Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Apr 13.
Published in final edited form as: Clin Cancer Res. 2023 Oct 13;29(20):4196–4208. doi: 10.1158/1078-0432.CCR-23-0156

Memory-like differentiation, tumor targeting monoclonal antibodies, and chimeric antigen receptors enhance natural killer cell responses to head and neck cancer

Miriam T Jacobs 1,2, Pamela Wong 1, Alice Y Zhou 1,2, Michelle Becker-Hapak 1, Nancy D Marin 1, Lynne Marsala 1, Mark Foster 1, Jennifer A Foltz 1, Celia C Cubitt 1, Jennifer Tran 1, David A Russler-Germain 1,2, Carly Neal 1, Samantha Kersting-Schadek 1, Lily Chang 1, Timfothy Schappe 1, Patrick Pence 1, Ethan McClain 1, Jose P Zevallos 3, Jason T Rich 2,4, Randal C Paniello 2,4, Ryan S Jackson c 2,4, Patrik Pipkorn 2,4, Douglas R Adkins 1,2, Carl J DeSelm 2,5, Melissa M Berrien-Elliott 1,2, Sidharth V Puram 2,4,6, Todd A Fehniger 1,2,*
PMCID: PMC10796148  NIHMSID: NIHMS1925330  PMID: 37556118

Abstract

Purpose:

Head and neck squamous cell carcinoma (HNSCC) is an aggressive tumor with low response rates to frontline PD-1 blockade. Natural killer (NK) cells are a promising cellular therapy for T cell therapy–refractory cancers, but are frequently dysfunctional in patients with HNSCC. Strategies are needed to enhance NK cell responses against HNSCC. We hypothesized that ML NK cell differentiation, tumor-targeting with cetuximab, and engineering with an anti-EphA2 chimeric antigen receptor (CAR) enhance NK cell responses against HNSCC.

Experimental Design:

We generated ML NK and conventional (c)NK cells from healthy donors then evaluated their ability to produce IFN-γ, TNF, degranulate, and kill HNSCC cell lines and primary HNSCC cells, alone or in combination with cetuximab, in vitro and in vivo using xenograft models. ML and cNK cells were engineered to express anti-EphA2 CAR-CD8A-41BB-CD3z, and functional responses were assessed in vitro against HNSCC cell lines and primary HNSCC tumor cells.

Results:

Human ML NK cells displayed enhanced IFN-γ and TNF production and both short- and long-term killing of HNSCC cell lines and primary targets, compared to cNK cells. These enhanced responses were further improved by cetuximab. Compared to controls, ML NK cells expressing anti-EphA2 CAR had increased IFN-γ and cytotoxicity in response to EphA2+ cell lines and primary HNSCC targets.

Conclusions:

These pre-clinical findings demonstrate that ML differentiation alone or coupled with either cetuximab-directed targeting or EphA2 CAR engineering were effective against HNSCCs and provide the rationale for investigating these combination approaches in early phase clinical trials for HNSCC patients.

INTRODUCTION

Head and neck squamous cell carcinoma (HNSCC) remains a clinical challenge due to high morbidity and mortality rates associated with current standard of care treatments.1,2 The introduction of immune checkpoint blockade (ICB) with antibodies against PD-1 and PDL-1 have significantly improved treatment outcomes in patients with metastatic HNSCC. Despite advances with PD-1 checkpoint blockade, response rates and overall survival remain low at 20% and 13 months respectively,3 highlighting the need to explore alternative and complementary immunotherapies for this disease.

To date most immunotherapies for metastatic HNSCC focus on improving T cell responses.1,2 In contrast, strategies to enhance innate immunity, including NK cells, have not been widely studied. NK cells are cytotoxic innate lymphoid cells that display potent effector responses against a wide variety of pathogen-infected and tumor cells.4 The NK cell responses to a target cell are regulated by the balance of signaling through inhibitory receptors that recognize MHC-I, and activating receptors that recognize stress-induced ligands, with functionality tuned by cytokine receptors.5 NK cells mediate cytotoxic functions against target cells via granules containing perforin and granzymes or via death receptor ligands. NK cells can be directly activated via signaling through CD16, a receptor that crosslinks after binding the Fc region of immunoglobulin (Ig)G bound to target cells. This triggers antibody-dependent cellular cytotoxicity (ADCC), which can be harnessed using therapeutic monoclonal antibodies (mAbs) to trigger killing of tumor cells.6 Activated NK cells can also secrete cytokines (e.g., IFN-γ, TNF) and chemokines (e.g., MIP1α) that modulate the function and trafficking of other immune cells.4 Thus, mechanisms of NK cell recognition of tumor cells are fundamentally distinct from those of T cells. These features allow NK cells to uniquely circumvent immune evasion mechanisms involving reduced MHC-I expression,7 which occurs in 20–70% of HNSCC tumors.8–10

NK cells are frequently deficient or dysfunctional in patients with cancer.11 A prospective study revealed an association between low NK cell function and increased risk of developing cancer.12 HNSCC patients have a lower peripheral blood (PB) NK cell number, compared to healthy donor (HD) controls at all stages of disease.13 Further, low NK-cell numbers correlate with unfavorable outcomes at all HNSCC stages, including shorter survival.9 Nevertheless, there have been limited data reported on HNSCC patient NK cell phenotype compared to age- and sex- matched healthy individuals. HNSCC cancers exhibit one of the highest median NK cell infiltration among any tumor type based on transcriptomic analysis.14 However, small exploratory studies of tumor associated NK cells from HNSCC patients have shown decreased expression of the activating receptors NKG2D, DNAM-1, NKp30, CD16 and 2B4, and higher expression of the inhibitory receptor NKG2A, compared to PB NK cells.13 Other pre-clinical HNSCC models suggest that NK cells differentiate into a hyporesponsive state once they reach the tumor microenvironment.14 Thus, new therapeutic strategies to enhance NK cell responses are needed to improve tumor control.

The paradigm of innate immune memory, also referred to as trained immunity, is a rapidly evolving field. It is now widely recognized that innate immune cells can have enhanced recall responses, which was previously thought to be unique to adaptive T and B lymphocytes. Memory-type NK cells differentiate depending on the initiating stimulus, including viral infections, haptens and combined cytokines.15 Human NK cells activated briefly through IL-12, IL-15, and IL-18 receptors differentiate into ML NK cells that display enhanced functionality including antitumor responses.16 ML NK cells exhibit a variety of attributes that confer superior ability to recognize and control tumor cells including upregulation of activating receptors, the ability to ignore inhibitory signaling through inhibitory killer Ig-like receptors (iKIR), and enhanced persistence in vivo.17–19 ML NK cells have been pre-clinically evaluated in melanoma and ovarian cancer.20,21 Additionally, in a phase 1 study for rel/ref AML patients, ML NK cells safely expand without cytokine release syndrome (CRS) or immune effector cell-associated neurotoxicity syndrome (ICANS), and induced composite complete remission (CR) in 47% of patients,22 making them a promising clinical platform for NK cellular therapy. When combined with hematopoietic cell transplantation, same donor ML NK cells expanded in vivo >1000-fold, persisted for >3 months, and induced composite CRs in 87% of rel/ref AML patients.23 Furthermore, opportunities to improve ML NK cell recognition of tumor targets have been pre-clinically advanced for hematologic malignancies, including enhanced ADCC via CD16a,18,24,25 and engineering with chimeric antigen receptors (CAR).26

