Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2023 Oct 25;103(1):103237. doi: 10.1016/j.psj.2023.103237

In ovo feeding of probiotic lactobacilli differentially alters expression of genes involved in the development and immunological maturation of bursa of Fabricius in pre-hatched chicks

Shreeya Sharma *, Raveendra R Kulkarni †, Shayan Sharif ‡, Hosni Hassan §, Mohammadali Alizadeh ‡, Scott Pratt *, Khaled Abdelaziz *,1
PMCID: PMC10801656  PMID: 38011819

Abstract

Compelling evidence indicates that immunological maturation of the gut-associated lymphoid tissues, including the bursa of Fabricius, is dependent upon antigenic stimulation post-hatch. In view of these data, the present study investigated the impact of exposing the immune system of chick embryos to antigenic stimuli, via in ovo delivery of poultry-specific lactobacilli, on the expression of genes associated with early bursal development and maturation. Broiler line embryonated eggs were inoculated with 106 and 107 colony-forming units (CFUs) of an individual or a mixture of Lactobacillus species, including L. crispatus (C25), L. animalis (P38), L. acidophilus (P42), and L. reuteri (P43), at embryonic day 18 (ED18). The bursa of Fabricius was collected from pre-hatched chicks (ED20) to measure the expression levels of various immune system genes. The results revealed that L. acidophilus and the mixture of Lactobacillus species at the dose of 106 CFU consistently elicited higher expression of genes responsible for B cell development, differentiation, and survival (B cell activating factor (BAFF), BAFF-receptor (BAFF-R)), and antibody production (interleukin (IL)-10) and diversification (TGF-β). Similar expression patterns were also noted in T helper (Th) cell-associated cytokine genes, including Th1-type cytokines (interferon (IFN)-γ and IL-12p40), Th2-type cytokines (IL-4 and IL-13) and Th17 cytokine (IL-17). Overall, these results suggest that the supplementation of poultry-specific lactobacilli to chick embryos might be beneficial for accelerating the development and immunological maturation of the bursa of Fabricius. However, further studies are required to determine if the changes in gene expression are associated with the developmental trajectory and phenotypes of bursal cells.

Key words: chicken, probiotics, Lactobacillus, cytokine, bursa of Fabricius

INTRODUCTION

Studies indicate that the gut immune system in chickens is not fully developed at hatch; it begins to develop during early embryogenesis and gradually matures during the first few weeks after hatching (Lowenthal et al., 1994; Bar-Shira et al., 2003; Miyazaki et al., 2007). The gut immune system is mainly orchestrated by the gut-associated lymphoid tissue (GALT), the largest immune organ in chickens. GALT is a complex network of innate and adaptive immune cells that function together to maintain gut-immunological homeostasis (Mowat and Agace, 2014) and includes the bursa of Fabricius, Peyer's patches, cecal tonsils, Meckel's diverticulum, and intraepithelial and lamina propria lymphocytes (Smith et al., 2014; Taha-Abdelaziz et al., 2018).

The bursa of Fabricius is the largest GALT organ and possesses a unique microenvironment supporting the development of mature B cells. Although the bursa of Fabricius contains a small population of thymus-derived lymphocytes (T cells), there is substantial evidence highlighting their crucial role in providing protection against viral diseases, such as infectious bursal disease and Marek's disease (Kim et al., 2000; Schat, 2022). The maturation and differentiation of the B cells in the bursa is a highly regulated process that relies on early exposure to antigens after hatching (Glick et al., 1956; Sorvari et al., 1975); however, modern poultry farming practices, including egg decontamination, artificial incubation, hatchery sanitation, lack of exposure to maternal microbiota, and the prophylactic use of antibiotics, were associated with a delay in the bursal development (Kpodo and Proszkowiec-Weglarz, 2023). The delay in bursal maturation renders hatched chicks susceptible to a plethora of environmental pathogens.

Experimental evidence indicates that early post-hatch feeding supplies the antigens required for the differentiation and proliferation of B lymphocytes in the GALT, including the bursa of Fabricius (Nagler-Anderson, 2001; Taha-Abdelaziz et al., 2018; Reicher et al., 2022). Additionally, recent data suggests that supplying antigens to chick embryos before hatching could result in outcomes comparable to post-hatch application. This has paved a new avenue for research into exploring the potential ability of in ovo delivery of feed additives, including probiotics, to chick embryos in eliciting early immunity and enhancing the immune competence of hatched chicks (Kadam et al., 2013; Madej et al., 2015; Teague et al., 2017). For instance, in ovo administration of probiotic lactobacilli has been shown to induce expression of immune-related genes in lymphoid organs and improve systemic antibody response to different antigens, such as sheep red blood cells (SRBC) and keyhole limpet hemocyanin (KLH) in newly hatched chicks, despite the incomplete development of their immune system (Alizadeh et al., 2020, 2021, 2022). In another study, supplementation of Lactobacillus species to chick embryos was shown to enhance cellular proliferation and increase the weight of lymphoid organs, including the spleen, thymus, and bursa of Fabricius, suggesting a possible role for probiotics in modulating the development of these lymphoid organs (Madej et al., 2015). It is important to emphasize that probiotic lactobacilli isolated and reinoculated into the same host species (i.e., species-specific lactobacilli) demonstrated greater effectiveness compared to those isolated from different species (La Reau et al., 2016; Kido et al., 2021, Moeller et al., 2019). However, although much research focused on the effects of in ovo-delivered probiotics on immune responses and cellular and morphological changes in lymphoid organs of hatched chicks, there remains no clear evidence of whether lactobacilli influence the development and functional maturation of these organs in pre-hatched chicks at the molecular level.

