Skip to main content
NCBI home page
The American Journal of Tropical Medicine and Hygiene logoLink to The American Journal of Tropical Medicine and Hygiene
. 2023 Nov 6;109(6):1270–1273. doi: 10.4269/ajtmh.23-0142

Case Report: Molecular Characterization of Bloodstream Infections due to Carbapenem-Resistant Acinetobacter baumannii: A Pediatric Case Series

José Iván Castillo Bejarano 1, Jorge Llaca Díaz 2, Manuel Enrique de la O Cavazos 3, Hugo Sánchez Alanís 2, Abiel Homero Mascareñas de los Santos 1, Fernando Espinosa Villaseñor 1, Rebeca Aguayo Samaniego 1, Daniel Siller Rodríguez 4, Nestor Casillas Vega 2,*
PMCID: PMC10793043  PMID: 37931306

ABSTRACT.

Acinetobacter baumannii poses a significant threat to public health due to the high rate of multidrug-resistant strains. However, information on the molecular characterization of carbapenem-resistant Acinetobacter baumannii (CRAB) bloodstream infections in children is scarce. This study aimed to describe the molecular characterization of carbapenem-resistant A. baumannii infections in children from a hospital in Mexico. A retrospective study was conducted during the period 2017–2022. Clinical and demographic data were collected from the clinical records. Mass spectrometry was used for the identification of the strains. To confirm A. baumannii strains, a polymerase chain reaction (PCR) method was applied using a gyrB sequence. The carbapenemase-encoding resistance genes were detected by PCR. Six cases of CRAB were documented, including five in neonates. The median intensive care unit stay was 20 days, and all cases had an invasive medical device. Half of the patients had at least one medical condition. A high prevalence of coresistance was observed in most of the antibiotic groups. Three of the six strains coharbored carbapenemase genes: blaOXA-51, blaOXA-24, and blaIMP. Mortality was reported in two neonate patients. The present study shows a high rate of coharboring blaOXA-51, blaOXA-24, and blaIMP-1, which has a direct impact on therapeutic decisions. Implementation of antimicrobial stewardship programs is urgent to stop the spread of this microorganism.

INTRODUCTION

Acinetobacter baumannii is considered a Priority 1 pathogen by the WHO because of its high prevalence of multidrug-resistant (MDR) strains.1 Carbapenem-resistant A. baumannii (CRAB) has become a worldwide threat because of the lack of therapeutic options.2,3 Acinetobacter baumannii strains possess a chromosomally encoded blaOXA-51, and can acquire additional carbapenemases, exacerbating the challenge of treatment.4

Information regarding the molecular characterization of CRAB infections in children is scarce, with most reports published in the context of an outbreak.5–8 Our study aimed to describe the molecular characteristics of CRAB bloodstream infections in children from a third-level referral center in Mexico.

MATERIALS AND METHODS

All cases of A. baumannii bloodstream infection were collected between January 2017 and December 2022 from hospitalized children at Hospital Universitario “Dr. José Eleuterio González” in Monterrey, Mexico. Demographic and clinical characteristics data were collected from clinical records.

The strains were previously identified at the Central Clinical Laboratory at the institution using matrix-assisted laser desorption/ionization time-of-flight (Bruke Biotyper Microflex LT/SH MALDI-MS System). To distinguish A. baumannii from other Acinetobacter species, a multiplex PCR was implemented, using a gyrB sequence.9 Antibiotic susceptibility testing was performed using a MicroScan Walkaway, and broth microdilution. The isolates were subjected to antimicrobial susceptibility testing according to the guidelines of the Clinical and Laboratory Standards Institute.10 Categorization of the drug-resistance profile was defined as MDR, extensively drug-resistant (XDR) profile, and pan-drug-resistant according to Magiorakos et al.11

All carbapenem-resistant isolates were tested for nine carbapenemase-encoding genes; one class A carbapenemase (blaKPC), four class B carbapenemases (blaIMP, blaVIM, blaNDM, and blaSIM series), and four class D carbapenemases (blaOXA-51, blaOXA-23, blaOXA-24/40, and blaOXA-58) (Table 1).12

Table 1.