Epidermal growth factor receptor (EGFR) is expressed on more than 90% of HNSCC10 and is targeted by the FDA-approved mAb cetuximab,27 with one mechanism of action directing NK cells via ADCC. Another promising drug target is Erythropoietin-producing hepatocellular receptor A2 (EphA2), a surface antigen on solid tumors, and its overexpression causes oncogenesis, epithelial-mesenchymal transition (EMT), angiogenesis, and cell growth.28,29 EphA2 CAR T cell immunotherapy revealed potent responses against EphA2+ solid tumors in vitro and in vivo in pre-clinical models.30 Preliminary results of EphA2 CAR T cells in a phase 1 study in patients with recurrent glioblastoma were recently published, providing proof-of-principle for this CAR target.31

Here, we evaluate ML NK cell differentiation, ADCC targeting of EGFR via cetuximab, and EphA2-CAR engineering as strategies to improve NK cell responses to HNSCC. We hypothesized that the combination of ML NK differentiation alone, or in combination with targeting of EGFR or EphA2, will overcome ineffective NK cell responses against HNSCC tumors in vitro and in vivo. We tested this hypothesis with IL-12, IL-15, and IL-18 to induced ML NK differentiation, EGFR-targeting with cetuximab, and engineering an anti-EphA2 CAR in pre-clinical models, revealing new translational strategies for NK cell therapy of HNSCC.

MATERIALS AND METHODS

Reagents, mice, and patient samples

The following recombinant human (rh) cytokines were used: rhIL-12 (Biolegend), rhIL-18 (Akron), and rhIL-15 (Miltenyi).16 Human HNSCC cell lines UM-SCC1 (Sigma-Aldrich, SCC070; RRID:CVCL_7707), Cal27 (ATCC, CRL-2095; RRID:CVCL_1107), UM-SCC9 (ATCC, CRL-1629; RRID:CVCL_7793) and UM-SCC47 (Sigma-Aldrich, SCC071; RRID:CVCL_7759) were cultured according to ATCC instructions. Cell line verification was performed on all cell lines used in this paper by GRCF DNA services at Johns Hopkins University using STR profiling following ANSI/ATCC ASN-0002–2011, Authentication of Human Cell Lines: Standardization of STR Profiling guidelines. All cell lines were tested to be Mycoplasma free (MycoAlert Plus Mycoplasma Detection Kit, Lonza Rockland, Inc.). EphA2 knock-out cell lines were generated via CRISPR-Cas9 using the Neon Electroporator (EphA2 sgRNA sequence: AGGTGCATCAGAGCCGGCGA) (Synthego).

De-identified HNSCC patient samples were collected on Washington University Institutional Review Board–approved protocol (2021–03013; Table S1). Resected tumor specimens were mechanically and enzymatically digested to prepare single-cell suspensions. NSG (NOD-scid IL-2rgnull; RRID:IMSR JAX:005557) mice (age 6–8 weeks) were obtained from The Jackson Laboratory, bred, and maintained under specific pathogen-free conditions, and used in accordance with our animal protocol approved by the Washington University Institutional Animal Care and Use Committee.

NK cell purification and cell culture

Leukapheresis chambers were obtained from anonymous healthy platelet donors, and NK cells were purified using RosetteSep (StemCell Technologies; ≥95% CD56+CD3−) followed by Ficoll centrifugation. ML NK cells were generated by overnight stimulation with rhIL-12 (10 ng/mL), rhIL-18 (50 ng/mL), and rhIL-15 (50 ng/mL); control NK cells were cultured in low dose IL-15 (1 ng/mL) as previously described.16

NK-cell functional assays and blocking experiments

NK cells were stimulated at indicated time points with HNSCC targets for 6 hours in presence of 1 ng/mL rhIL15. Effector to target (E:T) ratio was 5:1, unless otherwise indicated, with anti-CD107a antibody (Biolegend; RRID:AB_1227509) for 6 hours, with Golgi Plug/Stop present in the last 5 hours. When indicated, NK cells were pre-incubated, IgG1 Isotype control (5μg/mL; BioLegend; RRID:AB_2801451), anti-NKG2D (5μg /mL; BioLegend; RRID:AB_2810480), anti-CD2 (5 μg/mL; BD-Biosciences; RRID:AB_395731) or anti-CD226 (5μg/mL; BioLegend; RRID:AB_1279155) blocking antibodies 30 minutes before incubation with tumor targets. In Cetuximab experiments, tumor cells were pre-incubated with anti-EGFR antibody cetuximab (10μg/mL; Lily) prior to incubation with NK cells. Cells were stained for flow cytometry analysis as described previously.19 Degranulation (CD107a), TNF and IFN-γ were assessed by flow cytometry.16,20,26 Data were acquired on a Gallios flow cytometer (Beckman Coulter) and analyzed using FlowJo software (Tree Star v10.6; RRID:SCR_008520).

NK cell cytotoxicity against HNSCC targets

Cytotoxicity of NK cells was assessed in standard 4-hour 51Cr release assays as described previously.32 Targets were incubated with cetuximab or isotype control mAb for 30 minutes, washed, and then co-cultured with NK cells. Specific killing by NK cells was also evaluated using the IncuCyte® live-cell analysis system. Stably transduced GFP expressing HNSCC were incubated with cetuximab or isotype controls or blocking mAbs for 30 minutes, washed, plated in a 96-well plate, and imaged 2 hours prior to the addition of NK cells as indicated.20 For EphA2 CAR IncuCyte® experiments NK cells were sorted into GFP positive (CAR+) or GFP negative (CAR-) cells prior to culturing with HNSCC cell lines and primary patient samples.

Adoptive transfer of control and ML NK cells into NOD-scid Il2rg null (NSG) mice

NSG mice were irradiated with 250 cGy and i.p. injected with 2.5×105 UM-SCC1 CBR-Luc cells on day 0. On day 3, tumor bearing mice were i.p. injected with 5×106 control or IL-12/15/18 activated NK cells.19 The presence of tumor was confirmed by bioluminescent imaging (BLI) before NK cell injection, and the mice were imaged bi-weekly for the duration of the experiment on the AMI-HT optical imaging system (1–60 seconds exposure, bin8, FOV12 cm, open filter) as described previously.19,24 rhIL2 (50,000 IU) and rhIL15 (10 ng) per mouse were administered i.p 3 times per week to support the survival of transferred NK cells. For long term survival monitoring experiment in 1J, cytokines injections were stopped after day 32. For cetuximab experiments 1 mg/kg of IVIG was given per mouse on day 2 (to block unoccupied Fc receptors in NSG mice). On day 3, 2.5 mg/kg per mouse of cetuximab or rituximab were i.p. injected one hour prior to NK cell injection. 1×106 control or IL-12/15/18 activated NK cells were i.p. injected in tumor-bearing mice. rhIL2 (50,000 IU) per mouse was administered i.p 3 times per week to support the survival of transferred NK cells.

Construction of lentiviral vector and transduction of NK cells

The cassette encoding a single-chain variable fragment targeting CD19 (clone: FMC63) CD8α transmembrane, CD137, and CD3ζ was previously cloned into the MND lentiviral backbone to generate the CD19-CD8a-CD137-CD3ζ (19-CAR) vector.26 EphA2-specific CARs (clone:IgG28) EphA2-CD8a-CD137-CD3ζ were similarly cloned using the same strategy.29 A third-generation packaging system pseudotyped with VSV-G was used to generate lentivirus in 293T cells (RRID:CVCL_0063). The produced lentivirus was used to transduce NK cells by spinfection as previously described.26

Statistical analysis

Differences between groups were assessed using unpaired t test or ANOVA as indicated within each Figure using Prism v9 (RRID:SCR_002798). Linear mixed models were used for repeatedly measured data, followed by Tukey post hoc test for multiple comparisons. p-value < 0.05 was considered significant; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001.