Considering the role of the bursa of Fabricius, the primary site for the development of the B cell repertoire, in antibody production and in providing a niche for other lymphoid and myeloid cells such as T cells, macrophages, and dendritic cells, this study was undertaken to investigate the potential role of poultry-specific lactobacilli in modulating the expression of genes involved in the development, differentiation and activation of B cells and functional activity of other bursal cells, in pre-hatched chicks.

MATERIALS AND METHODS

Eggs Incubation

Eighty-eight embryonated commercial Ross 308 broiler eggs were obtained from a commercial hatchery (Fieldale Farms Corporation, GA) and incubated in an isolated, disease-free facility/Biosecurity Level-2 laboratory in a sanitized egg incubator (GQF Manufacturing Company Inc., GA) set at 37°C with humidity at 55% and automated turning for 20 d. All procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Clemson University.

Probiotic Strains

Poultry-specific Lactobacillus strains (L. reuteri-P43, L. acidophilus-P42, L. animalis-P38, and L. crispatus-C25 were provided by H. M. Hassan's Laboratory at NC State University). The growth curve for each strain utilized in this study was generated by inoculating a loopful of frozen Lactobacillus species into a 14 mL bacterial culture tube containing 10 mL of MRS (DeMan, Rogosa, and Sharpe). Tubes were incubated overnight at 37°C under anaerobic conditions. Subsequently, 500 μL of the overnight culture was inoculated into 50 mL fresh MRS broth and incubated at 37°C under anaerobic conditions. The optical density (OD) of each culture was measured at 600 nm (OD600) using a spectrophotometer (VWR, PA) at various time intervals. To determine the number of colony-forming units (CFUs) of each Lactobacillus strain/mL, a 10-fold serial dilution of each growing culture was prepared, and 100 μL of each dilution was streaked onto MRS agar plates. The plates were then incubated for 24 h at 37°C under anaerobic conditions. The viable colony counts were enumerated, and a linear calibration curve was generated by plotting CFUs/mL against the corresponding OD measurements obtained at different time points. A linear regression analysis was then conducted, and individual growth formulas were generated for each Lactobacillus strain to transform ODs into viable counts. The Lactobacillus strains used for in ovo injection were grown individually in MRS broth and incubated at 37°C under anaerobic conditions. During the stationary phase (15 h of incubation), individual Lactobacillus suspension was adjusted to a concentration of 106 or 107 CFUs/100 μL of PBS, and equal concentrations of each culture were mixed together to prepare a multistrain cocktail of lactobacilli.

In ovo Inoculations

On embryonic day 18 (ED18), eggs were disinfected with 70% ethanol and were randomly divided into 11 treatment groups with 8 replicates each. Subsequently, a hole was punched in the eggshell and a 23-gauge needle was used to administer the lactobacilli into the amniotic sac. Eggs were injected with different doses (low: 106 CFU or high: 107 CFU) of the individual Lactobacillus species or their mixture in a total volume of 100 μL Dulbecco's Phosphate-Buffered Saline (DPBS). The 11th group was treated with DPBS and served as a negative control. The treatment groups are summarized in Table 1. Eggs were incubated at 37°C with humidity at 55% and automated turning. After 48 h post-inoculation (ED20), chick embryos were sacrificed, and the bursa of Fabricius was collected in 1 mL TRIzol (Invitrogen, Carlsbad, CA) and stored at −80°C until further processing.

Table 1.

Treatment groups.

Treatment group Lactobacillus strain Dose (CFUs) Necropsy day Tissue collected
1 L. animalis 106 ED20 Bursa of Fabricius
2 L. animalis 107
3 L. acidophilus 106
4 L. acidophilus 107
5 L. reuteri 106
6 L. reuteri 107
7 L. crispatus 106
8 L. crispatus 107
9 Mixture 106
10 Mixture 107
11 PBS -
Open in a new tab

RNA Extraction and Complementary DNA (cDNA) Synthesis

Tissue samples were homogenized for RNA extraction using Bead Ruptor Elite (Omni International, GA). RNA was extracted from the bursa of Fabricius using TRIzol (Invitrogen, Carlsbad, CA) per the manufacturer's protocol. Total RNA was treated with DNase (DNA-free kit, Invitrogen, Carlsbad, CA) to remove the genomic DNA. The mass and purity of RNA samples were measured by a Nanodrop One spectrophotometer (Thermo Scientific, Greenville County, SC). Reverse transcription to cDNA was performed using SuperscriptII First-Strand Synthesis kit (Invitrogen, Carlsbad, CA) and oligo-dT primers (Thermofisher Scientific, Greenville County, SC) according to the manufacturer's protocol. The cDNA was diluted 1:10 in nuclease-free water.