Primer sequences of the target genes

Gene Primer sequence (5′ → 3′) Size (bp) References
IMP F: ATGAGCAAGTTATCTGTATTCTTTAT 390 12
R: TTAGTTGCTTAGTTTTGATGGTTT
KPC F: TCGCCGTCTAGTTCTGCTGTCCT 965 12
R: CCGCGCAGACTCCTAGCCTAA
NDM-1 F: TCACCGAGATTGCCGAGCGA 457 12
R: GGGCAGTCGCTTCCAACGGT
VIM F: GGTCGCATATCGCAACGCAGT 188 12
R: CGGCGACTGAGCGATTTTTG
IMI F: CCATTTCACCCATCACAAC 440 12
R: CTACCGCATAATCATTTGC
SPM F: CTGCTTGGATTCATGGGCGC 271 12
R: CCTTTTCCGCGACCTTGATC
OXA-51 F: TCCAAATCACAGCGCTTCAAAA 353 12
R: TGAGGCTGAACAACCCATCCA
OXA-23 F: ACTTGCTATGTGGTTGCTTCTTCTT 501 12
R: TTCAGCTGTTTTAATGATTTCATCA
OXA-24 F: CAGTGCATGTTCATCTATT 246 12
R: TCTAAGTTGAGCGAAAAG
OXA-58 F: AAGTATTGGGGCTTGTGCTG 599 12
R: CCCCTCTGCGCTCTACATAC
Open in a new tab

All statistical descriptive analyses were performed using R software (V 4.2.2) (https://www.r-project.org/). This study was approved by the Institutional Ethics Committee with the code PE2100010.

RESULTS

Six cases of A. baumannii infections were documented, three male and three female. Of the cases, five were ≤1 month; and 1 case was ≥12 years. No cases were documented in other age groups. The median hospital length stay was 36 days (interquartile range [IQR]: 24–65), with a median length of intensive care unit stay of 20 days (IQR; 17–59). All cases were reported in the intensive care units. Regarding comorbidities, three of the six patients had at least one medical condition, including neurological disease (one of six), congenital heart disease (one of six), chronic pulmonary disease (one of six), and primary immunodeficiency (one of six) (Table 2). Mortality was reported in two neonates.

Table 2.

Characteristics of children with carbapenem-resistant Acinetobacter baumannii infection

Age group Sex Comorbidities Invasive devices Diagnostic Carbapenemase gene Outcome
Neonate M None Urinary catheter, central venous catheter Central line–associated bloodstream infection blaOXA-51 + blaOXA-24 Survived
Neonate F None Mechanical ventilation, central venous catheter Central line–associated bloodstream infection blaOXA-51 + blaOXA-24 Survived
Neonate F None Mechanical ventilation, central venous catheter Central line–associated bloodstream infection blaOXA-51 + blaOXA-24 Died
Neonate F Congenital heart disease Central venous catheter Primary bacteriemia blaOXA-51 + blaOXA-24 + blaIMP Survived
Neonate M Chronic pulmonary condition Mechanical ventilation, urinary catheter, central venous catheter Central line–associated bloodstream infection blaOXA-51 + blaOXA-24 + blaIMP Died
Adolescent M Neurological condition, primary immune deficiencies Urinary catheter, central venous catheter Central line–associated bloodstream infection blaOXA-51 + blaOXA-24 + blaIMP Survived
Open in a new tab

F = female; M = male.

All cases of A. baumannii infection had invasive devices, including central venous catheter (six of six), mechanical ventilation (four of six), and a urinary catheter (two of six). Surgical intervention within the 30 days before the infection was reported in two cases. Five of the six cases received at least one antibiotic with activity against A. baumannii in the previous 30 days. Notably, none of the patients received a carbapenem antibiotic within the 30 days before the infection. The most prevalent diagnoses were catheter-related bloodstream infections (five of six) and primary bacteriemia (one of six) (Table 2).

High coresistance was observed for ceftazidime (six of six), cefepime (six of six), amikacin (six of six), ciprofloxacin (six of six), gentamicin (five of six), and ampicillin/sulbactam (four of six). Moderate coresistance was observed for trimethoprim/sulfamethoxazole (three of six), tetracyclines (three of six), and piperacillin/tazobactam (two of six). No cases of colistin resistance were reported. Following the criteria of Magiorakos et al.,11 four cases were categorized as MDR) and two cases as XDR.