Data Availability

Raw data, cell lines, and constructs generated in this study are available upon request from the corresponding author.

RESULTS

ML NK cells exhibit enhanced functional responses against HNSCC in vitro

We hypothesized that ML NK cells would exhibit enhanced functional responses against HNSCC, compared to conventional NK (cNK) cells. To test this, ML NK cells were generated by overnight IL-12, IL-15 and IL-18 activation (Fig.1A), allowed to differentiate for 7 days in low-dose IL-15 (1 ng/mL), and then stimulated with HNSCC cell lines. cNK cells were maintained in low-dose IL-15 to support survival.16 In response to various HNSCC cell lines used in our study that included both HPV-positive (UM-SCC47) and HPV-negative (UM-SCC1, UM-SCC9, Cal 27) lines, ML NK cells had significantly increased IFN-γ and TNF production, as well as surface CD107a (a surrogate measure of degranulation), compared to cNK cells from the same donors (Fig. 1B–E, Supplementary Fig. S1A–C). ML NK cells demonstrated significantly increased short-term cytotoxicity against HNSCC cell lines compared to cNK cells (Fig. 1F, Supplementary Fig. S1D). The enhanced control of HNSCC cells by ML NK cells was prominent in long-term in vitro tumor killing assays, in which ML NK cell eliminated the tumor targets, while cNK cells only delayed tumor cell outgrowth (Fig. 1G). These results indicate that ML NK cells exhibit an enhanced ability to control HNSCC targets in vitro.

Figure 1. ML NK cells from normal donors exhibit improved ability to control HPV+ and HPV- HNSCC compared to cNK cells.

Figure 1.

Open in a new tab

(A) PB-derived NK cells from HD were activated with IL-12/IL-15/IL-18 or in low dose (LD) IL-15 as control for 16–18 hours (1). Activated NK cells were differentiated into ML NK cells in vitro for 7 days in the presence of low dose IL-15 (2) and restimulated (3). (B) Representative flow cytometry and gating strategy to evaluate cytokine secretion and degranulation (CD107a+) of cNK and ML NK cells stimulated with HNSCC cell line UM-SCC1. Numbers indicate the percentage of positive cells. Summary data of (C) IFN-γ, (D) degranulation (CD107a), and (E) TNF of control (blue) and ML (green) NK cells re-stimulated 6 hours in vitro with UM-SCC1, UM-SCC9, and UM-SCC47 cells at a 5:1 effector to target ratio, n=12; 4 independent experiments. (F) 4-hour 51Cr release assay and (G) 120-hour IncuCyte® assay at 2.5:1 E: T ratio of ML NK cells: UM-SCC1. (H) NSG mice were injected intraperitoneal (i.p) with 2.5 × 105 UM-SCC1 expressing luciferase 3 days before NK-cell injection. On day 3, tumor-bearing mice were injected with 5 × 106 control or ML NK cells (i.p) and the tumor burden was assessed by bioluminescent imaging (BLI) weekly. (I) BLI summary data of tumor burden and (J) survival. n=10–11 mice per group from two independent experiments, black arrow indicates NK cell injection i.p.. Bars represent mean SEM. Statistical significance was determined by Two-way ANOVA test or paired t-test. For (F), n=3; two independent experiments. (G) shows a representative experiment out of three independent experiments.

ML NK cells control HNSCC targets in NSG mice xenografts

Next, human ML NK cells were evaluated for their ability to control HNSCC targets in vivo in immunodeficient NSG mice (Figure 1H). NSG mice were i.p. injected with 2.5×105 UM-SCC1-CBR-luc cells, and 3 days later received a single i.p. injection of 5×106 cNK cells or ML NK cells. rhIL-2 and rhIL-15 were administered to support human NK cell survival.17,19,24 Mice receiving cNK cells failed to control HNSCC tumor burden, compared to control mice not receiving human NK cells (tumor only) (Figure 1I). In contrast, mice treated with a single dose of ML NK cells from the same donors exhibited significantly improved control of HNSCC cells up to Day 14 compared to mice that received cNK cells (Fig. 1I, Supplementary Fig. 1E). Furthermore, we observed improved survival of mice treated with ML NK cells compared to mice treated with cNK cells, with median survival of 78 days and 108 days respectively (Fig. 1J). Similar to the i.p. tumor model, we also observed significantly lower tumor signals from subcutaneous flank tumors that received ML NK cells compared to the tumors that received cNK cells (Supplementary Fig. S1G–H). These data indicate that ML NK cells have improved in vivo control of HNSCC targets.

Enhanced response of ML NK cells against patient-derived primary HNSCC targets are dependent on CD2, NKG2D and DNAM-1

A paucity of information exists as to which NK cell activating receptor-ligand interactions mediate responses against HNSCC targets. To address this, NK cell receptor ligand expression was assessed on primary HNSCC cells and established HNSCC cell lines. Primary HNSCC tumor cells (HSNCC Pt1, HSNCC Pt2) were obtained from primary HNSCC lesions, and IHC staining of cytokeratin 5/6, and p63 confirmed these cells to be HNSCC (Supplementary Fig. S2A). Across primary HNSCC samples, MICA/B (stress-induced ligand for NKG2D), CD58 (ligand for CD2), as well as CD112 and CD155 (ligands for DNAM-1) were highly expressed (Fig. 2A, Supplementary Fig. S2B). Next, to investigate the mechanistic contribution of these receptors to functional NK cell recognition of HNSCC targets, NKG2D, CD2, and DNAM-1 were blocked using mAbs. In the presence of combined blockade of NKG2D, DNAM-1 and CD2, IFN-γ and TNF production from both cNK and ML NK cells significantly diminished (Fig. 2B–E). These differences were not associated with reduced cell viability of cNK or ML NK cells (Supplementary Fig. S3A and B). Furthermore, degranulation was markedly reduced in both cNK cells and ML NK cells when treated with the combination blockades (Fig. 2D). Consistent with this, the sustained in vitro killing of primary HNSCC targets by cNK cells and ML NK cells was also significantly impaired following blockade of these activating receptors (Fig. 2F). Individual blockade of NKG2D, DNAM-1, or CD2 did not substantially impact NK cell cytokine, but there was reduced tumor cell killing (Supplementary Fig. S3C–H). ML NK cells had greater reduction in IFN-γ production and killing compared to cNK cells when treated with the combination antibody blockade, consistent with higher expression of NKG2D, CD2 and DNAM1 by ML NK cells compared to cNK cells (Supplementary Fig. S3I–K).16,19 Together, these results demonstrate the critical role of NKG2D, DNAM-1 and CD2 in the NK recognition of HNSCC, especially the enhanced response of ML NK cells against HNSCC tumor targets.

Figure 2. Enhanced ML NK cell responses are partially dependent on DNAM-1, NKG2D and CD2.

Figure 2.