Quantitative Real-Time PCR

Quantitative real-time PCR (qRT-PCR) was performed using the LightCycler480 system (Roche Diagnostics) as previously described (Taha-Abdelaziz et al., 2016). The PCR master mix consisted of 10 µL of PowerTrack SYBR Green Master Mix (ThermoFisher Scientific, Greenville County, SC), 1 µL of forward and 1 µL of reverse primers (10 µM) and 3 µL nuclease-free water. Each reaction consisted of 15 µL of the master mix and 5 uL of cDNA. The qRT-PCR cycling protocol included an initial denaturation step at 95°C, followed by amplification for 45 cycles consisting of 95°C for 10 s, annealing (according to specific primers; provided in Table 2), and extension at 72°C for 10 s. All primers used in this study (Table 2) were synthesized by MilliporeSigma (Burlington, MA). The expression of the target genes was calculated relative to the reference gene (β-actin) using the Roche LightCycler 480 software based on the 2−ΔΔCT method.

Table 2.

Primer sequences used for real-time quantitative PCR.

Gene Primer sequence (5′–3′) Annealing temp. (°C) References
β-actin F: CAACACAGTGCTGTCTGGTGGTA
R: ATCGTACTCCTGCTTGCTGATCC		 60 Brisbin et al. (2010)
IFN-γ F: ACACTGACAAGTCAAAGCCGCACA
R: AGTCGTTCATCGGGAGCTTGGC		 60 Brisbin et al. (2010)
IL-10 F: TTTGGCTGCCAGTCTGTGTC
R: CTCATCCATCTTCTCGAACGTC		 64 Taha-Abdelaziz et al. (2017)
IL-17 F: TATCAGCAAACGCTCACTGG
R: AGTTCACGCACCTGGAATG		 60 Crhanova et al. (2011)
IL-13 F: ACTTGTCCAAGCTGAAGCTGTC
R: TCTTGCAGTCGGTCATGTTGTC		 60 Taha-Abdelaziz et al. (2018)
IL-4 F: GCTCTCAGTGCCGCTGATG
R: GGAAACCTCTCCCTGGATGTC		 58 Slawinska et al. (2014)
IL-12p40 F: TTGCCGAAGAGCACCAGCCG
R: CGGTGTGCTCCAGGTCTTGGG		 64 Brisbin et al. (2010)
BAFF F: CACGTCATCCAGCAGAAGGAT
R: ACAAGAGGACAGGAGCATTGC		 55 Ko et al. (2018)
BAFF-R F: CCTGGCCCCACCATAAGG
R: CATTACAGTCTCTCCTCACCCATACA		 55 Ko et al. (2018)
TGF-β F: CGGCCGACGATGAGTGGCTC
R: CGGGGCCCATCTCACAGGGA		 60 Taha-Abdelaziz et al. (2018)
Open in a new tab

Statistical Analysis

Data were analyzed and graphs were created using GraphPad Prism V5.0 (GraphPad Software, San Diego, CA). The effects of lactobacilli on cytokine expression were analyzed using 1-way ANOVA and differences among means between the treatment groups were determined using Tukey's multiple comparison test. Results were considered statistically significant if the P value ≤ 0.05. Data are shown graphically as the mean of the relative gene expression data (2−∆∆Ct) ± the standard error of the mean (SEM).

RESULTS

Effects of In ovo-Delivered Lactobacilli on the Gene Expression of Cytokines Involved in B Cell Development, Differentiation, Activation, and Survival in the Bursa of Fabricius

The high dose of L. acidophilus (107 CFUs) significantly induced a higher expression (P ≤ 0.05) of the B cell-activating factor (BAFF; an essential element for B cell maturation, differentiation, and survival) (Ng et al., 2004) than the untreated control and L. crispatus (106 CFU) treated group. A numerically higher expression of BAFF was observed in L. animalis (106 CFU), L. acidophilus (106 CFU), L. reuteri (106 CFU), and Lactobacillus mixture (106 CFU) treatment groups compared to the untreated control group (Figure 1A).

Figure 1.

Figure 1

Open in a new tab

Effect of in ovo supplementation of different Lactobacillus species on the relative gene expression profiles of cytokines involved in B cell development, differentiation, activation, and survival: BAFF (A) and BAFF-R (B) in the bursa of pre-hatched chick embryos. On embryonic d 18, eggs were injected with the respective Lactobacillus treatments and the bursa of Fabricius was collected at 48 h post-treatment. The treatment groups were as follows: PBS (phosphate-buffered saline), L. animalis (106 CFU/egg), L. animalis (107 CFU/egg), L. acidophilus (106 CFU/egg), L. acidophilus (107 CFU/egg), L. reuteri (106 CFU/egg), L. reuteri (107 CFU/egg), L. crispatus (106 CFU/egg), L. crispatus (107 CFU/egg), and a mixture of the lactobacilli at the dose of 106 CFU/egg and 107 CFU/egg. The expression of the target genes was calculated relative to the reference gene (β-actin). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey's comparison test. Error bars represent the standard error of the mean (SEM). An asterisk indicates a significant difference (P ≤ 0.05) among the treatment groups.

With respect to BAFF-receptor (BAFF-R), a critical regulator of B cell function, L. animalis (106 CFU) and L. acidophilus at both low and high doses (106 and 107 CFUs) induced numerically higher expression of BAFF-R in the bursa (P ≥ 0.05), whereas Lactobacillus mixture at 106 CFU induced significantly higher expression of BAFF-R (P ≤ 0.05) than the untreated control, both low and high doses of L. reuteri (106 and 107 CFU), and a low dose of L. crispatus (106 CFU) (Figure 1B).

