Skip to main content
BMC Cancer logoLink to BMC Cancer
. 2024 Jan 17;24:98. doi: 10.1186/s12885-023-11687-4

Regulatory function and mechanism research for m6A modification WTAP via SUCLG2-AS1- miR-17-5p-JAK1 axis in AML

Miaomiao Liu 1, Bingxin Yu 2, Yong Tian 3, Fan Li 1,4,5,6,7,
PMCID: PMC10795285  PMID: 38233760

Abstract

Acute myeloid leukemia (AML), characterized by the abnormal accumulation of immature marrow cells in the bone marrow, is a malignant tumor of the blood system. Currently, the pathogenesis of AML is not yet clear. Therefore, this study aims to explore the mechanisms underlying the development of AML. Firstly, we identified a competing endogenous RNA (ceRNA) SUCLG2-AS1-miR-17-5p-JAK1 axis through bioinformatics analysis. Overexpression of SUCLG2-AS1 inhibits proliferation, migration and invasion and promotes apoptosis of AML cells. Secondly, luciferase reporter assay and RIP assay validated that SUCLG2-AS1 functioned as ceRNA for sponging miR-17-5p, further leading to JAK1 underexpression. Additionally, the results of MeRIP-qPCR and m6A RNA methylation quantification indicted that SUCLG2-AS1(lncRNA) had higher levels of m6A RNA methylation compared with controls, and SUCLG2-AS1 is regulated by m6A modification of WTAP in AML cells. WTAP, one of the main regulatory components of m6A methyltransferase complexes, proved to be highly expressed in AML and elevated WTAP is associated with poor prognosis of AML patients. Taken together, the WTAP-SUCLG2-AS1-miR-17-5p-JAK1 axis played essential roles in the process of AML development, which provided a novel therapeutic target for AML.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12885-023-11687-4.

Keywords: AML, lncRNA SUCLG2-AS1, miR-17-5p, WTAP, JAK1

Introduction

Acute myeloid leukemia (AML) is a heterogeneous clonal tumor caused by cumulative genetic aberration [1], characterized by increased proliferation and blocked differentiation of leukemia cells [2]. Current treatments for AML include chemotherapy and hematopoietic stem cell transplantation [3]. Although treatment has improved for some specific subtypes of AML, it is still not ideal for the vast majority of AML patients. Therefore, finding novel treatments that can more effectively target AML remains critical. The occurrence and development of AML is related to many factors, including the genetic abnormalities [4], and the treatment responses and prognosis of AML vary greatly [5]. In recent years, with the development of molecular biology, especially genomics technology and second-generation sequencing technology [6], our understanding of the molecular heterogeneity of genes has been constantly improved. Transcriptome datas are mainly genes expression datas at the RNA level [7], which are mainly used to analyse genes expression and regulation rules at the transcription level. Among them, transcription factors, miRNA, lncRNA and circRNA are all factors influencing genes transcription regulation [810], and they can participate in many important cellular biological processes. These include cell proliferation, cell, differentiation, angiogenesis, apoptosis and immune responses [11]. These transcriptional regulatory molecules play an extremely important role in the development of AML and are an indispensable part of the molecular mechanism of AML.

N6-methyladenosine (m6A) methylation is one of the most common RNA modifications [12], and recent studies have demonstrated that abnormal expression of m6A regulators can influence the development of cancer [13]. M6A modifications regulates cell proliferation and metastasis [14], stem cell differentiation and homeostasis in cancer by influencing cell biological functions, as well as the cleavage, transport, stability and degradation of non-coding RNAs themselves. M6A methyltransferase regulates the function of lncRNAs [15]. For example, XIST (lncRNA, the transcriptional silencing of an X chromosome in female mammals requires XIST recruitment specific proteins to regulate gene silencing) [16] is a target of RBM15/15B-mediated m6A methylation modification. WTAP (m6A methyltransferase) is a protein associated with XIST, and RBM15/15B can, also bind METTL3 through WTAP protein to form m6A methylase complex and act on XIST to affect its function. Some studies suggest that the expression of WTAP in the AML group was significantly higher than that in the healthy control group [17], and the difference was showed statistically significant (P < 0.01). A large amount of evidence indicates that both m6A and lncRNAs play certain roles in the occurrence and development of tumors [18], but how WTAP regulates lncRNAs in AML has not been reported.

Long non-coding RNAs (lncRNAs) are a class of RNA molecules with transcripts over 200-100000nt long that do not encode proteins [19]. LncRNAs are involved in a variety of biological regulation and play an important role in life activities [20]. Recent studies have shown that some specific lncRNAs can modify the epigenetic states of DNA/RNA and histones by recruiting chromatin modification complexes. For example, HOXC gene cluster transcription of lncRNA HOTAIR [21] will collect chromatin modification complex PRC2 and locate it to the HOXD gene cluster site, change the chromatin modification state in this region, and then inhibit HOXD gene expression [22]. Forthermore, lncRNA SUCLG2-AS1 can be used as a prognostic predictor of clear cell renal cell carcinoma [23], with shorter survival time and progression-free survival in patients with low expression. LncRNAs are also directly involved in the post-transcriptional regulation of mRNA [24], including variable shearing, RNA editing, protein translation and transport. LncRNAs also affect the expression of target genes by controlling microRNAs (miRNAs) expression [25]. In some tumor cells and specific tissues, some lncRNAs carry “seed sequences” of certain miRNAs and bind miRNAs like sponges [26], thus preventing miRNAs from binding to their target mRNAs.

In this study, we find WTAP-SUCLG2-AS1-miR-17-5p-JAK1 axis that has an important significance to improve the therapeutic effect of AML. The flow chart of this study is shown in Fig. 1.

Fig. 1.

Fig. 1

Flowchart of this study

Materials and methods

Database download

The RNA-seq datasets of the miRNA expression (dataset GSE142699), mRNA expression, and lncRNA expression (dataset GSE96535) were downloaded from the National Center of Biotechnology Information Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/). Somatic mutation information was obtained from the TCGA database (http://cancergenome.nih.gov/), and datasets were obtained for copy number variant (CNV) assays [27]. The datasets in this study was in Supplementary Table S1.

GEO dataset processing

The original expression matrix was normalized and processed by R [28]. The limma package was used to screen out differentially expressed genes [29]. The GEO query function of the Bioconductor package was employed to download the RNA-seq expression value datasets. We used the “limma” package containing a linear model and empirical Bayes statistics to filter out nonspecific expression data. For mRNAs, lncRNAs and miRNAs, p < 0.05 and |log2 FC|≥1 were considered as the cutoff criteria for differential expression and mRNAs, lncRNAs and miRNAs that met these criteria were clustered following hierarchical clustering analysis with R package “ggplot2” [30].

Prediction of lncRNA-miRNA and miRNA-mRNA interactions

The RNA expression profile data downloaded from the GEO were analysed with the “DESeq2” R package. By setting the |log2 FC|> 1 with an adjusted false discovery rate (FDR) of P < 0.05, the differentially expressed lncRNAs (DElncRNAs), mRNAs (DEmRNAs), and miRNAs (DEmiRNAs) were screened for subsequent analysis.

DElncRNAs, DEmiRNAs, and DEmRNAs were used to construct a regulatory network. The experimental module DIANA-LncBase Version 2 (http://www.microRNA.gr/LncBase) was used for the lncRNA-miRNA predicted interactions. TargetScan (http://www.targetscan.org), miRDB (http://www.mirdb.org/), and DIANA-TarBase Version 8 (http://www.microrna.gr/tarbase) were used for obtaining predicted interactions between DEmiRNAs and DEmRNAs. The predicted interactions between DElncRNAs, DEmiRNAs, and DEmRNAs were used to construct a lncRNA-miRNA-mRNA ceRNA network with Cytoscape Version 3.7.2 [31], showing how lncRNAs can affect the function of miRNAs and act as miRNA sponges to regulate mRNA expression.

Gene Ontology and the Kyoto Encyclopedia of Genes and Genomes pathway

Enrichment analysis

The biological processes in Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways (P < 0.05) were used for the biological functional analysis of DEmRNAs in the ceRNA network. The significant enrichment results were visualized using the ggplot2 R package.

Integration of protein-protein interaction (PPI) network and module analysis

To further investigate the function of DEmRNAs in the ceRNA network at the protein level, the Search Tool for the Retrieval of Interacting Genes (STRING) database was used to construct PPI network [32]. DEmRNAs were mapped to STRING, and the median confidence score was 0.8, the protein interactions were evaluated. Cytoscape version 3.7.2 was used to construct the PPI network, and the plug-in “cytoHubba” was used to analyse the sub-network.