Regarding carbapenemase gene detection, blaOXA-51 and blaOXA-24 were amplified in all cases. Half of the cases were positive for blaIMP. Interestingly, half of the strains co-harbored blaOXA-24 + blaIMP. The antimicrobial resistance genes blaVIM, blaNDM, blaKPC, and blaIMI, were not detected in the isolates.

DISCUSSION

Acinetobacter baumannii is one of the main public health issues, particularly in healthcare-associated infections. However, information on the molecular characteristics of carbapenem-resistant A. baumannii infections in the pediatric population is scarce.13–17 In our case series, the neonatal population was the most prevalent (five of six), with catheter-related bloodstream infections being the most frequent type of infection (five of six), and a high rate of MDR and XDR strains. Interestingly, A. baumannii strains coharboring blaOXA-24 and blaIMP genes were detected in half the cases.

The presence of A. baumannii in the neonatal population has scarce information associated with active epidemiological surveillance.17 Although these cases were not under investigation of an outbreak due to the lack of epidemiology link between, we report a high proportion of neonatal population (five of six), with a fatal outcome in two of the five cases. Previous outbreaks due to carbapenem-resistant A. baumannii in neonatal intensive care units described mortality of 30.8% to 42.9%.17–20

Regarding risk factors for CRAB bloodstream infection in children, the presence of comorbidities (odds ratio [OR] 2.7, 95% CI: 2.03–5.6), stay in intensive care (OR 3.0, 95% CI: 1.3–5.1), use of ampicillin (OR: 2.8, 95% CI: 1.0–7.4), carbapenems (OR 2.4, 95% CI: 1.1–5.1), and surgical intervention (OR 5.1, 95% CI: 1.9–14.3) have been described. In another study conducted in Thailand, cases of CRAB in children showed higher exposure to ceftazidime (OR 5.19, 95% CI: 1.03–26.03) and aminoglycosides (OR 35.59, 95% CI: 3.51–360.52).18–21 In our study, there was a high prevalence of invasive devices (mechanical ventilation in four of six and central venous catheter in six of six), and half the cases had at least one medical condition. Furthermore, four of the five neonate cases received at least one antibiotic with activity against A. baumannii within 30 days before infection.

In our work, we described a high rate of MDR and XDR A. baumannii, with a high coresistance rate to most of the groups of antibiotics. The European Center for Disease Prevention and Control reports an increase of 121% in CRAB cases during the 2020–2021 period.22 Another recent study conducted in India showed an increase in the prevalence of CRAB from 95% to 100% in children, and the emergence of colistin resistance in 3.8%.23 In the United States, the proportion of CRAB in children increased from 0.6% in 1999 to 6.1% in 2012.24 In Latin America, a study conducted in Bolivia reported a high rate of CRAB (90%) with a coresistance greater than 80% for all groups of antibiotics.25 In Mexico, a multicenter study reported a prevalence of carbapenem resistance greater than 80%, with an alarming increase in coresistance to cefepime of 83.6%.26 In the pediatric population, a study of 54 cases reported a prevalence of carbapenem resistance of 21%.14

The distribution of the different types of carbapenemase genes has regional variations. In Europe, a multinational study identified an endemic prevalence of blaOXA-23 and blaOXA-72.27 Currently, blaOXA-23 in Brazil comprises up to 97.9% of the isolates compared with 64.4% in Argentina.28–31 In Mexico, according to a multicenter study conducted in the adult population, the most prevalent carbapenemase genes detected were blaOXA-40 (60.4%) and blaOXA-23 (23.2%).7 Another national study reports a high prevalence of blaOXA-72 (49.6%) and blaOXA-58 (28.3%).32

The information available on the molecular characterization of CRAB infections in children is scarce.33–36 Chen et al.12 described the presence of blaOXA-23 in 90.7% of cases, followed by blaOXA-24 (23.3%). Another study exhibits a high prevalence of blaOXA-23 (31%), and blaOXA-58 (11%) in Turkey.20 The presence of the blaOXA-23 gene in children in Latin America was reported in Bolivia, where it was detected in all CRAB cases.26 In Mexico, a study of five patients reported blaOXA-23 in all cases.14 In another study conducted in Mexico, CRAB carried blaOXA-23 in 51.13%. Interestingly, no cases of coharboring genes were reported.36 According to the data reported in our study, all CRAB cases carried blaOXA-24. The antimicrobial resistance genes blaOXA-23 and blaOXA-58 were not detected in our population.