Interleukin (IL)-10 is a Th2 cytokine that promotes B cell activation and antibody production (Saxena et al., 2015). While the expression of IL-10 was observed in the bursa of only 4 out of 6 birds in the untreated control group and in similar or fewer numbers of lactobacilli-treated groups, the low dose (106 CFUs) of L. acidophilus induced its expression in 6 out of 8 birds (Figure 2). Although the data did not subject to statistical analysis, the expression of IL-10 appears to be numerically higher in the group treated with the low dose of L. acidophilus (P ≥ 0.05).

Figure 2.

Figure 2

Open in a new tab

Effect of in ovo supplementation of different probiotic treatments on the relative gene expression profiles of the immunoregulatory pleiotropic cytokine involved in B cell activation and antibody production: IL-10 (Figure 2) in the bursa of pre-hatched chick embryos. On embryonic d 18, eggs were injected with the respective Lactobacillus treatments and the bursa of Fabricius was collected at 48 h post-treatment. The treatment groups were as follows: PBS (phosphate-buffered saline), L. animalis (106 CFU/egg), L. animalis (107 CFU/egg), L. acidophilus (106 CFU/egg), L. acidophilus (107 CFU/egg), L. reuteri (106 CFU/egg), L. reuteri (107 CFU/egg), L. crispatus (106 CFU/egg), L. crispatus (107 CFU/egg), and a mixture of the lactobacilli at the dose of 106 CFU/egg and 107 CFU/egg. The expression of the target genes was calculated relative to the reference gene (β-actin). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey's comparison test. Error bars represent the standard error of the mean (SEM). The figures above the bars represent the number of birds expressing IL-10 within each respective group.

The low dose (106 CFU) of Lactobacillus mixture induced significantly higher expression of transforming growth factor (TGF)-β (a regulatory cytokine produced by T cells and other nonlymphoid cells and plays a vital role in antibody diversification) P ≤ 0.05) compared to the untreated control group and other treatment groups, except the low dose (106 CFU) of L. acidophilus and the high dose of Lactobacillus mixture group (P ≥ 0.05). A numerically higher TGF-β expression was observed in the group administered with 106 CFUs of L. acidophilus (P ≥ 0.05) (Figure 3) compared to the untreated control group.

Figure 3.

Figure 3

Open in a new tab

Effect of in ovo supplementation of different probiotic treatments on the relative gene expression profiles of the cytokine involved in antibody diversification: TGF-β (Figure 3) in the bursa of pre-hatched chick embryos. On embryonic day 18, eggs were injected with the respective Lactobacillus treatments and the bursa of Fabricius was collected at 48 h post-treatment. The treatment groups were as follows: PBS (phosphate-buffered saline), L. animalis (106 CFU/egg), L. animalis (107 CFU/egg), L. acidophilus (106 CFU/egg), L. acidophilus (107 CFU/egg), L. reuteri (106 CFU/egg), L. reuteri (107 CFU/egg), L. crispatus (106 CFU/egg), L. crispatus (107 CFU/egg) and a mixture of the lactobacilli at the dose of 106 CFU/egg and 107 CFU/egg. The expression of the target genes was calculated relative to the reference gene (β-actin). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey's comparison test. Error bars represent the standard error of the mean (SEM). An asterisk indicates a significant difference (P ≤ 0.05) among the treatment groups.

Effects of In ovo-Delivered Lactobacilli on the Gene Expression of T Helper (Th) Cell-Associated Cytokines in the Bursa of Fabricius

The transcriptional response of IL-12p40 (a cytokine produced by Th1 and myeloid cells, including macrophages and dendritic cells) and interferon (IFN)-γ (a marker of Th1-mediated immune response) (Zhu et al., 2010) were measured in the bursa of chick embryos following exposure to different doses of lactobacilli. Inoculation of 106 CFUs of L. acidophilus and the lactobacilli mixture induced numerically higher expression of IFN-γ (P ≥ 0.05) compared to the untreated and other lactobacilli-treated groups (Figure 4A). The same dose of L. acidophilus also induced numerically higher expression of IL-12p40 (P ≥ 0.05) compared to the other treatment groups (Figure 4B). There were no differences among the other treatment groups in the expression of IFN-γ and IL-12p40 (P ≥ 0.05).

Figure 4.

Figure 4

Open in a new tab

Effect of in ovo supplementation of different lactobacilli treatments on the relative gene expression profiles of cytokines involved in Th-1 response: IFN-γ (A) and IL-12p40 (B) in the bursa of pre-hatched chick embryos. On embryonic d 18, eggs were injected with the respective Lactobacillus treatments and the bursa of Fabricius was collected at 48 h post-treatment. The treatment groups were as follows: PBS (phosphate-buffered saline), L. animalis (106 CFU/egg), L. animalis (107 CFU/egg), L. acidophilus (106 CFU/egg), L. acidophilus (107 CFU/egg), L. reuteri (106 CFU/egg), L. reuteri (107 CFU/egg), L. crispatus (106 CFU/egg), L. crispatus (107 CFU/egg) and a mixture of the lactobacilli at the dose of 106 CFU/egg and 107 CFU/egg. The expression of the target genes was calculated relative to the reference gene (β-actin). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey's comparison test. Error bars represent the standard error of the mean (SEM).

