cardiovasc Res. 2012;96(2):320‐329. doi: 10.1093/cvr/cvs258 [DOI] [PubMed] [Google Scholar]
  • 7. Liang QH, Jiang Y, Zhu X, et al. Ghrelin attenuates the osteoblastic differentiation of vascular smooth muscle cells through the ERK pathway. PLoS One. 2012;7(4):e33126. doi: 10.1371/journal.pone.0033126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Liao XB, Zhang ZY, Yuan K, et al. MiR‐133a modulates osteogenic differentiation of vascular smooth muscle cells. Endocrinology. 2013;154(9):3344‐3352. doi: 10.1210/en.2012-2236 [DOI] [PubMed] [Google Scholar]
  • 9. Liu GY, Liang QH, Cui RR, et al. Leptin promotes the osteoblastic differentiation of vascular smooth muscle cells from female mice by increasing RANKL expression. Endocrinology. 2014;155(2):558‐567. doi: 10.1210/en.2013-1298 [DOI] [PubMed] [Google Scholar]
  • 10. Sheen CR, Kuss P, Narisawa S, et al. Pathophysiological role of vascular smooth muscle alkaline phosphatase in medial artery calcification. J Bone Miner Res. 2015;30(5):824‐836. doi: 10.1002/jbmr.2420 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Yuan LQ, Zhu JH, Wang HW, et al. RANKL is a downstream mediator for insulin‐induced osteoblastic differentiation of vascular smooth muscle cells. PLoS One. 2011;6(12):e29037. doi: 10.1371/journal.pone.0029037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Collett GD, Sage AP, Kirton JP, Alexander MY, Gilmore AP, Canfield AE. Axl/phosphatidylinositol 3‐kinase signaling inhibits mineral deposition by vascular smooth muscle cells. Circ Res. 2007;100(4):502‐509. doi: 10.1161/01.RES.0000258854.03388.02 [DOI] [PubMed] [Google Scholar]
  • 13. Song L, Zhao J, Zhang X, Li H, Zhou Y. Icariin induces osteoblast proliferation, differentiation and mineralization through estrogen receptor‐mediated ERK and JNK signal activation. Eur J Pharmacol. 2013;714(1–3):15‐22. doi: 10.1016/j.ejphar.2013.05.039 [DOI] [PubMed] [Google Scholar]
  • 14. Wu Y, Xia L, Zhou Y, Xu Y, Jiang X. Icariin induces osteogenic differentiation of bone mesenchymal stem cells in a MAPK‐dependent manner. Cell Prolif. 2015;48(3):375‐384. doi: 10.1111/cpr.12185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Zhang WP, Bai XJ, Zheng XP, Xie XL, Yuan ZY. Icariin attenuates the enhanced prothrombotic state in atherosclerotic rabbits independently of its lipid‐lowering effects. Planta Med. 2013;79(9):731‐736. doi: 10.1055/s-0032-1328551 [DOI] [PubMed] [Google Scholar]
  • 16. Hu Y, Sun B, Liu K, et al. Icariin attenuates high‐cholesterol diet induced atherosclerosis in rats by inhibition of inflammatory response and p38 MAPK signaling pathway. Inflammation. 2016;39(1):228‐236. doi: 10.1007/s10753-015-0242-x [DOI] [PubMed] [Google Scholar]
  • 17. Bai XJ, Liu Y, Gao SS, Zhang WP. Inhibitory mechanism of icariin against oxidative stress‐induced calcification in aortic vascular smooth muscle cells. Zhongguo Zhong Yao Za Zhi. 2021;46(17):4497‐4503. doi: 10.19540/j.cnki.cjcmm.20210603.406 [DOI] [PubMed] [Google Scholar]
  • 18. Franceschi RT, Young J. Regulation of alkaline phosphatase by 1,25‐dihydroxyvitamin D3 and ascorbic acid in bone‐derived cells. J Bone Miner Res. 1990;5(11):1157‐1167. doi: 10.1002/jbmr.5650051111 [DOI] [PubMed] [Google Scholar]
  • 19. Prince M, Banerjee C, Javed A, et al. Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J Cell Biochem. 2001;80(3):424‐440. doi: [DOI] [PubMed] [Google Scholar]