There is a low prevalence of class B carbapenemases genes in CRAB infections.36 Lukovic et al.36 reported a low prevalence of blaNDM (3.2%) in CRAB patients, with a similar prevalence in China (3.49%). In Mexico, Alcántar-Curiel et al.32 reported in adult population a 78.3% prevalence of A. baumannii strains with carbapenemases class B phenotype; however, only blaVIM-1 was detected in 1.2%, whereas the rest corresponded to carbapenemases class D. Interestingly, we report CRAB coharboring blaOXA-24 and blaIMP in half of the patients.

Some limitations of our work were the lack of other sequences for other carbapenemase genes such as blaOXA-72, which has been described in an adult population in Mexico, and our small sample. However, the present study demonstrated a high proportion of neonatal population and a high rate of CRAB coharboring carbapenemase genes. Implementation of antimicrobial stewardship programs is urgent to stop the spread of carbapenem-resistant Acinetobacter baumannii.

ACKNOWLEDGMENT

We thank the Department of Clinical Pathology of the University Hospital “Dr. Jose Eleuterio González” from the Universidad Autónoma de Nuevo León for the processing and identification of the isolates.

REFERENCES

  • 1. De Freitas LC, 2013. Global Priority List of Antibiotic-Resistant Bacteria to Guide Research, Discovery, and Development of New Antibiotics. Vol. 43. Geneva, Switzerland: World Health Organization, 348–365. [Google Scholar]
  • 2. Piperaki ET, Tzouvelekis LS, Miriagou V, Daikos GL, 2019. Carbapenem-resistant Acinetobacter baumannii: in pursuit of an effective treatment. Clin Microbiol Infect 25: 951–957. [DOI] [PubMed] [Google Scholar]
  • 3. Schmid A, Wolfensberger A, Nemeth J, Schreiber PW, Sax H, Kuster SP, 2019. Monotherapy versus combination therapy for multidrug-resistant Gram-negative infections: systematic review and meta-analysis. Sci Rep 9: 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Llaca-Díaz JM, Mendoza-Olazarán S, Camacho-Ortiz A, Flores S, Garza-González E, 2013. One-year surveillance of eskape pathogens in an intensive care unit of Monterrey, Mexico. Chemotherapy 58: 475–481. [DOI] [PubMed] [Google Scholar]
  • 5. Marchaim D, Levit D, Zigron R, Gordon M, Lazarovitch T, Carrico JA, Chalifa-Caspi V, Moran-Gilad J, 2017. Clinical and molecular epidemiology of Acinetobacter baumannii bloodstream infections in an endemic setting. Future Microbiol 12: 271–283. [DOI] [PubMed] [Google Scholar]
  • 6. Morfin-Otero R. et al. , 2013. Acinetobacter baumannii infections in a tertiary care Hospital in Mexico over the past 13 years. Chemotherapy 59: 57–65. [DOI] [PubMed] [Google Scholar]
  • 7. Bocanegra-Ibarias P, Peña-López C, Camacho-Ortiz A, Llaca-Díaz J, Silva-Sánchez J, Barrios H, Garza-Ramos U, Rodríguez-Flores AM, Garza-González E, 2015. Genetic characterisation of drug resistance and clonal dynamics of Acinetobacter baumannii in a hospital setting in Mexico. Int J Antimicrob Agents 45: 309–313. [DOI] [PubMed] [Google Scholar]
  • 8. Mancilla-Rojano J. et al. , 2020. Molecular epidemiology of Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from children at the Hospital Infantil de México Federico Gómez. Front Microbiol 11: 1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Higgins PG, Wisplinghoff H, Krut O, Seifert H, 2007. A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. Clin Microbiol Infect 13: 1199–1201. [DOI] [PubMed] [Google Scholar]
  • 10. Clinical and Laboratory Institute , 2020. Performance Standards for Antimicrobial Susceptibility Testing. 30th ed. Wayne, PA: CLSI. [Google Scholar]