In ovo inoculation of 106 CFUs of L. acidophilus or Lactobacillus mixture resulted in a numerically higher expression of IL-4 (Figure 5A) and IL-13 (Figure 5B), key regulators of Th2 response, compared to the untreated control (P ≥ 0.05). No differences were observed among the other treatment groups (P ≥ 0.05).

Figure 5.

Figure 5

Open in a new tab

Effect of in ovo supplementation of different probiotic treatments on the relative gene expression profiles of cytokines involved in regulating Th-2 response: IL-4 (A) and IL-13 (B) in the bursa of pre-hatched chick embryos. On embryonic d 18, eggs were injected with the respective Lactobacillus treatments and the bursa of Fabricius was collected at 48 h post-treatment. The treatment groups were as follows: PBS (phosphate-buffered saline), L. animalis (106 CFU/egg), L. animalis (107 CFU/egg), L. acidophilus (106 CFU/egg), L. acidophilus (107 CFU/egg), L. reuteri (106 CFU/egg), L. reuteri (107 CFU/egg), L. crispatus (106 CFU/egg), L. crispatus (107 CFU/egg) and a mixture of the lactobacilli at the dose of 106 CFU/egg and 107 CFU/egg. The expression of the target genes was calculated relative to the reference gene (β-actin). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey's comparison test. Error bars represent the standard error of the mean (SEM).

While the expression of IL-17 (a cytokine produced mainly by Th17) was observed in the bursa of only 2 birds of the untreated control group, lactobacilli treatment induced its expression in a larger number of birds, with L. acidophilus and L. crispatus at 106 CFUs and L. acidophilus, L. animalis, and L. reuteri at 107 CFUs induced it in 6 out of 8 inoculated birds (P ≥ 0.05) (Figure 6). Although the data did not subject to statistical analysis, the expression of IL-17 appears to be numerically higher in the groups treated with L. acidophilus (P ≥ 0.05).

Figure 6.

Figure 6

Open in a new tab

Effect of in ovo supplementation of different lactobacilli treatments on the relative gene expression profiles of the cytokine produced by Th-17 cell: IL-17 (Figure 6) in the bursa of pre-hatched chick embryos. On embryonic d 18, eggs were injected with the respective Lactobacillus treatments and the bursa of Fabricius was collected at 48 h post-treatment. The treatment groups were as follows: PBS (phosphate-buffered saline), L. animalis (106 CFU/egg), L. animalis (107 CFU/egg), L. acidophilus (106 CFU/egg), L. acidophilus (107 CFU/egg), L. reuteri (106 CFU/egg), L. reuteri (107 CFU/egg), L. crispatus (106 CFU/egg), L. crispatus (107 CFU/egg) and a mixture of the lactobacilli at the dose of 106 CFU/egg and 107 CFU/egg. The expression of the target genes was calculated relative to the reference gene (β-actin). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey's comparison test. Error bars represent the standard error of the mean (SEM). The figures above the bars represent the number of birds expressing IL-17 within each respective group.

DISCUSSION

With the poultry industry increasingly adopting in ovo vaccination as an alternative approach to post-hatch vaccination, there is a growing interest in early manipulation of the immune system of chick embryos, via feed additives, for enhancing vaccine immunogenicity and the immunocompetence of neonatal chickens. Among these feed additives, probiotics have demonstrated considerable promise in modulating immunity and improving the performance parameters of neonatal chicks when administered in ovo a few days before hatching (de Oliveira et al., 2014; Alizadeh et al., 2020, 2021, 2022; Shehata et al., 2021). While numerous studies have focused on the role of probiotics in modulating the innate and adaptive immune responses and in increasing the weight, morphological changes, and cellular composition of the lymphoid organs in hatched chicks (Cengiz et al., 2015; Hussein et al., 2020; Stefaniak et al., 2020), their impact on the development of lymphoid organs during the late embryonic stage is poorly understood. Of note is the bursa of Fabricius, a unique primary lymphoid organ in birds that plays an essential role in the ontogenetic development of adaptive immunity by generating a diverse antibody repertoire. The development of the bursa of Fabricius begins at ED5. It reaches its maximum size between 8 and 12 wk after hatching and remains functionally active until 6 months of age, after which it undergoes involution (Ko et al., 2018). The changes in the cellular composition of the bursa during embryonic development are depicted in Figure 7.

Figure 7.

Figure 7

Open in a new tab

Cellular composition of the bursa of Fabricius during embryonic development (Khan and Hashimoto, 1996, Ko et al., 2018, Le Douarin et al., 1975, Madej et al., 2013, Nagy et al., 2004, Otsubo et al., 2001, Paramithiotis and Ratcliffe, 1994, Ratcliffe, 2006, Romano et al., 1996, Udoumoh et al., 2022).

The distinct structure of the bursa provides a niche that supports B cell maturation and proliferation. Evidence indicates that bursal follicles predominantly constitute B lymphocytes (85–95%), followed by T lymphocytes (<5%), and other nonlymphoid cells (Palojoki et al., 1992; Kim et al., 2000), such as Bursal Secretory Dendritic Cells (BSDCs) and stromal cells (Mesenchymal Reticular Cells and macrophages) (Oláh et al., 2022). Since B and T cells are the major cell types in the bursa, this study was undertaken to investigate the potential of lactobacilli in altering the expression of genes involved in B development, differentiation and activation and genes expressed by other cellular populations (lymphoid and myeloid cells) during the early stage of bursal growth and development.