CNV dataset processing

R package “limma” was utilized to perform differential expression analysis of the 23 m6A regulators. The results were assayed using R 3.7.2 and R Bioconductor software. The R package from RCircos was used to map CNVs in the 23 m6A modulators. The waterfall function of the maftools package was employed to present the mutations in patients. Kaplan–Meier curves and log-rank tests were conducted for survival analysis. In all cases, p < 0.05 was considered statistically significant.

Cell culture

The cells used in this study include normal human bone marrow stromal cell line HS-5, and the AML cell lines THP-1 and HL-60. The source of all cell lines used in the study: THP-1 and HS-5 cell lines were frozen stored in pathogenic biology laboratory of Basic Medical College of Jilin University, and HL-60 cell lines was donated by immunology laboratory of Basic Medical College of Jilin University. The cells were cultured in RPMI 1640 (containing 10% fetal bovine serum, 100 g/mL streptomycin and 100 u/mL penicillin) in an incubator at 37 °C and 5% CO2.

RNA extraction and qRT-PCR

With regard to miRNA, according to miRcute miRNA isolation kit from TIANGEN, extracting total RNAs from 1 × 106 cells based on the provided directions, cDNA was then synthesized using the miRcute Plus miRNA First-Strand cDNA Kit, and a miRcute Plus miRNA qPCR Kit (SYBR Green) was employed to conduct real-time PCR. U6 small nuclear RNA was applied as the internal control [33]. The primer sequence of miR-17-5p was designed by Shenggong Company. For mRNA and lncRNA, a total RNA purification kit was used to extract total RNAs from cells, and NovoScript Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) was applied to obtain cDNA. FastStart Universal SYBR Green Master Mix (Rox) was employed to conduct real-time PCR. GAPDH was adopted as the internal control. The primer sequences are detailed below (Table 1).

Table 1.

Real-time quantitative PCR primer sequences used in this study

Primer name Forward (5′ to 3′) Reverse (5′ to 3′)
GAPDH AAGGTGAAGGTCGGAGTCAA AATGAAGGGGTCATTGATGG
SUCLG2-AS1 AGGCTGATGACTTGACTGCAACTAAC CTGGTAAAGTGGATGGCTTCTCTATGG
JAK1 GTCAGCATTAACAAGCAGGACAACAAG CATCTACCAGGGACACAAAGGACAAG
WTAP GCAACACAACCGAAGATGACTTTCC CCTCCTCTGCCAGTTCTCTCCTC
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT

M6A RNA methylation quantification

The m6A RNA Methylation Quantification Kit (A&D Technology) was used to detect total m6A levels of the extracted RNA [34].

Immunofluorescence (IF)

AML cells were fixed, permeabilized, and blocked, and then incubated with anti-WTAP antibody or goat anti-rabbit IgG (H + L) antibody. DAPI was used to stain nuclei. Cells were observed using a confocal microscopy (Nikon, Japan) [35].

RNA immunoprecipitation (RIP) assays

Magna RIP RNA-Binding Protein Immunoprecipitation kit (Millipore) was used [36]. Total RNA was used as an input control. IgG was used as an isotype control. The cells were obtained to carry out RNA immunoprecipitation (RIP) experiments using a m6A antibody (Abcam) or Ago2 antibody (Abcam). RNAs were isolated for qRT-PCR assay.

Gene silencing/overexpression

Small short hair RNA (shRNA) targeting WTAP (sh-WTAP-1, sh-WTAP-2) and its negative control (sh-NC), SUCLG2-AS1 overexpression plasmid (pcDNA3.1 SUCLG2-AS1) and its negative control (pcDNA3.1 vector). JAK1 overexpression plasmid (pcDNA3.1 JAK1) and its negative control (pcDNA3.1 vector). All plasmids including the miR-17-5p inhibitor and miR-17-5p mimics were purchased from PPL Biotechnology Company.

Cell transfection

AML cells were inoculated into 6-well cell culture plates at a concentration of 5 × 105 /mL per well. When the cells growth density reached more than 70%, plasmids were transfected using X-tremeGENE HP DNA transfection kit (Roche) according to the manufacturer’s instructions [37].

CCK-8 assay

CCK-8 reagent (Meilunbio) was used to determine the proliferation of AML cells in each group [38]. The following steps were performed at 24 h, 48 h, 72 h and 96 h after cell transformation: The cells were washed twice with 1×PBS, and then the 10% CCK-8 medium was added to each well in the form of liquid exchange, and incubated for 30 min in the dark; The absorbance at 450 nm was measured with a microplate reader and recorded.

EdU assay

AML cells were treated with 100 µL of EdU solution (20 µM, EdU-488 kit, Meilunbio) in 6-well plates for 2 h at 37 °C with 5% CO2 [39]. After washing, the cells were fixed 4% paraformaldehyde and then 1% Triton 100 for 45 min. Hoechst33342 solution was used to stain the nuclei. The images were collected by fluorescence microscope (Cytation5, BioTek). The cells were counted by ImageJ software, and the green EdU and blue Hoechst images at the same position were merged and analysed.

Dual-luciferase reporter assay

Bioinformatics databases DIANA-lncbase Version 2, miRDB and Annolnc were used to predict the possible binding miRNAs and binding sites of SUCLG2-AS1 and DIANA-Tarbase Version 8, miRDB, Starbase and TargetScan were used to predict the mRNA and binding sites of miR-17-5p. In brief SUCLG2-AS1 (miR-17-5p)-WT, SUCLG2-AS1 (miR-17-5p)-MUT, JAK1-3UTR (miR-17-5p)-WT, JAK1-3UTR (miR-17-5p)-MUT, miR-17-5p mimic and inhibitor were used to cotransfected into 293T cells to measure luciferase activity [40].

Transwell assay

Transwell assays were used to detect the migration and invasion of AML cells [41]. The AML cells were collected 48 h after transfection. Serum-free medium was used to resuspend cells. The cell concentration of each group was adjusted to 1 × 105 cells/mL. 200 µl cell suspension was added to the upper transwell chamber. Then 600 µl complete medium containing 20% fetal bovine serum was added to the lower chamber. After 24 h of culture, cells invaded to the lower surface were fixed with 4% methanol for 15–30 min followed by staining with Giemsa working solution at room temperature for 30 min. Finally, the number of invaded cells was counted under a microscope (Nikon, Japan). For invasion detection, 40 µl of VitroGel 3D-RGD gel solution was used to precoat the upper of the membrane first. The other procedures were similar as above in the migration detection methods.

Western blot analysis

A Column Tissue & Cell Protein Extration Kit was applied to extract the total proteins derived from AML cells, and a BCA Protein Assay Kit (Sigma) was applied to detect the protein concentration. According to the PAGE Gel Quick Preparation Kit, proteins were fractionated by 10% sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS/PAGE). Then we placed the protein into a polyvinylidene fluoride (PVDF) membrane after separation. Primary antibodies were incubated with β-actin, E-cadherin, N-cadherin, JAK1, and WTAP at 4 °C overnight, and all antibodies were purchased from Abcam. Subsequently, blotted membranes were incubated for 1 h with HRP-conjugated secondary antibody at ambient temperature. ECL Substrates (Millipore) were used to visualize the signals.

EMT (epithelial-mesenchymal transition) assay

In the progression of tumor malignancy, epithelial-mesenchymal transition (EMT) plays an extremely important role, not only assisting tumor cells in completing metastasis and invasion, but also enabling tumor cells to escape cell apoptosis induced by certain factors. It is known that E-cadherin expression is decreased and N-cadherin expression is increased as a hallmark change in the EMT process [42]. To verify whether the migration and invasion ability of AML were related to the EMT process, a Western blot analysis was performed to detect the changes in the protein expression levels of E-cadherin and N-cadherin.

Flow cytometry

The cells were collected by centrifugation at 160 × g at 4˚C for 5 min and washed twice with cold PBS after transfection for 48 h. Then 5 µl FITC Annexin V and 5 µl PI Binding Buffer were added to 100 µl cell suspension. A flow cytometer (CytoFLEX, Beckman) was employed to obtain fluorescence signals and ascertain the apoptosis rate. FlowJo software was used to further analyse the detection results.

Statistical analysis

Graphpad Prism 8.0 software was used for statistical analysis and plotting of the experimental data obtained. Each group of experiments was repeated for 3 times, and the data was expressed as mean ± SD. At the same time, Student’s T-test was used for statistical analysis between the two groups. One-way ANOVA was used for comparative analysis between multiple groups, and P < 0.05 was considered statistically significant.