Open in a new tab

(A) Expression of DNAM-1 ligands (CD155, CD112), NKG2D ligand (MICA/B) and CD2 ligand (CD58) on primary HNSCC tumors. (B-E) cNK and ML NK cells derived from healthy donors (HD) were stimulated for 6 hours with head and neck cell lines or tumor cells with or without αNKG2D (5 μg/ml), αCD2 (5 μg/ml) and αDNAM-1 (5 μg/ml) blocking antibodies or isotype controls. B, Representative flow cytometry dot plots and summary data showing (C) IFN-γ, (D) TNF, and (E) degranulation (CD107a+) by control and ML NK cells after DNAM-1, NKG2D and CD2 blockade. (F) Growth of primary HNSCC tumor cells co-cultured with HD control and ML NK cells at 2.5:1 NK cell: Target cell ratio with or without blocking antibodies measured using IncuCyte®. Error bars represent mean ± SEM. Statistical significance was determined by Two- way ANOVA test. For C-E, n=6; three independent experiments. For F, n=3; two independent experiments.

Cetuximab enhances the ability of ML and cNK cells to respond to HNSCC cell lines in vitro

Cetuximab is an anti-EGFR mAb used for the treating metastatic HNSCC; however, responses to cetuximab when used in the second-line setting are typically of short durations.33,34 Previous studies have shown that cetuximab can enhance NK cell functional responses against HNSCC by providing additional recognition via CD16a.35 Thus, we evaluated the ability of cetuximab to enhance ML NK cells responses against HNSCC. UM-SCC1, UM-SCC9, or UM-SCC47 cells were pre-incubated with cetuximab or IgG1 isotype control prior to incubation with cNK and ML NK cells. Cetuximab significantly increased IFN-γ, TNF, and degranulation in cNK cells compared to isotype control as expected (Fig. 3A). Notably, the best responses were observed in ML NK cells treated with cetuximab (Fig.3A), with significant improvements over cNK cells treated with cetuximab. Additionally, the combination of NK cells and cetuximab resulted in significantly increased cytotoxicity against HNSCC cells in both short-term and long-term killing assays, with ML NK cells demonstrating significantly better killing compared to cNK cells (Fig. 3B and C). Notably, ML NK cells combined with cetuximab eliminated HNSCC tumor targets at low (e.g., 1:1) E:T ratios (Fig. 3C). These results demonstrate that cetuximab can direct and further enhance the ability of ML NK cells to control HNSCC cell line targets in vitro.

Figure 3. Cetuximab enhances the ability of ML NK and cNK cells to control HPV+ and HPV- HNSCC cell lines in vitro.

Figure 3.

Open in a new tab

HD cNK and ML NK cells were stimulated with HNSCC cell lines pre-incubated with IgG1 isotype control or cetuximab antibody. (A) Summary data of IFN-γ, degranulation (CD107a+) and TNF, of cNK (blue) and ML (green) NK cells re-stimulated 6 hours in vitro with UM-SCC1, UM-SCC9, and UM-SCC47 cells with either IgG1 isotype control (-, open) or cetuximab (+, filled). Cell lines were used at a 5:1 E:T ratio. N = 7–12, 4 independent experiments. (B) Short-term killing in 4 hour 51Cr release assay of both cNK and ML NK cells against the UM-SCC47 cell line. N =3, two independent experiments (C) IncuCyte® killing assay of cNK and ML NK cells with IgG1 isotype control or Cetuximab against UM-SCC1; representative experiment out of 3 independent experiments. (D) NK cells derived from HD were pre-activated as indicated in Fig. 1A. Head and neck squamous cell carcinoma cell lines generated from primary tumor tissue were used as target cells for cytokine production, degranulation, and long-term killing assessment. (E) Summary data of IFN-γ, degranulation (CD107a+) and TNF, of control (blue) and ML (green) NK cells re-stimulated 6 hours in vitro with primary HSNCC cells with either IgG1 isotype control (-, open) or cetuximab (+, filled) at a 5:1 E:T ratio. (F-G) IncuCyte® assay at (F)1:1 E:T and (G) 0.5:1 E:T ratio. F and G show a representative experiment out of 3 independent experiments. Error bars represent mean ± SEM. Statistical significance was determined by Two-way ANOVA test.

Cetuximab improves ML NK cell responses against primary HNSCC cells in vitro

We next asked whether cNK and ML NK cell responses against patient-derived primary HNSCC targets could be further enhanced by cetuximab (Fig. 3D). The addition of cetuximab significantly increased IFN-γ, TNF, and degranulation by ML NK cells compared to cNK cells in response to primary HNSCC cells (Fig. 3E). Compared to cNK cells, ML NK cells exhibited enhanced in vitro cytotoxicity against primary HNSCC targets (Fig. 3F). Notably, the improved in vitro control of primary HNSCC by ML NK cells was again evident at the low E:T ratio of 0.5 NK cell to 1 target (Fig. 3G). The ability of ML NK cells to kill primary HNSCC cells was further improved when cetuximab was added to the assay (Fig. 3G). Cetuximab alone did not influence the growth of HNSCC tumor cells in vitro (Supplementary Fig. S4A–C). These data support that the combination of cetuximab and ML differentiation significantly improved the ability of NK cells to control primary HNSCC targets in vitro, especially at lower E:T ratios.

ML NK cells and cetuximab control HNSCC targets in an NSG xenograft model

Next, the combination of human ML NK cells and cetuximab was evaluated for its ability to control HNSCC targets in vivo using a human xenograft model into NSG mice (Fig. 4A). Rituximab (anti-CD20) was used as a control antibody treatment as UM-SCC1 does not express CD20. Mice receiving cNK cells plus cetuximab had similar tumor burden to mice receiving cetuximab alone (Fig. 4B and C). In contrast, mice treated with ML NK cells plus cetuximab exhibited a significantly increased control of HNSCC cells in vivo as measured by bioluminescent imaging (BLI), and this is improved over cetuximab alone and cNK cells plus cetuximab, with low tumor burden over the entire duration of the experiment (Fig. 4B and C). No weight loss was observed in mice treated with Cetuximab or Rituximab (Supplementary Fig. S4D). These data indicate that when combined with cetuximab, a single injection of ML NK cells provided enhanced control of primary HNSCC cells in vivo, compared to cNK cells.

Figure 4. Cetuximab and human ML NK cells effectively control head and neck targets in a xenograft model in NSG mice.

Figure 4.

Open in a new tab

(A) NSG mice were injected with 2.5 × 105 UM-SCC1 HNSCC cells expressing luciferase i.p.. On day 3, tumor-bearing mice were injected i.p. with cetuximab or rituximab (Isotype control) and 1 × 106 cNK or ML NK cells i.p. the tumor burden was assessed using BLI weekly. (B) Representative BLI images. (C) BLI Summary data of tumor burden. n=7–10 mice per group, 2 independent experiments (rituximab only = 10 mice, cetuximab only = 8 mice, cNK cells + cetuximab = 7 mice, and ML NK cells + cetuximab = 8 mice). Bars represent mean ± SEM. Statistical significance calculated by Two-way ANOVA -mixed-effect model with Tukey post-test.