In general, our results revealed that L. acidophilus and the mixture of Lactobacillus species at the dose of 106 CFU induced comparable gene expression levels of various cytokines produced by lymphoid and myeloid cells in the bursa of Fabricius, including IFN-γ, IL-12p40, IL-4, IL10, IL-13, IL-17, TGF-β, BAFF, and BAFF-R. Given the similarity in gene expression within these 2 particular groups (L. acidophilus and the mixture of Lactobacillus species), one could reasonably speculate that the observed effects might be related to the presence of L. acidophilus in the mixture rather than the combined effects of different lactobacilli.

It is also worth noting that the low level of gene expression observed in this study could be due to the fact that the bursal cells are not yet fully developed. While there is no evidence to support this hypothesis in the bursa, Abdul-Careem and colleagues have demonstrated developmental changes in cytokine gene expression in the spleen of developing chicken embryos and newly hatched chick. Their findings revealed that cytokine expression levels exhibited a gradual increase as the birds aged, with higher expression of IFN-γ, IL-4, IL-10, and IL-18 observed in the spleen of post-hatched chickens compared to chick embryos (Abdul-Careem et al., 2007). In another in vitro study, treatment of adult chicken splenic T cells with various mitogens resulted in cellular proliferation and production of IFN-γ and IL-2; however, no such effects were observed in the splenic T cells of day-old chicks, though they were phenotypically mature (Lowenthal et al., 1994). The lack of splenic T cell responsiveness in neonatal chicks implies that these cells have not fully developed their functional capabilities. In the context of bursal responsiveness, Alizadeh and colleagues observed that in ovo inoculation of a Lactobacillus mixture, including L. salivarius, L. johnsonii, L. reuteri, and L. crispatus, induced a higher cytokine expression in the bursa at 10 d of age, while little or no changes were observed at 5 d of age (Alizadeh et al., 2021). Taken together, the increased expression of genes associated with the development and functional maturity of bursal T and B cells highlights the potential immunostimulatory capacity of the in ovo-injected lactobacilli in enhancing the B cell maturation and immune responsiveness.

In the present study, the enhanced expression of IL-12p40, IL-17, and IFN-γ indicates that lactobacilli can promote the functional ability of lymphoid and myeloid cells in the bursa of Fabricius. This observation is in support of a previous study that found in ovo inoculation of a Lactobacillus mixture can augment the expression of these genes in newly hatched chicks (Alizadeh et al., 2021). While the excessive production of the proinflammatory IL-17 could potentially result in uncontrolled inflammation (Ge et al., 2020), it has been demonstrated that the controlled expression of IL-17 plays a crucial role in coordinating innate immunity against extracellular pathogens by promoting the expression of antimicrobial peptides (Lin et al., 2011; Brabec et al., 2023). It is therefore important to highlight that although probiotic lactobacilli induced the expression of IL-17 in a larger number of birds compared to the untreated control birds, the magnitude of its expression does not appear to be elevated to the level that would be detrimental to the host.

In addition to its role in promoting the differentiation of the naïve CD4+ cells to T regulatory (Treg) cells, TGF-β also plays a vital role in antibody diversification by driving the class-switching process toward IgA+ cells, the primary class of antibodies in mucosal secretions (Coffman et al., 1989). Indeed, Ko et al. (2018) have recently studied the phenotypic changes of the bursal B cells during embryonic development, and their result revealed that the percentage of IgA+ B cells was extremely low (<1%) during the embryonic stage and the first 2-days post-hatch (Ko et al., 2018). Hence, the notable induction of TGF-β expression in the bursa highlights the potential of the in ovo-delivered probiotic lactobacilli to provide stimulatory signals to bursal cells, leading to an increased diversity of the antibody repertoire.

Since B cell differentiation and proliferation in the bursa commence on ED15 and continue to proliferate until 8 to 12 wk of age (Oláh et al., 1986), it is tempting to speculate that early induction of genes responsible for B cell proliferation could lead to accelerated bursal development. IL-4 is known for its essential role in promoting the activation of mature B cells and immunoglobulin class switching to IgG1 and IgE (Yoshimoto, 2018). It is thought that the production of IL-13 might also promote the Th-2 response by suppressing the production of IL-12, an inhibitor of Th2 development (Leyva-Castillo et al., 2021). Furthermore, both IL-4 and IL-13 have been reported to promote the growth and proliferation of B cells (Junttila, 2018). In view of this, the lactobacilli-induced expression of IL-4 and IL-13 suggests that in ovo supplementation of lactobacilli during the late embryonic stage could accelerate B cell growth and proliferation and functional maturity of developing bursa.

B cell activating factor (BAFF) and B cell activating factor receptor (BAFF-R) are members of the tumor necrosis factor family and are known as key regulators of B cell survival, bursal cellularity, and phenotypic maturation (Ng et al., 2004). During the earliest embryonic stage (ED15–17), the bursa harbors a higher proportion of large than small B cell subpopulations; however, this ratio quickly reverses around E19 to 20, with small B cells becoming the predominant population (Ko et al., 2018). Given that large B cells are more proliferative and differentiated than small B cells, the induction of BAFF and BAFF-R expressions by lactobacilli suggests that supplementation of lactobacilli to chick embryos before ED19 could stimulate and extend the proliferative capacity of B cells.