  • 11. Magiorakos A. et al. , 2011. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 18: 268–281. [DOI] [PubMed] [Google Scholar]
  • 12. Chen Y, Ai L, Guo P, Huang H, Wu Z, Liang X, Liao K, 2018. Molecular characterization of multidrug resistant strains of Acinetobacter baumannii isolated from pediatric intensive care unit in a Chinese tertiary hospital. BMC Infect Dis 18: 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lukić-Grlić A, Kos M, Žižek M, Luxner J, Grisold A, Zarfel G, Bendenić B, 2020. Emergence of carbapenem-hydrolyzing oxacillinases in Acinetobacter baumannii in children from Croatia. Chemotherapy 64: 167–172. [DOI] [PubMed] [Google Scholar]
  • 14. Bello-López E. et al. , 2020. Antibiotic resistance mechanisms in Acinetobacter spp. isolated from patients in a pediatric hospital in Mexico. J Glob Antimicrob Resist 23: 120–129. [DOI] [PubMed] [Google Scholar]
  • 15. McGrath EJ, Chopra T, Abdel-Haq N, Preney K, Koo W, Asmar BI, Kaye KS, 2011. An outbreak of carbapenem-resistant Acinetobacter baumanii infection in a neonatal intensive care unit: investigation and control. Infect Control Hosp Epidemiol 32: 34–41. [DOI] [PubMed] [Google Scholar]
  • 16. Gajic I, Jovicevic M, Milic M, Kekic D, Opavski N, Zrnic Z, Dacic S, Pavlovic L, Mijac V, 2021. Clinical and molecular characteristics of OXA-72-producing Acinetobacter baumanii ST636 outbreak at a neonatal intensive care unit in Serbia. J Hosp Infect 112: 54–60. [DOI] [PubMed] [Google Scholar]
  • 17. Thatrimotriachai A, Apisarnthanarak A, Chanvitan P, Janjindamai W, Dissaneevate S, Maneenil G, 2013. Risk factors and outcomes of carbapenem-resistant Acinetobacter baumanii bacteremia in neonatal intensive care unit: a case-case-control study. Pediatr Infect Dis J 32: 140–145. [DOI] [PubMed] [Google Scholar]
  • 18. Karaaslan A, Soysal A, Gelmez A, Kepenekli E, Söyletir G, Bakir M, 2015. Molecular characterization and risk factors for carbapenem-resistant Gram-negative bacilli colonization in children: emergence of NDM-producing Acinetobacter baumannii in a newborn intensive care unit in Turkey. J Hosp Infect 92: 67–72. [DOI] [PubMed] [Google Scholar]
  • 19. Routsi C, Pratikaki M, Platsouka E, Sotiropoulou C, Nanas S, Markaki V, Vrettou C, Paniara O, Giamarellou H, Roussos C, 2010. Carbapenem-resistant versus carbapenem-susceptible Acinetobacter baumannii bacteremia in a Greek intensive care unit: risk factors, clinical features and outcomes. Infection 38: 173–180. [DOI] [PubMed] [Google Scholar]
  • 20. Al Jarousha AM, El Jabda AH, Al Afifi AS, El Quaqa LA, 2009. Nosocomial multidrug-resistant Acinetobacter baumanii in the neonatal intensive care unit in Gaza City, Palestine. Int J Infect Dis 13: 623–628. [DOI] [PubMed] [Google Scholar]
  • 21. Hsu JF, Chu SM, Lien R, Chiu CH, Chiang MC, Fu RH, Lee CW, Huang HR, Tsai MH, 2014. Case–control analysis of endemic Acinetobacter baumannii bacteremia in the neonatal intensive care unit. Am J Infect Control 42: 23–27. [DOI] [PubMed] [Google Scholar]
  • 22. European Centre for Disease Prevention and Control , 2022. Antimicrobial Resistance in the EU/EEA (EARS-Net)—Annual Epidemiological Report 2021. Stockholm, Sweden: ECDC. [Google Scholar]