EphA2-CAR-ML NK cells exhibit enhanced functional responses to EphA2+ HNSCC targets

EphA2 is a tumor associated antigen expressed on HNSCC and other solid tumors that has demonstrated potential to be targeted using CAR T cells (Supplementary Fig. S5A and B).30,31 Prior work by our group showed that CD19-CAR ML NK cells exhibit an enhanced response to CD19+ lymphoma, compared to CD19-CAR cNK cells.26 To understand if an EphA2-CAR expression would improve ML NK cell responses against HNSCC targets, we generated EphA2-CAR ML NK cells, utilizing an anti-EphA2 scFv, CD8α transmembrane domain, and CD137 and CD3ζ signaling motifs (Fig. 5A). We observed higher transduction efficiency in ML NK cells compared to cNK cells, and thus in subsequent analyses we flow gate on GFP positive (CAR positive) and GFP negative (CAR negative) cells within cNK and ML NK cells to specifically identify and compare CAR positive or negative NK cells (Supplementary Fig. 5D). EphA2-CAR ML NK cells (GFP positive) exhibited increased IFN-γ production and degranulation against UM-SCC9, UM-SCC47, UM-SCC1, and CAL27, in addition to UD-SCC2 that is otherwise resistant to ML NK cells (Figure 5B–G, Supplementary Figure S6) compared to CAR negative (GFP negative) ML NK cells. To assess how CAR expression affect ML NK cells’ ability to kill HNSCC cells, we utilized sorted GFP+ and GFP- ML NK cells for Incycute assays. EphA2-CAR ML NK cells demonstrated a significantly improved ability to eliminate the UM-SCC9 cell line in sustained in vitro cytotoxicity assays, compared to donor-matched ML NK cells (Fig. 5F). These experiments demonstrate that ML differentiation and CAR engineering can be combined to further enhance effector functions against EphA2+ solid tumor targets.

Figure 5. EphA2-CAR ML NK cells display enhanced functional responses and antigen (ephA2)-specific response against HNSCC tumor cell lines.

Figure 5.

Open in a new tab

(A) Schematic representation of EphA2 CAR construct. P2A indicates the ribosomal P2A skip site. Transmembrane (TM)/hinge: CD8a; costimulatory domain (D1): CD137; and stimulatory domain (D2): CD3z. ITAMs indicated in light blue. (B) Schema of in vitro experiments. Purified NK cells were activated with IL-12, IL-15, and IL-18 or were control treated for 16 hours, washed, and transduced with CAR lentivirus for 2 days. After differentiating for 1 week, CAR ML NK cell functionality was assessed. (C) Representative flow plots of ephA2 CAR (GFP+) cNK or ML NK cells stimulated with UM-SCC9 targets (total NK:Tumor, 5:1) depicting IFN-γ (top) and degranulation (CD107a; bottom). Summary IFN-γ and degranulation (CD107a+) from stimulation with (D) HPV- cell line UM-SCC9 and (E) HPV+ cell line UM-SCC47, cNK cells (blue) EphA2-CAR cNK cells (black), ML NK cells (green), EphA2-CAR-ML NK cells (brown). n=9; 5 independent experiments. (F) IncuCyte® assay at 1:1 E: T of ML NK cells co-cultured with EphA2 expressing UM-SCC9 cells (G-H) EphA2-CAR-ML NK cells were incubated with wild type UM-SCC9 or UM-SCC9 EphA2 knock-out target cells for 6 hours at a 5:1 total NK/Target ratio. Summary data show percentage of (G) IFN-γ and (H) CD107a positive cells. n=8; four independent experiments. Purified NK cells were used for all assays. Statistical significance was calculated by Two-way ANOVA. F shows a representative experiment out of three independent experiments.

EphA2-CAR-ML NK cells exhibit EphA2-specific responses requiring CAR signaling

To determine whether CAR intracellular signaling is required for enhanced antitumor responses, we developed a EphA2-CAR with a truncated cytoplasmic domain that lacks signaling components (Supplementary Fig. S7A). ML NK cells expressing this EphA2-CARtrunc did not demonstrate the enhanced IFN-γ production and degranulation observed in EphA2-CAR ML NK cells against UM-SCC9 (Supplementary Fig. S7B and C). Next, the specificity of EphA2-CAR ML NK cells for EphA2 was investigated using wildtype (WT) UM-SCC9 or EphA2 knock-out (KO) UM-SCC9 cells (Supplementary Fig. S7D). EphA2-CAR ML NK cells exhibited a significant increase in IFN-γ production and degranulation against WT UM-SCC9 targets, but these enhanced responses were not observed against EphA2 KO UM-SCC9 targets (Fig. 5G and H). This finding was also confirmed with EphA2 negative lymphoma cell line Raji (Supplementary Fig. S7E and F). CD19-CAR ML NK cells did not have enhanced responses to UM-SCC9 targets (EphA2+, CD19-) compared to ML NK cells without CAR (Supplementary Fig. S7I–J). Furthermore, compared to ML NK cells without CAR, EphA2-CAR ML NK cells but not CD19-CAR ML NK cells exhibited enhanced killing of UM-SCC9, even at low CAR+ E:T ratios of 1:1 (Supplementary Fig. S7K). Together, these data demonstrate that the enhanced response by EphA2-CAR ML NK cells were CAR antigen specific and required intracellular CAR signaling.

EphA2-CAR ML NK cells have enhanced responses against patient primary HNSCC cells

Next, we investigated the functionality of EphA2-CAR ML NK cells against primary HNSCC cells. The two primary HNSCC samples in our study both had high EphA2 expression (Fig. 6A). EphA2-CAR ML NK cells have significantly increased IFN-γ production and degranulation against primary patient HNSCC cells, compared with CAR-negative ML NK cells from the same donor (Fig. 6B and C, Supplementary Fig. S7L). This enhanced response was abrogated in EphA2-CARtrunc ML NK cells (Fig. 6D). EphA2-CAR ML NK cells have significantly improved killing compared with CAR-negative ML NK cells in sustained in vitro cytotoxicity assay against primary HNSCC cells (Fig. 6E). These EphA2-CAR ML NK cell responses against primary HNSCC also required intact CAR intracellular signaling and are CAR target specific (Supplementary Fig. S7M). Thus, engineering with an EphA2-CAR provides a potent activating signal to ML NK cells to specifically attack primary HNSCC targets.

Figure 6. EphA2-CAR ML NK cells are effective at controlling primary HNSCC cells in vitro.

Figure 6.

Open in a new tab

(A) Expression of the tumor antigen EphA2 on primary HNSCC tumors. ML NK cells (green) or EphA2-CAR-ML NK cells (brown) from normal donors were incubated with primary HNSCC tumor cells for 6 hours at a 5:1 total NK/Target ratio. (B-C) Summary data of IFN-γ and degranulation (CD107a+) for ML NK cells (green) compared to EphA2-CAR-ML NK cells (brown). n=10; 3 independent experiments. (D) Summary data of IFN-γ and degranulation for EphA2-CAR ML NK cells compared to EphA2-CAR with truncated intracellular signaling domain (EphA2-CARtrunc ML NK cells). n=5; 3 independent experiments. (E) EphA2-CAR-ML NK cells control tumor growth at low E:T ratio of 0.5:1 in IncuCyte® assay. Error bars represent SEM. Statistical significance calculated by Two-way ANOVA Test. E shows a representative experiment out of three independent experiments.

DISCUSSION

Here, we discovered that ML NK cells exhibit enhanced in vitro and in vivo effector functions against primary HNSCC targets, compared to cNK cells. NKG2D, DNAM-1, and CD2 were identified as key activating receptors responsible for recognition of HNSCC by both cNK and ML NK cells. Moreover, directing cNK and ML NK cells with cetuximab further improved NK cell functional responses against HNSCC, with the combination of cetuximab and ML NK cells consistently demonstrating the most robust responses. We also engineered ML NK cells to express an anti-EphA2 CAR to enhance recognition of HNSCC. ML differentiation and CAR expression combined (EphA2-CAR ML NK cells) yielded enhanced IFN-γ production and cytotoxicity against HNSCC targets compared to EphA2-CAR cNK cells and ML NK cells without CAR expression. Thus, this study reports three highly translational and complementary approaches that are amenable to combinatorial testing: ML differentiation, EGFR-targeting with cetuximab, and anti-EphA2 CAR engineering to improve NK cell responses against HNSCC. These approaches warrant clinical investigation.