Results

Differentially expressed lncRNAs, miRNAs, and mRNAs

A total of 664 DElncRNAs, 58 DEmiRNAs, and 3700 DEmRNAs were identified in AML patients at |log2 FC| > 1 and an adjusted FDR of P < 0.001. The differential expression of lncRNAs, miRNAs, and mRNAs among the samples is shown by hierarchical clustering (Fig. 2). Figure 2A, B and C were heatmaps of lncRNAs, miRNAs, and mRNAs, and Fig. 2D, E and F were volcano plots of lncRNAs, miRNAs, and mRNAs. The differentially expressed genes of lncRNAs and mRNAs were shown in Supplementary Tables S2 and S3, respectively.

Fig. 2.

Fig. 2

Hierarchical heatmaps and volcano plots presenting differentially expressed lncRNAs, miRNAs, and mRNAs. Left panels, heatmaps for all differentially expressed A lncRNAs, B miRNAs, and C mRNAs in AML; Right panels, volcano plots showing D lncRNAs, E miRNAs, and F mRNAs with fold change ≥ 1 (P < 0.05). Green, downregulated; red, upregulated; black, not differentially expressed. lncRNA: long noncoding RNA; miRNA: microRNA

Screening out key genes from ceRNA network and functional analysis

The lncRNAs and mRNAs targeted by miRNAs were screened based on the interactions between the DElncRNAs, DEmRNAs, and DEmiRNAs described above. Only 51 of 58 DEmiRNAs were predicted to target 57 of the 664 DElncRNAs based on DIANA-LncBase Version 2 experimental module. Using TargetScan, miRDB, and DIANA-TarBase Version 8, the target mRNAs of the 51 selected DEmiRNAs were selected. The predicted mRNAs were then compared with 3700 specific DEmRNAs, and only 37 mRNAs from both groups were targeted by the 51 miRNAs. The representative interactions among lncRNAs, miRNAs, and mRNAs are shown in Tables 2 and 3. Based on the interactions between lncRNA-miRNA and miRNA-mRNA, a lncRNA-miRNA-mRNA ceRNA network was constructed consisting of 57 lncRNAs, 51 miRNAs, and 37 mRNAs with a total of 90 interactions (Fig. 3A).

Table 2.

Representative interactions between the miRNAs and lncRNAs for AML

miRNA lncRNA
hsa-miR-19a-3p PCBP1-AS1,
hsa-miR-106a-5p SUCLG2-AS1
hsa-miR-17-5p SUCLG2-AS1
hsa-miR-32-5p PRKCQ-AS1
hsa-miR-125b-5p AC010096.1
hsa-miR-34a-5p DISC1FP1
hsa-let-7i-5p NEAT1
hsa-miR-495-3p NEAT1
hsa-miR-146a-5p MIR222HG
hsa-miR-22-3p LINC01035
hsa-miR-27b-3p NEAT1
hsa-miR-136-5p LINC01268
hsa-miR-125a-5p LINC00843

Table 3.

Representative interactions between the miRNAs and mRNAs for AML

miRNA mRNA
hsa-miR-19a-3p KCNJ2, GPR137B
hsa-miR-106a-5p ENPP5, ATXN1, AKT3, REEP3, ARHGEF3
hsa-miR-17-5p ENPP5, ATXN1, TXNIP, JAK1
hsa-miR-32-5p RBM47, USP28, DNAJB9
hsa-miR-125b-5p SGPL1
hsa-miR-34a-5p SLC44A2, GREM2
hsa-let-7i-5p LIMD1, BTBD3, CCNJ, QARS, LUC7L3, ABCC5, FNIP1
hsa-miR-495-3p NUFIP2
hsa-miR-146a-5p ABL2
hsa-miR-22-3p MAPK14
hsa-miR-27b-3p STRBP, KHSRP, JMJD1C, HMGB3, RUNX1, CSF1
hsa-miR-136-5p ANKRD11
hsa-miR-125a-5p FUT4

Fig. 3.

Fig. 3

Screening key genes from ceRNA network and functional analysis. A Construction of a lncRNA-miRNA-mRNA ceRNA network for AML. In the ceRNA network, the blue and red nodes show decreased and increased expression of RNAs, respectively, while the colors are related to the absolute value of the fold change. Diamonds represent lncRNAs, ellipses represent miRNAs, rectangles represent mRNAs, and gray edges represent interactions among the lncRNAs-miRNAs and mRNAs. B PPI network of ceRNA network-related DEmRNAs. The nodes denote DEmRNAs (confidence score > 0.4) and the size of the nodes represents the degree of each node. C Top ten genes from the sub-network modularized by the plug-in cytoHubba. D, E Top 20 GO terms (P < 0.05) of the ceRNA-related DEmRNAs, respectively. F, G Top 20 KEGG pathways (P < 0.05) of the ceRNA-related DEmRNAs, respectively. Interactions and overlap among the important KEGG pathways. ceRNA: competing endogenous RNA;GO: Gene Ontology; KEGG: Kyoto Encyclopedia of Genes and Genomes

Based on the STRING database, we built a PPI network with the ceRNA-related DEmRNAs to investigate the function of DEmRNAs at the protein level and filter the functional genes (Fig. 3B). The PPI network consisted of 55 nodes and 112 edges. The plug-in “cytoHubba” was used to analyse the sub-network and mRNAs were chosen for further analysis. The top five mRNAs of MAPK14, JAK1, ARHGEF3, ABL2, and TXNIP were chosen for further analysis from the sub-network (Fig. 3C). The ceRNA regulatory axis (lncRNA-miRNA-mRNA) associated with these mRNAs were LINC01035-hsa-miR-22-3p-MAPK14, SUCLG2-AS1-hsa-miR-17-5p-JAK1, SUCLG2-AS1-hsa-miR-106a-5p- ARHGEF3, MIR222HG-hsa-miR-146a-5p-ABL2, and SUCLG2-AS1-hsa-miR-17-5p- TXNIP.

Since the expression of JAK1 has been reported to be closely related to AML [43], and SUCLG2-AS1 is a relatively important lncRNA among these ceRNA regulatory axes, so SUCLG2-AS1-hsa-miR-17-5p-JAK1 axis was selected among the top important genes for further study.

Using DAVID along with Metascape bioinformatic tools, we performed GO and KEGG pathway analyses with the 37 DEmRNAs. The top 20 GO terms (Fig. 3D, E) and top 20 KEGG pathways (Fig. 3F, G) were chosen for biological function analysis. The biological process of GO terms were “regulation of hemopoiesis” and “regulation of myeloid cell differentiation”. Among these pathways, “Th17 cell differentiation” and the “TNF signaling pathway” have been reported to be correlated with the proliferation, invasion, and metastasis of cancer in patients [44] (Supplementary Table S4).

The expression of significant genes in AML cells by qRT-PCR

To study the role of SUCLG2-AS1, miR-17-5p and JAK1 in AML cells, we analysed the expression of all of the above genes using qRT-PCR. The results showed that SUCLG2-AS1 and JAK1 were downregulated in AML cells compared with normal cells, while miR-17-5p were upregulated in AML cells compared with normal cells (Fig. 4A, B, C). This result is consistent with what bioinformatics predicted, and this result is consistent with the theoretical mechanism of ceRNA.

Fig. 4.

Fig. 4

The expression of key genes by qRT-PCR. A SUCLG2-AS1. B miR-17-5p. C JAK1

Overexpression of SUCLG2-AS1 inhibits proliferation, migration and invasion and promotes apoptosis of AML cells

To assess the impact of SUCLG2-AS1 on AML cells, we transfected THP-1 and HL-60 cells with pcDNA3.1 SUCLG2-AS1 (Supplementary Figure 1) [45] and confirmed the transfection efficiency by qRT-PCR analysis. The results showed that the transfection of SUCLG2-AS1 was successful, and the expression of pcDNA3.1 SUCLG2-AS1 group was significantly higher than that of the nontransfected (pcDNA3.1 Vector)group (Fig. 5A). CCK-8 assays revealed that the proliferation of AML cells transfected with pcDNA3.1 SUCLG2-AS1 was significantly decreased compared to that of the pcDNA3.1 Vector group (Fig. 5B). EdU assay and Transwell assay showed that overexpression of SUCLG2-AS1 inhibits proliferation, migration and invasion in AML cells (Fig. 5C, D). As we all know, downregulated expression of E-cadherin and upregulated expression of N-cadherin are an important marker of EMT. In this study, WB experiment showed upregulated expression of E-cadherin and downregulated expression of N-cadherin in pcDNA3.1 SUCLG2-AS1 group compared to that of the pcDNA3.1 Vector group (Fig. 5E), which is exactly the opposite to the process of EMT, indicating that overexpression of SUCLG2-AS1 inhibits cell invasion and metastasis. In addition, the apoptotic rate of AML cells transfected with pcDNA3.1 SUCLG2-AS1 was increased compared to that of the pcDNA3.1 Vector group (Fig. 5F). Taken together, these findings suggested that overexpression of SUCLG2-AS1 inhibits proliferation, migration and invasion and promotes apoptosis of AML cells.