In addition to their role in B cell activation and proliferation, evidence indicates that BAFF and BAFF-R represent the main prosurvival factors to naïve B cells by regulating apoptosis during the transitional B cell stages (Schneider, 2004). Since over 90% of the B cells undergo apoptosis during migration to secondary lymphoid organs after hatching (Lassila, 1989), the lactobacilli-induced expression of BAFF and BAFF-R could provide a survival signal to B cells during the transitional stages and migration process.

Overall, in ovo delivery of probiotics was associated with alterations in the expression of various immune system genes involved in the maturation of B and T cells and myeloid cells in the bursa of Fabricius of pre-hatched chicks. Nonetheless, more research is needed to further explore whether the observed changes in genes associated with cellular differentiation and proliferation resulted in any alterations to the phenotypic characteristics, cellular composition, and developmental trajectory of bursal cells.

In conclusion, the results of this study suggest that in ovo delivery of lactobacilli provides signals not only for B cell development and survival but also for promoting the immune function of other lymphoid and myeloid cells during bursal development. These findings highlight the potential of in ovo application of lactobacilli to promote bursal development.

ACKNOWLEDGMENTS

This work is supported by the USDA National Institute of Food and Agriculture, Hatch Project number SC-1700628 [Accession Number 7004405 & Technical Contribution No. 7220] and the South Carolina Department of Agriculture (SCDA), Agribusiness Center for Research & Entrepreneurship Competitive Grant Program (ACRE CGP) [Grant Number 2016204]. This project was also funded in part by Clemson University's R-Initiatives. We would like to thank the Fieldale Farms Corporation for their generous assistance in supplying fertilized broiler eggs, which greatly facilitated our research. The assistance of the staff of the Godley-Snell Research Center (GSRC) is gratefully acknowledged.

DISCLOSURES

The authors declare that there are no conflicts of interest.