The findings here are promising approaches to address unmet clinical needs in HNSCC patients. ICB therapy targeting PD-1 as a monotherapy or combined with chemotherapy has led to improved clinical responses in patients with metastatic HNSCC and is currently first-line standard of care treatment for patients with metastatic HNSCC.3 However, over 80% of metastatic HNSCC patients treated with ICB will not respond to treatment, and almost all patients who have an initial response progress within one year of treatment.3 A major ICB resistance mechanism is the downregulation of MHC-I antigen presentation pathways leading to evasion of cytotoxic T-cell antigen specific immune responses.36 This loss of MHC-I expression along with stress-induced ligands allow NK cells to recognize and exert their cytotoxic and immunomodulatory functions against the tumor cells, and thus NK cells are an alternative approach to T cell-based immunotherapies.37 However, previous studies have demonstrated that NK cell numbers and functionality are decreased in HNSCC patients in advanced clinical stages and as disease progresses.9 This is due to downregulation of NK cell activating receptors, upregulation of inhibitory receptors, and inhibition through circulating soluble NKG2D ligands.13,14 We reasoned that ML NK cells can overcome these barriers as they have increased activating receptor expression (NKG2D, NKp46, DNAM-1),16,19 the ability to ignore signals via iKIRs,19 and potent in vitro Fc-triggered responses.18,24 Previous studies have shown that ML NK cells have improved cytotoxicity and cytokine production against human melanoma20 and ovarian21 cancers. Pre-clinical syngeneic mouse models revealed increased trafficking and persistence within solid tumors by ML NK cells compared to cNK cells.38 Studies have also demonstrated ML NK cells have improved metabolic fitness,24,39 and emerging data suggests that this translates into function in the challenging solid tumor microenvironments.40 These reports support the translation of ML NK cells as therapy for HNSCC patients. In this study, we advance the field by demonstrating that ML NK cells have improved responses against HPV+ and HPV- HNSCC cell lines and primary HNSCC cells. We further identified NKG2D, DNAM-1, and CD2 as key activating receptors involved, consistent with the findings that their respective ligands MICA/B, CD112, CD155 and CD58 are upregulated on the majority of HNSCC cell lines and primary patient samples assessed.

The use of mAbs to enhance the cytotoxicity of NK cells through ADCC killing has been investigated clinically across multiple cancers. Cetuximab is a mAb that recognizes EGFR expressed on tumor cells (>90% of HNSCCs are EGFR+41) and is used clinically in HNSCC and colorectal cancer.2 Cetuximab has demonstrated modest clinical activity as a monotherapy, with response rates of 13%, and a PFS of 2–3 months34. Similarly, cetuximab combined with chemotherapy yields modest response rates of 36% and median PFS of 5.6 months.33 These relatively low responses are likely in part due to compromised Fc-bearing cells (NK cells and monocytes/macrophages) within HNSCC and downregulation of CD16 expression, which has been reported in patients across multiple cancers.42 Prior reports established that ML NK cells have enhanced in vitro IFN-γ responses to CD16a triggering, as well as enhanced antibody-dependent cellular cytotoxicity in vitro, suggesting that memory-like NK cells will be effective responders to antibody-opsonized targets.24,25,43 To circumvent issues with impaired NK cell functionality, we evaluated the ability of allogenic ML NK cells from HD combined with cetuximab to enhance functionally of NK cells against HNSCC cells. We demonstrate that cetuximab improved cytotoxicity and cytokine production of both cNK and ML NK cells against HNSCC targets both in vitro and in vivo. ML NK cells when combined with cetuximab offer superior ADCC against HNSCC tumor bearing hosts compared to cNK cells, which could serve as additional mechanism for overcoming the sub-optimal ADCC seen in HNSCC patients.

The solid tumor associated antigen EphA2, is a receptor tyrosine kinase that is expressed at relatively low levels on healthy tissues but is over-expressed on many solid tumors.44 EphA2 CAR T cells have been tested in pre-clinical osteosarcoma and glioblastoma models,45 and are currently in early phase clinical development for glioblastoma.31 Early reports in glioblastoma patients showed that EphA2 CAR T cells administered intravenously expanded and trafficked to the brain and CSF, but no clinical responses were reported and 2 out of 3 patients developed grade 2 CRS.31 CAR-engineered NK cells offer several advantages over CAR T cells. CAR NK cells may abrogate issues with CAR antigen escape often seen in CAR T cell therapy as NK cells can engage tumors through their natural cytotoxicity receptors (NCR) and are amendable to combination therapy with tumor targeting mAbs. Additionally, CD16 expression on mature NK cells allows for flexible dual-targeting strategies with therapeutic monoclonal antibodies or bispecific antibodies that ligate CD16 and a tumor-restricted antigen. CAR NK cells and ML NK cells have also demonstrated reduced risks of GvHD, CRS, ICANS and prolonged cytopenias, clinically.22,23,46,47 Our group previously developed a rapid process to engineer CD19-CAR ML NK cells for B cell malignancies.26 Building on this concept, we broaden this finding to solid tumors with EphA2-targeting CAR ML NK cells, and show that EphA2-CAR ML NK cells have enhanced responses against HNSCC, compared to EphA2-CAR cNK cells and ML NK cells without CAR, that are specific to EphA2+ tumor targets.

Similar to all pre-clinical models our study has limitations. NSG xenografts test the activity of ML NK cells in relative isolation, and cannot recapitulate the immune cell interactions in the tumor microenvironment. Ideally these approaches would be complemented by syngeneic mouse models in immunocompetent mice. However, HNSCC syngeneic tumor models are lacking, with current models using carcinogens to induce oral cavity cancers in mice or genetically engineered mouse models.48 The extensive prior work evaluating ML NK cells against other cancer types in vitro and in vivo,16,19,20,24–26,38,43 and within clinical trials,19,22,23,47,49,50 mitigates these limitations as solid tumor clinical studies are designed and implemented.

In summary, ML NK cells exhibit enhanced ability to control HNSCC targets in vivo and in vitro, which is further improved with the addition of cetuximab or engineering with EphA2 CAR. Importantly, we demonstrate multiple approaches to improve NK cell functioning against primary HNSCC targets. This provides a rational for the use of ML NK cells in combination with cetuximab or EphA2 CAR as an alternative cellular therapy to treat patients with advanced HNSCC. These NK cell therapy approaches warrant clinical testing in early phase clinical trials, with the potential of future combinations including dual targeting with EphA2 CAR ML NK cells and cetuximab.

Supplementary Material

1
2
3
4
5
6
7
8

Translational Relevance.

NK cell-based therapies may offer an alternative treatment option for patients with HNSCC that are refractory to PD-1 blockade. NK cells in patients with advanced HNSCC are dysfunctional with reduced numbers, altered activating and inhibitory receptor expression, and impaired cytotoxicity. Thus, mechanisms to enhance NK cell recognition and functionality in HNSCC are necessary to develop robust NK cell immunotherapies for this disease. This pre-clinical study demonstrated enhanced responses by cytokine-induced memory-like (ML) NK cells against primary HNSCC cells and HNSCC cell lines in vitro and in vivo using NSG xenograft models. Responses were multi-functional and included enhanced pro-inflammatory cytokine production (IFN-γ, TNF), as well as augmented degranulation and cytotoxicity. ML NK cells in combination with cetuximab or anti-EphA2 CAR significantly improved NK cell attack against HNSCC. These data establish the rationale for early phase clinical testing of ML NK cellular therapy combined with cetuximab or anti-EphA2 CAR for patients with advanced HNSCC.