Fig. 5.

Fig. 5

Overexpression of SUCLG2-AS1 inhibits proliferation, migration and invasion and promotes apoptosis of AML cells. A Validation of SUCLG2-AS1 overexpression in AML cells by qRT-PCR. B The viability was detected after overexpression of SUCLG2-AS1 by CCK-8 assay. C The cell proliferation was detected after overexpression of SUCLG2-AS1 by EdU assay. D Detection of cell migration and invasion after overexpression of SUCLG2-AS1 by Transwell assay. E Detection of cell invasion after overexpression of SUCLG2-AS1 by EMT assay. F Detection of cell apoptosis after overexpression of SUCLG2-AS1 by flow cytometry

SUCLG2-AS1 regulates the occurrence and development of AML through miR-17-5p

Bioinformatics databases Diana-lncbase Version 2, miRDB and Annolnc were used to predict the possible binding miRNAs and binding sites of SUCLG2-AS1.Combined with the lncRNA/miRNA/mRNA coregulatory network of AML constructed in previous studies, we found that SUCLG2-AS1 may bind to miR-17-5p and act as ceRNA. To observe the relationship between SUCLG2-AS1 and miR-17-5p in AML cells, and to study the effect of SUCLG2-AS1 on the expression level of miR-17-5p, AML cells THP-1 and HL-60 were transfected with (a) miR-NC, (b) miR-17-5p inhibitor, (c) miR-17-5p mimics, (d) pcDNA3.1 SUCLG2-AS1 + miR-NC,and (e) pcDNA3.1 SUCLG2-AS1 + miR-17-5p mimics. qRT-PCR analysis suggested that SUCLG2-AS1 overexpression can inhibit the expression of miR-17-5p in AML cells, and there may be an interaction relationship between SUCLG2-AS1 and miR-17-5p (Fig. 6A). To further verify the combination of SUCLG2-AS1 and miR-17-5p, we performed a dual-luciferase reporter assay and RIP assay. A dual-luciferase reporter gene detection experiment markedly confirmed the binding between SUCLG2-AS1 and miR-17-5p (Fig. 6B). According to RIP assays, in AML cells THP-1 and HL-60, Ago2 antibody significantly enriched SUCLG2-AS1 and miR-17-5p compared with the negative control IgG group (Fig. 6C). CCK-8 assays and EdU assay revealed that SUCLG2-AS1 regulates the proliferation of AML cells through miR-17-5p (Fig. 6D, E). Transwell assay showed that SUCLG2-AS1 regulates the migration and invasion of AML cells through miR-17-5p (Fig. 6F). Additionally, flow cytometry assays showed that the apoptotic rate of AML cells was increased by pcDNA3.1 SUCLG2-AS1, and partially reversed through cotransfection with miR-17-5p mimics (Fig. 6G). These results indicated that SUCLG2-AS1 functioned by negatively regulating miR-17-5p expression in AML cells.

Fig. 6.

Fig. 6

SUCLG2-AS1 functioned via negatively regulating miR-17-5p expression in AML cells. A The regulatory function of SUCLG2-AS1 on the expression level of miR-17-5p in AML cells. B The luciferase reporter assay validated the relationships between SUCLG2-AS1 and miR-17-5p. C Ago2 RNA-binding protein immunoprecipitation assay to verify SUCLG2-AS1 binding with miR-17-5p. DE SUCLG2-AS1 can affect the proliferation of AML cells through miR-17-5p by CCK-8 assay and EdU assay. F SUCLG2-AS1 can affect the migration and invasion of AML cells through miR-17-5p by Transwell assay. G SUCLG2-AS1 can regulate the apoptosis of AML cells through miR-17-5p by flow cytometry

SUCLG2-AS1 regulates the expression of JAK1 through competitive binding of miR-17-5p

WB assay validated that the expression of JAK1 was lower in AML cells than that in normal cells (Fig. 7A). According to the dual-luciferase reporter assay, miR-17-5p mimics significantly inhibited the luciferase activity of JAK1-WT compared with the control group JAK1-WT + miR-NC (P < 0.001). miR-17-5p mimics did not significantly inhibit the luciferase activity of JAK1-MUT, suggesting that miR-17-5p could bind to JAK1 through this binding site (Fig. 7B). RIP assays showed that miR-17-5p can achieve complementary pairing binding with JAK1 through RISC, and SUCLG2-AS1 may regulate JAK1 by binding to miR-17-5p (Fig. 7C). To further observe whether miR-17-5p can silence the expression of JAK1 in AML cells, and the regulation of SUCLG2-AS1 on the expression level of JAK1 by binding to miR-17-5p, mRNA and protein expression of JAK1 were detected by qRT-PCR and WB respectively after transfection. Accoding to Fig. 7D and E, the expression levels of JAK1 in THP-1 and HL-60 cells were significantly increased after miR-17-5p knockdown, while they were significantly decreased after miR-17-5p overexpression, suggesting that miR-17-5p can downregulate the expression of JAK1.After SUCLG2-AS1 overexpression, the expression of JAK1 was significantly increased, indicating that SUCLG2-AS1 could upregulate the expression of JAK1. However, after cotransfection of pcDNA3.1 SUCLG2-AS1 and miR-17-5p mimics, the expression of JAK1 in cells could be significantly restored and approached to the normal level, suggesting that miR-17-5p mimics could inhibit the upregulation of JAK1 by SUCLG2-AS1 overexpression. This also suggests that SUCLG2-AS1 regulates the expression of JAK1 through miR-17-5p.

Fig. 7.

Fig. 7

SUCLG2-AS1 regulates the expression of JAK1 through competitive binding of miR-17-5p. A The validation of JAK1 expression in AML cells and normal cells by WB. B The luciferase reporter assay validated the relationships between miR-17-5p and JAK1. C Ago2 RNA-binding protein immunoprecipitation assay to verify miR-17-5p binding with JAK1. D The regulation of SUCLG2-AS1 on the expression level of JAK1 through miR-17-5p in AML cells by qRT-PCR. E The regulation of SUCLG2-AS1 on the expression level of JAK1 through miR-17-5p in AML cells by WB

miR-17-5p regulates the occurrence and development of AML through JAK1

In order to further verify the regulatory effect of miR-17-5p on JAK1, the JAK1 overexpression plasmid pcDNA3.1 JAK1 (Supplementary Figure 2) was constructed using the pcDNA3.1 (+) vector, and transfected into AML cells THP-1 and HL-60. Then the expression of JAK1 was detected by qRT-PCR and WB. Accoding to Fig. 8A and B, compared with the control group, the expression levels of JAK1 mRNA and protein in pcDNA3.1JAK1 cells were significantly increased after transfection, and this phenomenon was significantly reversed after cotransfection with miR-17-5p mimics, which promoted the expression of JAK1 to be close to normal. This further confirmed the negative regulation of miR-17-5p on JAK1 at the posttranscriptional level. CCK-8 and EdU assay revealed that miR-17-5p regulates the proliferation of AML cells through JAK1 (Fig. 8C, D). Transwell assay showed that miR-17-5p regulates the migration and invasion of AML cells through JAK1 (Fig. 8E). As in the previous experiment, the results of apoptosis showed that overexpression of miR-17-5p can inhibit the apoptosis of AML cells, however, after cotransfection of miR-17-5p mimics and PCDNA3.1 JAK1, the apoptosis rate of AML cells was restored to the normal level, suggesting that the regulation process of miR-17-5p on AML cell apoptosis is closely related to JAK1 (Fig. 8F). All quantitative graph of apoptosis results was in Supplementary Figure 3.

Fig. 8.

Fig. 8

miR-17-5p regulates the occurrence and development of AML through JAK1. A The negative regulatory effect of miR-17-5p on JAK1 expression levels in AML cells was detected by qRT-PCR. B The negative regulatory effect of miR-17-5p on JAK1 expression levels in AML cells was detected by WB. C, D SUCLG2-AS1 can affect the proliferation of AML cells through miR-17-5p by CCK-8 assay and EdU assay. E miR-17-5p can affect the migration and invasion of AML cells through JAK1 by Transwell assay. F miR-17-5p can regulate the apoptosis of AML cells through JAK1 by flow cytometry

SUCLG2-AS1 is regulated by m6A modification of WTAP in AML cells

We checked the m6A methylation level of SUCLG2-AS1 in AML cells by MeRIP-qPCR. According to the results, the m6A methylation level was more enriched within SUCLG2-AS1 in THP-1 and HL-60 cells than that in controls (Fig. 9A). As WTAP is a crucial m6A methyltransferase, we then performed shRNA-mediated silencing of WTAP (Fig. 9B) and found that downregulation of WTAP resulted in the decreased m6A levels of both total RNA and SUCLG2-AS1 in THP-1 cells (Fig. 9C, D). Then we explored whether m6A modification could affect SUCLG2-AS1 RNA metabolism and found that knockdown of WTAP led to lower expression of SUCLG2-AS1 in THP-1 cells (Fig. 9E). After new RNA synthesis was blocked with actinomycin D, we measured the loss of SUCLG2-AS1. The results indicated that SUCLG2-AS1 showed lower RNA stability after silencing of WTAP in THP-1 cells (Fig. 9F). It was suggested that the m6A level of SUCLG2-AS1 was higher in AML cells, and its modification in SUCLG2-AS1 improved transcripts stability.