  • 23. Konca C, Tekin M, Geyik M, 2021. Susceptibility patterns of multidrug-resistant Acinetobacter baumanii. Indian J Pediatr 88: 120–126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Logan L, Gandra S, Trett A, Weinstein R, Laxminarayan R, 2019. Acinetobacter baumannii resistance trends in children in the United States, 1999–2012. J Pediatric Infect Dis Soc 8: 136–142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Cerezales M, Ocampo-Sosa AA, Álvarez Montes L, Díaz Ríos C, Bustamante Z, Santos J, Martínez-Martínez L, Higgins PG, Gallego L, 2018. High prevalence of extensively drug-resistant Acinetobacter baumanii at a children’s hospital in Bolivia. Pediatr Infect Dis J 37: 1118–1123. [DOI] [PubMed] [Google Scholar]
  • 26. Garza-González E. et al. , 2020. The evolution of antimicrobial resistance in Mexico during the last decade: results from the INVIFAR Group. Microb Drug Resist 26: 1372–1382. [DOI] [PubMed] [Google Scholar]
  • 27. Goic-Barisic I. et al. , 2021. Endemicity of OXA-23 and OXA-72 in clinical isolates of Acinetobacter baumannii from three neighbouring countries in southeast Europe. J Appl Genet 62: 353–359. [DOI] [PubMed] [Google Scholar]
  • 28. Neves FC, Clemente WT, Lincopan N, Paião ID, Neves PR, Romanelli RM, Lima SS, Paiva LF, Mourão PH, Nobre-Junior VA, 2016. Clinical and microbiological characteristics of OXA-23- and OXA-143-producing Acinetobacter baumannii in ICU patients at a teaching hospital, Brazil. Braz J Infect Dis 20: 556–563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Henrique Camargo C. et al. Clonal spread of ArmA- and OXA-23-coproducing Acinetobacter baumannii International Clone 2 in Brazil during the first wave of the COVID-19 pandemic. J Med Microbiol 71: 556–563. [DOI] [PubMed] [Google Scholar]
  • 30. Romanin P. et al. , 2019. Multidrug- and extensively drug-resistant Acinetobacter baumannii in a tertiary hospital from Brazil: the importance of carbapenemase encoding genes and epidemic clonal complexes in a 10-year study. Microb Drug Resist 25: 1365–1373. [DOI] [PubMed] [Google Scholar]
  • 31. Merkier AK. et al. , 2008. Polyclonal spread of blaOXA-23 and blaOXA-58 in Acinetobacter baumannii isolates from Argentina. J Infect Dev Ctries 2: 235–240. [DOI] [PubMed] [Google Scholar]
  • 32. Alcántar-Curiel MD. et al. , 2014. Molecular mechanisms associated with nosocomial carbapenem-resistant Acinetobacter baumannii in Mexico. Arch Med Res 45: 553–560. [DOI] [PubMed] [Google Scholar]
  • 33. Hu Z, Wang Z, Liu D, Chen P, Wang H, Chen Y, Zhao X, Shi Y, 2011. Clinical and molecular microbiological characteristics of carbapenem-resistant Acinetobacter baumannii strains in a NICU. Pediatr Int 53: 867–872. [DOI] [PubMed] [Google Scholar]
  • 34. Bello-López E, Castro-Jaimes S, Cevallos MÁ, Rocha-Gracia RDC, Castañeda-Lucio M, Sáenz Y, Torres C, Gutiérrez-Cazares Z, Martínez-Laguna Y, Lozano-Zarain P, 2019. Resistome and a novel blaNDM-1-harboring plasmid of an Acinetobacter haemolyticus strain from a children’s hospital in Puebla, Mexico. Microb Drug Resist 25: 1023–1031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Mancilla-Rojano J. et al. , 2020. Molecular epidemiology of Acinetobacter calcoaceticus–Acinetobacter baumannii complex isolated from children at the Hospital Infantil de México Federico Gómez. Front Microbiol 11: 576673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Lukovic B, Gajic I, Dimkic I, Kekic D, Zornic S, Pozder T, Radisavljevic S, Opavski N, Kojic M, Ranin L, 2020. The first nationwide multicenter study of Acinetobacter baumannii recovered in Serbia: emergence of OXA-72, OXA-23 and NDM-1-producing isolates. Antimicrob Resist Infect Control 9: 101. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The American Journal of Tropical Medicine and Hygiene are provided here courtesy of The American Society of Tropical Medicine and Hygiene

RESOURCES