Acknowledgments

The authors thank our patient volunteers and the head and neck cancer physician, nursing, and research assistant teams who care for them at the Washington University School of Medicine. We acknowledge support from the Siteman Flow Cytometry Core, and Siteman Tissue Procurement Core. We thank the Genome Engineering and iPSC Center (GEiC) at the Washington University in St. Louis for their gRNA validation services.

The research reported in this publication was supported by grants from the NIH National Cancer Institute K12CA167540 (M.T. Jacobs), P50CA171963 (T.A. Fehniger, M.M. Berrien-Elliott), R01CA205239 (T.A. Fehniger), P30CA91842 (T.A. Fehniger), 1K08CA237732 (S.V. Puram). National Institute of General Medical Sciences T32GM139799 (J.A. Foltz), 1F31GM146361–01 (J. Tran). NIH National Institute of Allergy and Infectious Disease F30AI161318 (C.C. Cubitt). NIH National Heart, Lung, and Blood Institute T32 HL007088 (P. Wong). NIH National Institute of Dental and Craniofacial Research 5DP5OD026427 (C.J. DeSelm). Additional support was provided by the Siteman Cancer Center (T.A. Fehniger), the ASCO Young Investigator Award via Conquer Cancer Foundation (M.T. Jacobs, D.A. Russler-Germain), Dean’s Scholars award from the Washington University Division of Physician-Scientists, which is funded by a Burroughs Wellcome Fund Physician-Scientist Institutional award (M.T. Jacobs), the Paula C and Rodger O. Riney Blood Cancer Initiative (T.A. Fehniger), the Lymphoma Research Foundation (T.A. Fehniger, D. A. Russler-Germain). Barnes Jewish Hospital Foundation (S.V. Puram) and Doris Duke Fund to Retain Clinician Scientists and Clinician Scientist Development Award (S.V. Puram).

Footnotes

Conflict of Interest

MMBE, TAF have equity, consulting, licensed patents with potential future royalties in Wugen Inc. TAF serves on the SAB of Wugen, Indapta Therapeutics, Orca Bio, and Affimed, and has research funding from HCW Biologics, Affimed, Wugen. TAF is an advisor for AI Proteins, Smart Immune.

The remaining authors declare no potential conflicts of interest related to this work.