Fig. 9.

Fig. 9

The m6A modification was enriched in SUCLG2-AS1 and improved its transcripts stability. A The m6A methylation level of SUCLG2-AS1 in AML cells and control cells were determined by MeRIP-qPCR. B The knockdown effect of sh-WTAP was verified by Western blot (WB) analysis in THP-1 cells. C m6A methylation level in THP-1 cells after WTAP was knocked down. D Changes in m6A modified SUCLG2-AS1 levels upon WTAP was knockdown in THP-1 cells. E Transcript levels of WTAP and SUCLG2-AS1 in negative control and sh-WTAP THP-1 cells. F Reduction of SUCLG2-AS1 RNA stability in WTAP knockdown THP-1 cells as compared to control. Cells were treated with actinomycin D and RNA was isolated at 0, 2, and 4 h. Data represent the mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001. The experiments were independently repeated at least three times

Elevated WTAP is associated with poor prognosis of AML patients

WTAP is an important m6A methylation modification transferase, some studies confirmed that WTAP methylation modification was closely related to AML [46]. Therefore, we use bioinformatics methods to verify whether m6A methylation modification is associated with AML.

The transcription levels of 23 m6A regulators, which included 13 readers, 8 writers, and 2 erasers, as well as the copy number variations (CNVs) and somatic mutations of these regulators, have been described in a previous study [47]. The chromosomal locations of the amplification mutations were distributed randomly and unequally across the chromosomes, as shown in Fig. 10A. Of the 134 AML samples used in this study, 3 contained mutations related to m6A (2.24% mutation rate). The assay of AML specimens found that only WTAP (1%), RBM15 (1%) and ELAVL1 (1%) showed any mutation frequency, while the other genes did not (Fig. 10B). The differential expression of m6A regulators in normal and tumor samples were shown by hierarchical clustering analysis in Fig. 10C. The m6A regulators of WTAP, RBM15, IGFBP3, and FTO were highly expressed in AML samples compared with normal samples. The m6A regulators of WTAP were the risk genes in AML (Fig. 10D, P < 0.05), and AML patients with high WTAP showed poor overall survival (Fig. 10E). So elevated WTAP is associated with poor prognosis of AML patients.

Fig. 10.

Fig. 10

Overview of m6A gene locus and gene information. A The location of mutations in m6A regulators. B Waterfall plot of m6A regulators mutation genes and mutation types. C Comparison of gene expression levels of 23 regulators between the normal and tumor tissue cohorts. D Landscape and inner crosslink between 23 m6A regulators. E The Kaplan–Meier survival analysis of WTAP. **P < 0.01, ***P < 0.001. m6A, N6-methyladenosine

WTAP and its m6A methylation are significantly increased in AML cells

To investigate the role of WTAP in AML, we first checked the expression of WTAP and its m6A levels in AML (THP-1 and HL-60) cells and control HS-5 cells. The data suggested that AML significantly increased WTAP level compared with that of controls (Fig. 11A). Meanwhile, the m6A level of WTAP was also significantly increased in AML compared with that of controls (Fig. 11B). We also measured the expression of WTAP in AML and control cells by IF. As shown in Fig. 11C and D, AML cells exhibited a significantly higher expression of WTAP. These findings indicate that AML increases WTAP, and this result is consistent with what bioinformatics predicted.

Fig. 11.

Fig. 11

WTAP expression and m6A modification in AML cells. A The expression of WTAP in AML cells and control cells were determined by qRT-PCR. B The m6A level of WTAP in AML cells. CD WTAP expression in AML Cells were stained for WTAP (red), and nuclei were stained with DAPI (blue). Scale bar: 100 μm. *P < 0.05, ***P < 0.001. ns, no significance

Discussion

In recent years, studies have found that the ceRNA mechanism is widely present in various cancers such as gastric cancer [48], colon cancer and bladder cancer, and plays a role in tumor gene regulation and biological processes such as tumor cell proliferation, invasion, metastasis, apoptosis and cell cycle. According to the ceRNA mechanism, lncRNAs regulate miRNAs by binding their target sites on protein-coding mRNA molecules [49]. In this study, we used bioinformatics methods for prediction and analysis and used qRT-PCR to verify these results. The results showed that SUCLG2-AS1 and JAK1 were expressed at low levels, while miR-17-5p was highly expressed in AML cells. This is in accordance with the ceRNA principle.

A large number of studies have reported that lncRNAs can participate in the regulation of malignant tumor progression by affecting the growth and proliferation, migration and invasion of tumor cells and other cell behaviors [50]. In this study, SUCLG2-AS1-overexpressing AML cells were constructed by transfection of the SUCLG2-AS1 overexpression vector, and the changes in malignant characteristics of AML cells after SUCLG2-AS1 overexpression were further observed through various in vitro experiments. In CCK-8 and EdU experiments, the results consistently showed that overexpression of SUCLG2-AS1 could significantly inhibit the proliferation of AML cells. In Transwell cell migration/invasion assay, it was found that SUCLG2-AS1-overexpressing AML cells showed a significant downward trend in migration and invasion, suggesting that SUCLG2-AS1 could inhibit the migration and invasion of AML cells. In addition, by detecting the expression of E-cadherin and N-cadherin proteins in SUCLG2-AS1-overexpressing AML cells, it was observed that SUCLG2-AS1 could affect the EMT process. Since the EMT process is related to tumor invasion and metastasis, we speculated that the effect of SUCLG2-AS1 on the migration and invasion ability of AML cells might be related to the EMT process. During the detection of cell apoptosis, it was found that the apoptosis rate of AML cells overexpressing SUCLG2-AS1 showed an increasing trend, and both the early and late apoptosis rates increased, which also suggested that SUCLG2-AS1 may promote the apoptosis process of AML cells. All the above in vitro experiments suggested that SUCLG2-AS1 could be used as a protective lncRNA to inhibit the malignant biological behavior of AML cells.

In order to further verify the targeted binding relationship between SUCLG2-AS1 and miR-17-5p, we overexpressed SUCLG2-AS1. The results showed that miR-17-5p expression was significantly downregulated after overexpression of SUCLG2-AS1, while SUCLG2-AS1 was not significantly changed after overexpression or knockdown of miR-17-5p. It can be speculated that SUCLG2-AS1 has a certain inhibitory effect on the expression of miR-17-5p in AML cells, and the binding relationship between the two was verified by a luciferase reporter gene assay. We further verified the binding relationship between SUCLG2-AS1 and miR-17-5p through Ago2 RIP experiments, and found that the Ago2 antibody could significantly enrich SUCLG2-AS1 and miR-17-5p simultaneously. Comprehensive analysis showed that SUCLG2-AS1 could bind to miR-17-5p through AGO2-containing RISC, and then play a regulatory role in its target genes. Similarly, we used a luciferase reporter gene assay and an Ago2 RIP experiment to verify the binding relationship between miR-17-5p and JAK1.The results showed that miR-17-5p in AML cells targeted to bind JAK1 and inhibited its expression, and SUCLG2-AS1 interfered with the inhibitory effect of miR-17-5p on JAK1 through competitive binding of miR-17-5p.