  • 20. Osako MK, Nakagami H, Koibuchi N, et al. Estrogen inhibits vascular calcification via vascular RANKL system: common mechanism of osteoporosis and vascular calcification. Circ Res. 2010;107(4):466‐475. doi: 10.1161/CIRCRESAHA.110.216846 [DOI] [PubMed] [Google Scholar]
  • 21. Rzewuska‐Lech E, Jayachandran M, Fitzpatrick LA, Miller VM. Differential effects of 17beta‐estradiol and raloxifene on VSMC phenotype and expression of osteoblast‐associated proteins. Am J Physiol Endocrinol Metab. 2005;289(1):E105‐E112. doi: 10.1152/ajpendo.00366.2004 [DOI] [PubMed] [Google Scholar]
  • 22. Shi Y, Gou BD, Shi YL, Zhang TL, Wang K. Lanthanum chloride suppresses hydrogen peroxide‐enhanced calcification in rat calcifying vascular cells. Biometals. 2009;22(2):317‐327. doi: 10.1007/s10534-008-9168-1 [DOI] [PubMed] [Google Scholar]
  • 23. Luo XH, Zhao LL, Yuan LQ, Wang M, Xie H, Liao EY. Development of arterial calcification in adiponectin‐deficient mice: adiponectin regulates arterial calcification. J Bone Miner Res. 2009;24(8):1461‐1468. doi: 10.1359/jbmr.090227 [DOI] [PubMed] [Google Scholar]
  • 24. Shan PF, Lu Y, Cui RR, Jiang Y, Yuan LQ, Liao EY. Apelin attenuates the osteoblastic differentiation of vascular smooth muscle cells. PLoS One. 2011;6(3):e17938. doi: 10.1371/journal.pone.0017938 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Ke Z, Liu J, Xu P, Gao A, Wang L, Ji L. The cardioprotective effect of icariin on ischemia‐reperfusion injury in isolated rat heart: potential involvement of the PI3K‐Akt signaling pathway. Cardiovasc Ther. 2015;33(3):134‐140. doi: 10.1111/1755-5922.12121 [DOI] [PubMed] [Google Scholar]
  • 26. Xiao‐Hong D, Chang‐Qin X, Jian‐Hua H, Wen‐Jiang Z, Bing S. Icariin delays homocysteine‐induced endothelial cellular senescence involving activation of the PI3K/AKT‐eNOS signaling pathway. Pharm Biol. 2013;51(4):433‐440. doi: 10.3109/13880209.2012.738332 [DOI] [PubMed] [Google Scholar]
  • 27. Sun Y, Liang Y, Li Z, Xia N. Liraglutide promotes osteoblastic differentiation in MC3T3‐E1 cells by ERK5 pathway. Int J Endocrinol. 2020;2020:8821077. doi: 10.1155/2020/8821077 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Zhang B, An L, Geng B, et al. ERK5 negatively regulates Kruppel‐like factor 4 and promotes osteogenic lineage cell proliferation in response to MEK5 overexpression or fluid shear stress. Connect Tissue Res. 2021;62(2):194‐205. doi: 10.1080/03008207.2019.1670650 [DOI] [PubMed] [Google Scholar]
  • 29. Adam C, Gluck L, Ebert R, Goebeler M, Jakob F, Schmidt M. The MEK5/ERK5 mitogen‐activated protein kinase cascade is an effector pathway of bone‐sustaining bisphosphonates that regulates osteogenic differentiation and mineralization. Bone. 2018;111:49‐58. doi: 10.1016/j.bone.2018.03.020 [DOI] [PubMed] [Google Scholar]
  • 30. Bean LA, Ianov L, Foster TC. Estrogen receptors, the hippocampus, and memory. Neuroscientist. 2014;20(5):534‐545. doi: 10.1177/1073858413519865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Nanao‐Hamai M, Son BK, Hashizume T, Ogawa S, Akishita M. Protective effects of estrogen against vascular calcification via estrogen receptor alpha‐dependent growth arrest‐specific gene 6 transactivation. Biochem Biophys Res Commun. 2016;480(3):429‐435. doi: 10.1016/j.bbrc.2016.10.066 [DOI] [PubMed] [Google Scholar]

Articles from Aging Medicine are provided here courtesy of Wiley

RESOURCES