REFERENCES

  • 1.Cohen EEW, Bell RB, Bifulco CB, et al. The Society for Immunotherapy of Cancer consensus statement on immunotherapy for the treatment of squamous cell carcinoma of the head and neck (HNSCC). J. Immunother. Cancer. 2019;7(1):184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chow LQM. Head and neck cancer. N. Engl. J. Med 2020;382:60–72. [DOI] [PubMed] [Google Scholar]
  • 3.Burtness B, Harrington KJ, Greil R, et al. Pembrolizumab alone or with chemotherapy versus cetuximab with chemotherapy for recurrent or metastatic squamous cell carcinoma of the head and neck (KEYNOTE-048): a randomised, open-label, phase 3 study. Lancet. 2019;394(10212):1915–1928. [DOI] [PubMed] [Google Scholar]
  • 4.Caligiuri MA. Human natural killer cells. Blood. 2008;112(3):461–469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lanier LL. Up on the tightrope: natural killer cell activation and inhibition. Nat. Immunol 2008;9(5):495–502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ochoa MC, Minute L, Rodriguez I, et al. Antibody-dependent cell cytotoxicity: Immunotherapy strategies enhancing effector NK cells. Immunol. Cell Biol 2017;95(4):347–355. [DOI] [PubMed] [Google Scholar]
  • 7.Ferris RL, Hunt JL, Ferrone S. Human leukocyte antigen (HLA) class I defects in head and neck cancer. Immunol. Res 2005;33(2):113–133. [DOI] [PubMed] [Google Scholar]
  • 8.Näsman A, Andersson E, Marklund L, et al. HLA class I and II expression in oropharyngeal squamous cell carcinoma in relation to tumor HPV status and clinical outcome. PLoS One. 2013;8(10):e77025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wulff S, Pries R, Börngen K, Trenkle T, Wollenberg B. Decreased levels of circulating regulatory NK cells in patients with head and neck cancer throughout all tumor stages. Anticancer Res. 2009;29(8):3053–7. [PubMed] [Google Scholar]
  • 10.The Cancer Genome Atlas Research Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature. 2015;517(7536):576–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chiossone L, Dumas PY, Vienne M, Vivier E. Natural killer cells and other innate lymphoid cells in cancer. Nat. Rev. Immunol 2018;18(11):671–688. [DOI] [PubMed] [Google Scholar]
  • 12.Imai K, Matsuyama S, Miyake S, et al. Natural cytotoxic activity of peripheral-blood lymphocytes and cancer incidence: an 11-year follow-up study of a general population. Lancet. 2000;356(9244):1795–9. [DOI] [PubMed] [Google Scholar]
  • 13.Korrer MJ, Kim Y. Natural Killer cells from primary human head and neck squamous cell carcinomas upregulate NKG2 A. J. Immunol 2017;198(1 Supplement):130.18–130.18. [Google Scholar]
  • 14.Moreno-Nieves UY, Tay JK, Saumyaa S, et al. Landscape of innate lymphoid cells in human head and neck cancer reveals divergent NK cell states in the tumor microenvironment. Proc. Natl. Acad. Sci 2021;118(28):. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Min-Oo G, Kamimura Y, Hendricks DW, Nabekura T, Lanier LL. Natural killer cells: walking three paths down memory lane. Trends Immunol. 2013;34(6):251–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Romee R, Schneider SE, Leong JW, et al. Cytokine activation induces human memory-like NK cells. Blood. 2012;120(24):4751–4760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Leong JW, Chase JM, Romee R, et al. Preactivation with IL-12, IL-15, and IL-18 induces CD25 and a functional high-affinity IL-2 receptor on human cytokine-induced memory-like natural killer cells. Biol Blood Marrow Transpl. 2014;20(4):463–473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wagner JA, Berrien-Elliott MM, Rosario M, et al. Cytokine-Induced Memory-Like Differentiation Enhances Unlicensed NK Cell Anti-Leukemia and FcγRIIIa-Triggered Responses. Biol. Blood Marrow Transplant. 2016;23(3):398–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Romee R, Rosario M, Berrien-Elliott MM, et al. Cytokine-induced memory-like natural killer cells exhibit enhanced responses against myeloid leukemia. Sci. Transl. Med 2016;8(357):357ra123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Marin ND, Krasnick BA, Becker-Hapak M, et al. Memory-like Differentiation Enhances NK Cell Responses to Melanoma. Clin. Cancer Res 2021;27(17):4859–4869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Uppendahl LD, Felices M, Bendzick L, et al. Cytokine-induced memory-like natural killer cells have enhanced function, proliferation, and in vivo expansion against ovarian cancer cells. Gynecol Oncol. 2019;153(1):149–157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Berrien-Elliott MM, Cashen AF, Cubitt CC, et al. Multidimensional Analyses of Donor Memory-Like NK Cells Reveal New Associations with Response after Adoptive Immunotherapy for Leukemia. Cancer Discov. 2020;10(12):1854–1871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Berrien-Elliott MM, Foltz JA, Russler-Germain DA, et al. Hematopoietic Cell Transplantation Donor-derived Memory-Like NK Cells Functionally Persist after Transfer into Patients with Leukemia. Sci. Transl. Med 2022;14(633):eabm1375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Becker-Hapak MK, Shrestha N, McClain E, et al. A Fusion Protein Complex that Combines IL-12, IL-15, and IL-18 Signaling to Induce Memory-Like NK Cells for Cancer Immunotherapy. Cancer Immunol. Res 2021;9(9):1071–1087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kerbauy LN, Marin ND, Kaplan M, et al. Combining AFM13, a bispecific CD30/CD16 antibody, with cytokine-activated cord blood-derived NK cells facilitates CAR-like responses against CD30+ malignancies. Clin. Cancer Res 2021;27(13):3744–3756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gang M, Marin NDD, Wong P, et al. CAR-modified memory-like NK cells exhibit potent responses to NK-resistant lymphomas. Blood. 2020;136(20):2308–2318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kalyankrishna S, Grandis JR. Epidermal Growth Factor Receptor Biology in Head and Neck Cancer. J. Clin. Oncol 2006;24(17):2666–2672. [DOI] [PubMed] [Google Scholar]
  • 28.Miao H, Gale NW, Guo H, et al. EphA2 promotes infiltrative invasion of glioma stem cells in vivo through cross-talk with Akt and regulates stem cell properties. Oncogene. 2015;34(5):558–567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ansuini H, Meola A, Gunes Z, et al. Anti-EphA2 Antibodies with Distinct In Vitro Properties Have Equal In Vivo Efficacy in Pancreatic Cancer. J Oncol. 2009;2009:951917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chow KK, Naik S, Kakarla S, et al. T Cells Redirected to EphA2 for the Immunotherapy of Glioblastoma. Mol. Ther 2013;21(3):629–637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lin Q, Ba T, Ho J, et al. First-in-Human Trial of EphA2-Redirected CAR T-Cells in Patients With Recurrent Glioblastoma: A Preliminary Report of Three Cases at the Starting Dose. Front. Oncol 2021;11(June):1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Fehniger TA, Cai SF, Cao X, et al. Acquisition of murine NK cell cytotoxicity requires the translation of a pre-existing pool of granzyme B and perforin mRNAs. Immunity. 2007;26(6):798–811. [DOI] [PubMed] [Google Scholar]
  • 33.Vermorken JB, Mesia R, Rivera F, et al. Platinum-Based Chemotherapy plus Cetuximab in Head and Neck Cancer. N. Engl. J. Med 2008;359(11):1116–1127. [DOI] [PubMed] [Google Scholar]
  • 34.Vermorken JB, Trigo J, Hitt R, et al. Open-Label, Uncontrolled, Multicenter Phase II Study to Evaluate the Efficacy and Toxicity of Cetuximab As a Single Agent in Patients With Recurrent and/or Metastatic Squamous Cell Carcinoma of the Head and Neck Who Failed to Respond to Platinum-Based The. J. Clin. Oncol 2007;25(16):2171–2177. [DOI] [PubMed] [Google Scholar]
  • 35.Luedke E, Jaime-Ramirez AC, Bhave N, et al. Cetuximab therapy in head and neck cancer: Immune modulation with interleukin-12 and other natural killer cell-activating cytokines. Surgery. 2012;152(3):431–440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Pitt JM, Vétizou M, Daillère R, et al. Resistance Mechanisms to Immune-Checkpoint Blockade in Cancer: Tumor-Intrinsic and -Extrinsic Factors. Immunity. 2016;44(6):1255–1269. [DOI] [PubMed] [Google Scholar]
  • 37.Morvan MG, Lanier LL. NK cells and cancer: You can teach innate cells new tricks. Nat. Rev. Cancer 2016;16(1):7–19. [DOI] [PubMed] [Google Scholar]
  • 38.Ni J, Miller M, Stojanovic A, Garbi N, Cerwenka A. Sustained effector function of IL-12/15/18–preactivated NK cells against established tumors. J. Exp. Med 2012;209(13):2351–2365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Terrén I, Orrantia A, Mosteiro A, et al. Metabolic changes of Interleukin-12/15/18-stimulated human NK cells. Sci. Rep 2021;11(1):1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sullivan R, Mathyer M, Govero J, et al. Development of WU-NK-101, a feeder cell-free expanded allogeneic memory NK cell product with potent anti-tumor activity. J. Immunother. Cancer 2021;9(Suppl;2)(A200):Abstract1188. [Google Scholar]
  • 41.Phan NN, Liu S, Wang C-Y, et al. Overexpressed gene signature of EPH receptor A/B family in cancer patients-comprehensive analyses from the public high-throughput database. Int. J. Clin. Exp. Pathol 2020;13(5):1220–1242. [PMC free article] [PubMed] [Google Scholar]
  • 42.Watanabe M, Kono K, Kawaguchi Y, et al. NK cell dysfunction with down-regulated CD16 and up-regulated CD56 molecules in patients with esophageal squamous cell carcinoma. Dis. esophagus Off. J. Int. Soc. Dis. Esophagus 2010;23(8):675–681. [DOI] [PubMed] [Google Scholar]
  • 43.Wagner JA, Berrien-Elliott MM, Rosario M, et al. Cytokine-Induced Memory-Like Differentiation Enhances Unlicensed Natural Killer Cell Antileukemia and FcγRIIIa-Triggered Responses. Biol. Blood Marrow Transplant 2017;23(3):. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wu Z, Doondeea JB, Gholami AM, et al. Quantitative chemical proteomics reveals new potential drug targets in head and neck cancer. Mol. Cell. Proteomics 2011;10(12):. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hsu K, Middlemiss S, Saletta F, et al. Chimeric Antigen Receptor-modified T cells targeting EphA2 for the immunotherapy of paediatric bone tumours. Cancer Gene Ther. 2021;28(3–4):321–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Liu E, Marin D, Banerjee P, et al. Use of CAR-transduced natural killer cells in CD19-positive lymphoid tumors. N. Engl. J. Med 2020;382(6):545–553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Bednarski JJ, Zimmerman C, Berrien-Elliott MM, et al. Donor memory-like NK cells persist and induce remissions in pediatric patients with relapsed AML after transplant. Blood. 2022;139(11):1670–1683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Tinhofer I, Braunholz D, Klinghammer K. Preclinical models of head and neck squamous cell carcinoma for a basic understanding of cancer biology and its translation into efficient therapies. Cancers Head Neck. 2020;5(1):9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Berrien-Elliott MM, Becker-Hapak M, Cashen AF, et al. Systemic IL-15 promotes allogeneic cell rejection in patients treated with natural killer cell adoptive therapy. Blood. 2021;139(8):1177–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shapiro RM, Birch GC, Hu G, et al. Expansion, persistence, and efficacy of donor memory-like NK cells infused for posttransplant relapse. J. Clin. Invest 2022;132(11):. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1925330-supplement-1.docx (22.8KB, docx)
2
NIHMS1925330-supplement-2.pdf (1.9MB, pdf)
3
NIHMS1925330-supplement-3.pdf (2.6MB, pdf)
4
NIHMS1925330-supplement-4.pdf (198.5KB, pdf)
5
NIHMS1925330-supplement-5.pdf (61.5KB, pdf)
6
NIHMS1925330-supplement-6.pdf (415.2KB, pdf)
7
NIHMS1925330-supplement-7.pdf (119KB, pdf)
8
NIHMS1925330-supplement-8.pdf (206.3KB, pdf)

Data Availability Statement

Raw data, cell lines, and constructs generated in this study are available upon request from the corresponding author.

RESOURCES