An increasing number of studies have found that miR-17-5p is upregulated in a variety of malignant tumors and plays an obvious cancer-promoting role [51], including breast cancer, colon cancer, and thyroid cancer, etc. Moreover, miR-17-5p can bind to a variety of lncRNAs to regulate the biological processes of different tumors [52]. In this study, in order to verify the function of miR-17-5p in AML and whether SUCLG2-AS1 plays a regulatory role in AML cells through miR-17-5p, we conducted a series of experiments for verification. In CCK-8 and EdU experiments, miR-17-5p was consistently found to promote the proliferation of AML cells, and SUCLG2-AS1 was found to regulate the malignant proliferation of AML cells through competitive binding of miR-17-5p. In the Transwell cell migration/invasion assay, it was observed that miR-17-5p overexpression could promote the migration or invasion of AML cells, while cotransfection of miR-17-5p mimics could reverse the inhibitory regulation of SUCLG2-AS1 overexpression on the migration or invasion of AML cells. It is speculated that SUCLG2-AS1 can inhibit the migration and invasion of AML cells by targeting miR-17-5p. In previous studies, we found that SUCLG2-AS1 could affect the EMT process of AML cells. In this chapter, we confirmed the promoting effect of miR-17-5p on the EMT process through Western Blot. It was also confirmed that SUCLG2-AS1 could affect the EMT process through miR-17-5p. At the same time, miR-17-5p was detected to inhibit the apoptosis of AML cells, and the effect of SUCLG2-AS1 on apoptosis was also accomplished through miR-17-5p. Our study further confirmed that miR-17-5p can also act as a cancer-promoting molecule in AML to regulate the malignant progression of AML, and it was also confirmed that SUCLG2-AS1 plays a regulatory function through miR-17-5p. Using the same experimental method, we overexpressed JAK1, and the results confirmed that miR-17-5p can affect the biological processes of AML cells by inhibiting JAK1.

N6-methyladenosine (m6A) modification has attracted increasing attention, especially in human cancer tumorigenesis [53]. Studies have shown that more than 7 000 different mRNAs and more than 300 lncRNAs molecules are m6A methylated [54, 55], meaning that m6A methylation may affect genes expression extensively. Its regulation is coregulated by methyltransferase (METTL3, METTL14, WTAP, etc.)/demethylase (FTO, ALKBH5, etc.) and some RNA-binding proteins (YTHDF1/2/3, ELAVL1, etc.) [56]. Wilms’ tumor 1-associating protein (WTAP) has been shown to regulate recruitment of the m6A methyltransferase complex to mRNA targets [57]. WTAP is considered as a pervasive internal modification of mRNA and plays critical roles in the progression of a variety of human diseases including cancers. Results showed that knocking down WTAP significantly decreased proliferation and increased apoptosis by affecting alternative splicing in AML cells [46]. In this study, it was discovered that m6A methylation was increased within SUCLG2-AS1 in AML cells. Additionally, WTAP regulated the m6A modification in SUCLG2-AS1, thus affecting its RNA stability. It was thus speculated that the enhancement of SUCLG2-AS1 in AML may be attributed to the m6A modification.

However, there are a few limitations of this study. First, the effect of the SUCLG2-AS1- miR-17-5p-JAK1 axis on AML has not been studied at the animal level. Second, further studies of these genes are needed in clinical trials to confirm our conclusions. We will work on them in the future.

Conclusion

Our study indicates that SUCLG2-AS1 is downregulated in AML cells. Overexpression of SUCLG2-AS1 inhibits the proliferation, migration and invasion of AML cells, and promotes the apoptosis of AML cells. MiR-17-5p was highly expressed in AML cells, and JAK1, the target gene of miR-17-5p, was expressed at low levels in AML cells. SUCLG2-AS1 inhibits the silencing effect of miR-17-5p on JAK1 through competitive binding of miR-17-5p, thus playing a regulatory role in the occurrence and development of AML. Meanwhile, SUCLG2-AS1 is regulated by the m6A modification of WTAP. In conclusion, the WTAP-SUCLG2-AS1- miR-17-5p-JAK1 axis may be critical in regulating the development and progression of AML and may be a therapeutic target for intervention in AML.

Supplementary Information

12885_2023_11687_MOESM1_ESM.docx (24.5KB, docx)

Additional file 1: Supplementary Table S1. The datasets in this study.

12885_2023_11687_MOESM2_ESM.docx (109.8KB, docx)

Additional file 2: Supplementary Table S2. The differentially expressed genes of lncRNA.

12885_2023_11687_MOESM3_ESM.docx (512.3KB, docx)

Additional file 3: Supplementary Table S3. The differentially expressed genes of mRNA.

12885_2023_11687_MOESM4_ESM.docx (28KB, docx)

Additional file 4: Supplementary Table S4. GO biological process terms and KEGG enriched pathways for ceRNA network-related DEmRNAs.

12885_2023_11687_MOESM5_ESM.docx (981.3KB, docx)

Additional file 5: Supplementary Figure 1. The overexpression plasmid pcDNA3.1 SUCLG2-AS1. Supplementary Figure 2. The overexpression plasmid pcDNA3.1 JAKI. Supplementary Figure 3. Percentage of apoptotic cells.

Additional file 6. (702.9KB, docx)

Acknowledgements

Not applicable.

Abbreviations

AML

Acute myeloid leukemia

WTAP

Wilms tumor 1-associating protein

m6A

N6-methyladenosine

ceRNA

competing endogenous RNA

lncRNA

Long noncoding RNAs

RIP

RNA Binding Protein Immunoprecipitation

JAK1

a tyrosine protein kinase

SUCLG2-AS1

a long noncoding RNAs

miR−17−5p

a microRNAs

XIST

a long noncoding RNAs

RBM15/15B

RNA binding motif protein 15/15B

METTL3

Methyltransferase Like 3

HOXD

a mRNA

PRC2

Polycomb repressive complex 2

miRNAs

microRNAs

GEO

Gene Expression Omnibus

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

PPI

Integration of protein-protein interaction

STRING

Search Tool for the Retrieval of Interacting Genes

CNV

copy number variant

circRNA

Circular RNA

EMT

epithelial-mesenchymal transition

WB

Western Blot

Authors’ contributions

ML and FL designed the study. ML, YT and BY performed the experiments. ML, YT and FL analyzed the data. YT, BY and FL prepared the figures. ML and YT wrote the manuscript. BY and FL supervised the study. All authors reviewed the manuscript.

Funding

This study received funding from the National Natural Science Foundation of China (Grant No. 31972921, 82171553, 32201234).

This work was supported by the Science and Technology.

Research Project of the Education Department of Jilin Province (JJKH20211161KJ).

Availability of data and materials

All data are fully available without restrictions. Publicly available datasets were analyzed in this study. The following information was supplied regarding data availability:

GEO (http://www.ncbi.nlm.nih.gov/geo/): GSE96535, GSE142699; copy number variant (CNV): https://portal.gdc.cancer.gov/cart.

Declarations

Ethics approval and consent to participate

The experimental materials used in this study were cell lines, and no ethical issues were involved.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Aung MMK, Mills ML, Bittencourt-Silvestre J, Keeshan K. Insights into the molecular profiles of adult and paediatric acute myeloid leukaemia. Mol Oncol. 2021;15:2253–2272. doi: 10.1002/1878-0261.12899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wang XN, Studzinski GP. Activation of extracellular signal-regulated kinases (ERKs) defines the first phase of 1,25-dihydroxyvitamin D-3-induced differentiation of HL60 cells. J Cell Biochem. 2001;80:471–82. https://doi.org/10.1002/1097-4644(20010315)80:4<471::Aid-jcb1001>3.0.Co;2-j. [DOI] [PubMed]
  • 3.Fathi AT, Chen Y-B. Treatment of relapse of acute myeloid leukemia after allogeneic hematopoietic stem cell transplantation. Curr Hematol Malig Rep. 2014;9:186–192. doi: 10.1007/s11899-014-0209-2. [DOI] [PubMed] [Google Scholar]
  • 4.Pedersen-Bjergaard J, Christiansen DH, Desta F, Andersen MK. Alternative genetic pathways and cooperating genetic abnormalities in the pathogenesis of therapy-related myelodysplasia and acute myeloid leukemia. Leukemia. 2006;20:1943–1949. doi: 10.1038/sj.leu.2404381. [DOI] [PubMed] [Google Scholar]
  • 5.Yan H, Wen L, Tan D, Xie P, Pang FM, Zhou HH, Zhang W, Liu ZQ, Tang J, Li X, Chen XP. Association of a cytarabine chemosensitivity related gene expression signature with survival in cytogenetically normal acute myeloid leukemia. Oncotarget. 2017;8:1529–1540. doi: 10.18632/oncotarget.13650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Mertes F, ElSharawy A, Sauer S, van Helvoort JMLM, van der Zaag PJ, Franke A, Nilsson M, Lehrach H, Brookes AJ. Targeted enrichment of genomic DNA regions for next-generation sequencing. Brief Funct Genomics. 2011;10:374–386. doi: 10.1093/bfgp/elr033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zaghlool A, Niazi A, Bjorklund AK, Westholm JO, Ameur A, Feuk L. Characterization of the nuclear and cytosolic transcriptomes in human brain tissue reveals new insights into the subcellular distribution of RNA transcripts. Sci Rep. 2021;11:11. doi: 10.1038/s41598-021-83541-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kong H, Sun ML, Zhang XA, Wang XQ. Crosstalk among circRNA/lncRNA, miRNA, and mRNA in Osteoarthritis. Front Cell Dev Biol. 2021;9. 10.3389/fcell.2021.774370. [DOI] [PMC free article] [PubMed]
  • 9.Leng Y, Wang MZ, Xie KL, Cai Y. Identification of potentially functional circular RNA/long noncoding RNA-MicroRNA-mRNA regulatory networks associated with vascular injury in type 2 diabetes mellitus by integrated microarray analysis. J Diabetes Res. 2023;2023:3720602. doi: 10.1155/2023/3720602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wu YG, Lu XX, Shen B, Zeng Y. The therapeutic potential and role of miRNA, lncRNA, and circRNA in osteoarthritis. Curr Gene Ther. 2019;19:255–263. doi: 10.2174/1566523219666190716092203. [DOI] [PubMed] [Google Scholar]
  • 11.Bai Y, Lu W, Han N, Bian H, Zhu M. Functions of miR126 and innate immune response. Yi Chuan. 2014;36:631–636. doi: 10.3724/sp.J.1005.2014.0631. [DOI] [PubMed] [Google Scholar]
  • 12.Zhou W, Xue P, Yang Y, Xia L, Yu B. Research progress on N6-methyladenosine in the human placenta. J Perinat Med. 2022 doi: 10.1515/jpm-2021-0665. [DOI] [PubMed] [Google Scholar]
  • 13.Yi YC, Chen XY, Zhang J, Zhu JS. Novel insights into the interplay between m6A modification and noncoding RNAs in cancer. Mol Cancer. 2020;19. 10.1186/s12943-020-01233-2. [DOI] [PMC free article] [PubMed]
  • 14.Ma S, Chen C, Ji X, Liu J, Zhou Q, Wang G, Yuan W, Kan Q, Sun Z. The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 2019;12:121. doi: 10.1186/s13045-019-0805-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Qin Y, Li L, Luo E, Hou J, Yan G, Wang D, Qiao Y, Tang C. Role of m6A RNA methylation in cardiovascular disease (review) Int J Mol Med. 2020;46:1958–1972. doi: 10.3892/ijmm.2020.4746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.McHugh CA, Chen CK, Chow A, Surka CF, Tran C, McDonel P, Pandya-Jones A, Blanco M, Burghard C, Moradian A, Sweredoski MJ, Shishkin AA, Su JL, Lander ES, Hess S, Plath K, Guttman M. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 2015;521:232. doi: 10.1038/nature14443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yang LL, Zhao RR, Jiang RY, Liu H, Zhou SY, Gu B, Wu XJ, Wu DP. The expression of WTAP gene in acute myeloid leukemia and its clinical significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2021;29:653–60. doi: 10.19746/j.cnki.issn.1009-2137.2021.03.001. [DOI] [PubMed] [Google Scholar]
  • 18.Yang LR, Lin ZY, Hao QG, Li TT, Zhu Y, Teng ZW, Zhang J. The prognosis biomarkers based on m6A-related lncRNAs for myeloid leukemia patients. Cancer Cell Int. 2022;22:22. doi: 10.1186/s12935-021-02428-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Shi L, Li WL, Zeng HX, Shi Y, Liao XL. Systematic identification and functional analysis of long noncoding RNAs involved in indoxacarb resistance in Spodoptera litura. Insect Sci. 2022 doi: 10.1111/1744-7917.13015. [DOI] [PubMed] [Google Scholar]
  • 20.Wang KX, Chen CB, Wan QX, Zha XF. Long non-coding RNA Bmdsx-AS1 effects on male external genital development in silkworm. Insects. 2022;13:188. doi: 10.3390/insects13020188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li J, Wang J, Zhong Y, Guo R, Chu D, Qiu H, Yuan Z. HOTAIR: a key regulator in gynecologic cancers. Cancer Cell Int. 2017;17:65. doi: 10.1186/s12935-017-0434-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang MH, Zhao L, Wang L, Wen OY, Hu SS, Li WL, Ai ML, Wang YQ, Han Y, Li TT, Ding YQ, Wang S. Nuclear lncRNA HOXD-AS1 suppresses colorectal carcinoma growth and Metastasis via inhibiting HOXD3-induced integrin 3 transcriptional activating and MAPK/AKT signalling. Mol Cancer. 2019;18. 10.1186/s12943-019-0955-9. [DOI] [PMC free article] [PubMed]
  • 23.Yang W, Zhou J, Zhang K, Li L, Xu Y, Ma K, Xie H, Cai L, Gong Y, Gong K. Identification and validation of the clinical roles of the VHL-related LncRNAs in clear cell renal cell carcinoma. J Cancer. 2021;12:2702–2714. doi: 10.7150/jca.55113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhang Q, Yan YF, Lv Q, Li YJ, Wang RR, Sun GB, Pan L, Hu JX, Xie N, Zhang C, Tian BC, Jiao F, Xu S, Wang PY, Xie SY. miR-4293 upregulates lncRNA WFDC21P by suppressing mRNA-decapping enzyme 2 to promote lung carcinoma proliferation. Cell Death Dis. 2021;12:12. doi: 10.1038/s41419-021-04021-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Beer L, Nemec L, Wagner T, Ristl R, Altenburger LM, Ankersmit HJ, Mildner M. Ionizing radiation regulates long non-coding RNAs in human peripheral blood mononuclear cells. J Radiat Res. 2017;58:201–209. doi: 10.1093/jrr/rrw111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Matuszyk J. MALAT1-miRNAs network regulate thymidylate synthase and affect 5FU-based chemotherapy. Mol Med. 2022;28:28. doi: 10.1186/s10020-022-00516-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fang L, Wang K. Identification of copy number variants from SNP arrays using PennCNV. Methods Mol Biol. 2018;1833:1–28. doi: 10.1007/978-1-4939-8666-8_1. [DOI] [PubMed] [Google Scholar]
  • 28.Yoshida M, Kobune M, Miura S, Ibata S, Iyama S, Sato T, Murase K, Takada K, Ono K, Hashimoto A, Tatekoshi A, Kamihara Y, Sugama Y, Kikuchi S, Ikeda H, Horiguchi H, Kawano Y, Miyanishi K, Kuroda H, Maeda M, Kato J. Extracellular vesicle microRNAs from acute myeloid leukemia are involved in the regulation of adherence junction in bone marrow microenvironment. Blood. 2016;128. 10.1182/blood.V128.22.2863.2863.
  • 29.Chen XM, Zhang HM, Yang B, Lu XC, He PF. Analysis of unfavorable prognosis gene markers in patients with acute myeloid leukemia by multiomics. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2019;27:331–8. doi: 10.19746/j.cnki.issn.1009-2137.2019.02.004. [DOI] [PubMed] [Google Scholar]
  • 30.Ito K, Murphy D. Application of ggplot2 to pharmacometric graphics. CPT Pharmacometrics Syst Pharmacol. 2013;2(10):e79. doi: 10.1038/psp.2013.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Abdi S, Zamanian Azodi M, Rezaei-Tavirani M, Razzaghi M, Heidari MH, Akbarzadeh Baghban A. Differentiation of H. Pylori-negative and positive gastric cancer via regulatory network analysis. Gastroenterol Hepatol Bed Bench. 2020;13:161–167. [PMC free article] [PubMed] [Google Scholar]
  • 32.Chen C, Li L, Zhao C, Zhen J, Yan J. Analysis of sepsis-related genes through weighted gene co-expression network. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue. 2021;33:659–64. doi: 10.3760/cma.j.cn121430-20210127-00135. [DOI] [PubMed] [Google Scholar]
  • 33.Jiang DF, Wu X, Sun XY, Tan W, Dai X, Xie YB, Du AS, Zhao QQ. Bone mesenchymal stem cell-derived exosomal microRNA-7-5p inhibits progression of acute myeloid leukemia by targeting OSBPL11. J Nanobiotechnol. 2022;20(1):29. doi: 10.1186/s12951-021-01206-7. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 34.Dang YQ, Xu JJ, Yang Y, Li CL, Zhang Q, Zhou WJ, Zhang L, Ji G. Ling-gui-zhu-gan decoction alleviates hepatic steatosis through SOCS2 modification by N6-methyladenosine. Biomed Pharmacother. 2020;127. 10.1016a./j.bioph2020.109976. [DOI] [PubMed]
  • 35.Nadarajan G, Doyle S. Realistic cross-domain microscopy via conditional generative adversarial networks: converting immunofluorescence to hematoxylin and Eosin, SPIE Conference on medical imaging - digital pathology, Houston, TX. 2020. [Google Scholar]
  • 36.Alspach E, Stewart SA. RNA-binding Protein Immunoprecipitation (RIP) to examine AUF1 binding to Senescence-Associated Secretory Phenotype (SASP) factor mRNA. Bio Protoc. 2015;5(10):e1481. doi: 10.21769/BioProtoc.1481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Dang WQ, Tang H, Cao H, Wang L, Chen TM. Construction of lentivirus-mediated short hairpin RNA targeting human STAT3 gene. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2012;28:1204–1207. [PubMed] [Google Scholar]
  • 38.Liao R, Cao JF. Emodin induces osteosarcoma cell apoptosis by promoting ATM protein cleavage. Trop J Pharm Res. 2023;22:31–36. doi: 10.4314/tjpr.v22i1.5. [DOI] [Google Scholar]
  • 39.Zhao C, Zhang J, Yang ZY, Shi LQ, Liu SL, Pan LJ, Dong P, Zhang Y, Xiang SS, Shu YJ, Mei JW. Ponicidin inhibited gallbladder cancer proliferation and Metastasis by decreasing MAGEB2 expression through FOXO4. Phytomedicine. 2023;114. 10.1016/j.phymed.2023.154785. [DOI] [PubMed]
  • 40.Zhang Q, Lu MY, Wang C, Du J, Zhou PX, Zhao MR. Characterization of estrogen receptor α activities in polychlorinated biphenyls by in vitro dual-luciferase reporter gene assay. Environ Pollut. 2014;189:169–175. doi: 10.1016/j.envpol.2014.03.001. [DOI] [PubMed] [Google Scholar]
  • 41.Zhang Z, Li SY, Zhang LB. LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma. Eur Rev Med Pharmacol Sci. 2018;22:1979–1986. doi: 10.26355/eurrev_201804_14725. [DOI] [PubMed] [Google Scholar]
  • 42.Hong JW, Yu Y, Wang LS, Li Z, Zhang R, Wang Q, Ding Z, Zhang JP, Zhang MR, Xu LC. BMP4 regulates EMT to be involved in non-syndromic cleft lip with or without palate. Cleft Palate Craniofac J. 2022 doi: 10.1177/10556656221105762. [DOI] [PubMed] [Google Scholar]
  • 43.Xiang ZF, Zhao Y, Mitaksov V, Fremont DH, Kasai Y, Molitoris A, Ries RE, Miner TL, McLellan MD, DiPersio JF, Link DC, Payton JE, Graubert T, Watson M, Shannon W, Heath SE, Nagarajan R, Mardis ER, Wilson RK, Ley TJ, Tomasson MH. Identification of somatic JAK1 mutations in patients with acute myeloid leukemia. Blood. 2008;111:4809–4812. doi: 10.1182/blood-2007-05-090308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jiang CX, Qu XY, Ke HH, Gong W, Chen R, Yang WH, Cheng ZP. Association between the HMGB1/TLR4 signaling pathway and the clinicopathological features of ovarian cancer. Mol Med Rep. 2018;18:3093–3098. doi: 10.3892/mmr.2018.9271. [DOI] [PubMed] [Google Scholar]
  • 45.Tang ZL, Zhang K, Lv SC, Xu GW, Zhang JF, Jia HY. LncRNA MEG3 suppresses PI3K/AKT/mTOR signalling pathway to enhance autophagy and inhibit inflammation in TNF-α-treated keratinocytes and psoriatic mice. Cytokine. 2021;148. 10.1016/j.cyto.2021.155657. [DOI] [PubMed]
  • 46.Naren D, Yan TY, Gong YP, Huang JC, Zhang D, Sang LN, Zheng X, Li YR. High Wilms’ Tumor 1 associating protein expression predicts poor prognosis in acute myeloid leukemia and regulates m6a methylation of MYC mRNA. J Cancer Res Clin Oncol. 2021;147:33–47. doi: 10.1007/s00432-020-03373-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Duan Y, Yu C, Yan MP, Ouyang YZ, Ni SJ. m6A regulator-mediated RNA methylation modification patterns regulate the immune microenvironment in osteoarthritis. Front Genet. 2022;13. 10.3389/fgene.2022.921256. [DOI] [PMC free article] [PubMed]
  • 48.Guo LL, Song CH, Wang P, Dai LP, Zhang JY, Wang KJ. Competing endogenous RNA networks and gastric cancer. World J Gastroenterol. 2015;21:11680–11687. doi: 10.3748/wjg.v21.i41.11680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Gu Y, Lin Y, Li M, Zong C, Sun H, Shen Y, Zhu J. An analysis of lncRNA-miRNA-mRNA networks to investigate the effects of HDAC4 inhibition on skeletal muscle atrophy caused by peripheral nerve injury. Ann Transl Med. 2022;10(9):516. doi: 10.21037/atm-21-6512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Liu SS, Zhang JF, Yin LY, Wang XX, Zheng Y, Zhang YJ, Gu JY, Yang L, Yang J, Zheng P, Jiang Y, Shuai L, Cai XW, Wang HZ. The lncRNA RUNX1-IT1 regulates C-FOS transcription by interacting with RUNX1 in the process of pancreatic cancer proliferation, migration and invasion. Cell Death Dis. 2020;11. 10.1038/s41419-020-2617-7. [DOI] [PMC free article] [PubMed]
  • 51.Fang T, Wu Q, Zhou L, Mu S, Fu Q. miR-106b-5p and mir-17-5p suppress osteogenic differentiation by targeting Smad5 and inhibit bone formation. Exp Cell Res. 2016;347:74–82. doi: 10.1016/j.yexcr.2016.07.010. [DOI] [PubMed] [Google Scholar]
  • 52.Soliman RA, Youness RA, Manie TM, Khallaf E, El-Shazly M, Abdelmohsen M, Handoussa H, Gad MZ. Uncoupling tumor necrosis factor-alpha and interleukin-10 at tumor immune microenvironment of breast cancer through miR-17-5p/MALAT-1/H19 circuit. Biocell. 2022;46:769–783. doi: 10.32604/biocell.2022.016636. [DOI] [Google Scholar]
  • 53.Liu F, Su X. Effects of m6A modifications on signaling pathways in human cancer. Oncol Rep. 2021;45. 10.3892/or.2021.7987. [DOI] [PubMed]
  • 54.Teng FZ, Tang WF, Wuniqiemu T, Qin JJ, Zhou YL, Huang X, Wang SY, Zhu XY, Tang Z, Yi L, Wei Y, Dong JC. Methyladenosine methylomic landscape of lung tissues in murine acute allergic asthma. Front Immunol. 2021;12. 10.3389/fimmu.2021.740571. [DOI] [PMC free article] [PubMed]
  • 55.Lan YF, Liu BY, Guo HB. The role of M6A modification in the regulation of tumor-related lncRNAs. Mol Ther Nucleic Acids. 2021;24:768–779. doi: 10.1016/j.omtn.2021.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Zhang BJ, Jiang H, Dong Z, Sun AJ, Ge JB. The critical roles of m6A modification in metabolic abnormality and cardiovascular diseases. Genes Dis. 2021;8:746–758. doi: 10.1016/j.gendis.2020.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Horiuchi K, Kawamura T, Hamakubo T. Wilms’ tumor 1-associating protein complex regulates alternative splicing and polyadenylation at potential G-quadruplex-forming splice site sequences. J Biol Chem. 2021;297:101248. doi: 10.1016/j.jbc.2021.101248. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12885_2023_11687_MOESM1_ESM.docx (24.5KB, docx)

Additional file 1: Supplementary Table S1. The datasets in this study.

12885_2023_11687_MOESM2_ESM.docx (109.8KB, docx)

Additional file 2: Supplementary Table S2. The differentially expressed genes of lncRNA.

12885_2023_11687_MOESM3_ESM.docx (512.3KB, docx)

Additional file 3: Supplementary Table S3. The differentially expressed genes of mRNA.

12885_2023_11687_MOESM4_ESM.docx (28KB, docx)

Additional file 4: Supplementary Table S4. GO biological process terms and KEGG enriched pathways for ceRNA network-related DEmRNAs.

12885_2023_11687_MOESM5_ESM.docx (981.3KB, docx)

Additional file 5: Supplementary Figure 1. The overexpression plasmid pcDNA3.1 SUCLG2-AS1. Supplementary Figure 2. The overexpression plasmid pcDNA3.1 JAKI. Supplementary Figure 3. Percentage of apoptotic cells.

Additional file 6. (702.9KB, docx)

Data Availability Statement

All data are fully available without restrictions. Publicly available datasets were analyzed in this study. The following information was supplied regarding data availability:

GEO (http://www.ncbi.nlm.nih.gov/geo/): GSE96535, GSE142699; copy number variant (CNV): https://portal.gdc.cancer.gov/cart.


Articles from BMC Cancer are provided here courtesy of BMC

RESOURCES