REFERENCES

  1. Abdul-Careem M.F., Hunter D.B., Lambourne M.D., Barta J., Sharif S. Ontogeny of cytokine gene expression in the chicken spleen. Poult. Sci. 2007;86:1351–1355. doi: 10.1093/ps/86.7.1351. [DOI] [PubMed] [Google Scholar]
  2. Alizadeh M., Astill J., Alqazlan N., Shojadoost B., Taha-Abdelaziz K., Bavananthasivam J., Doost J.S., Sedeghiisfahani N., Sharif S. In ovo co-administration of vitamins (A and D) and probiotic lactobacilli modulates immune responses in broiler chickens. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alizadeh M., Bavananthasivam J., Shojadoost B., Astill J., Taha-Abdelaziz K., Alqazlan N., Boodhoo N., Shoja Doost J., Sharif S. In ovo and oral administration of probiotic lactobacilli modulate cell- and antibody-mediated immune responses in newly hatched chicks. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.664387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alizadeh M., Shojadoost B., Astill J., Taha-Abdelaziz K., Karimi S.H., Bavananthasivam J., Kulkarni R.R., Sharif S. Effects of in ovo inoculation of multi-strain lactobacilli on cytokine gene expression and antibody-mediated immune responses in chickens. Front. Vet. Sci. 2020;7:105. doi: 10.3389/fvets.2020.00105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bar-Shira E., Sklan D., Friedman A. Establishment of immune competence in the avian GALT during the immediate post-hatch period. Dev. Comp. Immunol. 2003;27:147–157. doi: 10.1016/s0145-305x(02)00076-9. [DOI] [PubMed] [Google Scholar]
  6. Brabec T., Vobořil M., Schierová D., Valter E., Šplíchalová I., Dobeš J., Březina J., Dobešová M., Aidarova A., Jakubec M., Manning J., Blumberg R., Waisman A., Kolář M., Kubovčiak J., Šrůtková D., Hudcovic T., Schwarzer M., Froňková E., Pinkasová T., Jabandžiev P., Filipp D. IL-17-driven induction of Paneth cell antimicrobial functions protects the host from microbiota dysbiosis and inflammation in the ileum. Mucosal Immunol. 2023;16:373–385. doi: 10.1016/j.mucimm.2023.01.005. [DOI] [PubMed] [Google Scholar]
  7. Brisbin J.T., Gong J., Parvizi P., Sharif S. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin. Vacc. Immunol. 2010;17:1337–1343. doi: 10.1128/CVI.00143-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cengiz Ö., Köksal B.H., Tatlı O., Sevim Ö., Ahsan U., Üner A.G., Ulutaş P.A., Beyaz D., Büyükyörük S., Yakan A., Önol A.G. Effect of dietary probiotic and high stocking density on the performance, carcass yield, gut microflora, and stress indicators of broilers. Poult. Sci. 2015;94:2395–2403. doi: 10.3382/ps/pev194. [DOI] [PubMed] [Google Scholar]
  9. Coffman R.L., Lebman D.A., Shrader B. Transforming growth factor beta specifically enhances IgA production by lipopolysaccharide-stimulated murine B lymphocytes. J. Exp. Med. 1989;170:1039–1044. doi: 10.1084/jem.170.3.1039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Crhanova M., Hradecka H., Faldynova M., Matulova M., Havlickova H., Sisak F., Rychlik I. Immune response of chicken gut to natural colonization by gut microflora and to Salmonella enterica serovar Enteritidis infection. Infect. Immun. 2011;79:2755–2763. doi: 10.1128/IAI.01375-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. de Oliveira J.E., van der Hoeven-Hangoor E., van de Linde I.B., Montijn R.C., van der Vossen J.M.B.M. In ovo inoculation of chicken embryos with probiotic bacteria and its effect on posthatch Salmonella susceptibility. Poult. Sci. 2014;93:818–829. doi: 10.3382/ps.2013-03409. [DOI] [PubMed] [Google Scholar]
  12. Ge Y., Huang M., Yao Y. Biology of interleukin-17 and its pathophysiological significance in sepsis. Front. Immunol. 2020;11:1558. doi: 10.3389/fimmu.2020.01558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Glick B., Chang T.S., Jaap R.G. The bursa of Fabricius and antibody production. Poult. Sci. 1956;35:224–225. [Google Scholar]
  14. Hussein E.O.S., Ahmed S.H., Abudabos A.M., Aljumaah M.R., Alkhlulaifi M.M., Nassan M.A., Suliman G.M., Naiel M.A.E., Swelum A.A. Effect of antibiotic, phytobiotic and probiotic supplementation on growth, blood indices and intestine health in broiler chicks challenged with Clostridium perfringens. Animals. 2020;10:507. doi: 10.3390/ani10030507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Junttila I.S. Tuning the cytokine responses: an update on interleukin (IL)-4 and IL-13 receptor complexes. Front. Immunol. 2018;9:888. doi: 10.3389/fimmu.2018.00888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kadam M.M., Barekatain M.R., Bhanja S.K, Iji P.A. Prospects of in ovo feeding and nutrient supplementation for poultry: the science and commercial applications - a review. J. Sci. Food Agric. 2013;93:3654–3661. doi: 10.1002/jsfa.6301. [DOI] [PubMed] [Google Scholar]
  17. Khan M.Z., Hashimoto Y. An immunohistochemical analysis of T-cell subsets in the chicken bursa of Fabricius during postnatal stages of development. J. Vet. Med. Sci. 1996;58:1231–1234. doi: 10.1292/jvms.58.12_1231. [DOI] [PubMed] [Google Scholar]
  18. Kido Y., Maeno S., Tanno H., Kichise Y., Shiwa Y., Endo A. Niche-specific adaptation of Lactobacillus helveticus strains isolated from malt whisky and dairy fermentations. Microb. Genom. 2021;7 doi: 10.1099/mgen.0.000560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim I.-J., You S.K., Kim H., Yeh H.-Y., Sharma J.M. Characteristics of bursal T lymphocytes induced by infectious bursal disease virus. J. Virol. 2000;74:8884–8892. doi: 10.1128/jvi.74.19.8884-8892.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ko K.H., Lee I.K., Kim G., Gu M.J., Kim H.Y., Park B.-C., Park T.S., Han S.H., Yun C.-H. Changes in bursal B cells in chicken during embryonic development and early life after hatching. Sci. Rep. 2018;8:16905. doi: 10.1038/s41598-018-34897-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kpodo K.R., Proszkowiec-Weglarz M. Physiological effects of in ovo delivery of bioactive substances in broiler chickens. Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1124007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. La Reau A.J., Meier-Kolthoff J.P., Suen G. Sequence-based analysis of the genus Ruminococcus resolves its phylogeny and reveals strong host association. Microb. Genom. 2016;2 doi: 10.1099/mgen.0.000099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lassila O. Emigration of B cells from chicken bursa of Fabricius. Eur. J. Immunol. 1989;19:955–958. doi: 10.1002/eji.1830190527. [DOI] [PubMed] [Google Scholar]
  24. Le Douarin N.M., Houssaint E., Jotereau F.V., Belo M. Origin of hemopoietic stem cells in embryonic bursa of Fabricius and bone marrow studied through interspecific chimeras. Proc. Natl. Acad. Sci. U.S.A. 1975;72:2701–2705. doi: 10.1073/pnas.72.7.2701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Leyva-Castillo J.M., Das M., Artru E., Yoon J., Galand C., Geha R.S. Mast cell-derived IL-13 downregulates IL-12 production by skin dendritic cells to inhibit the TH1 cell response to cutaneous antigen exposure. J. Allergy Clin. Immunol. 2021;147:2305–2315. doi: 10.1016/j.jaci.2020.11.036. e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lin A.M., Rubin C.J., Khandpur R., Wang J.Y., Riblett M., Yalavarthi S., Villanueva E.C., Shah P., Kaplan M.J., Bruce A.T. Mast cells and neutrophils release IL-17 through extracellular trap formation in psoriasis. J. Immunol. 2011;187:490–500. doi: 10.4049/jimmunol.1100123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lowenthal J.W., Connick T., McWaters P.G., York J.J. Development of T cell immune responsiveness in the chicken. Immunol. Cell Biol. 1994;72:115–122. doi: 10.1038/icb.1994.18. [DOI] [PubMed] [Google Scholar]
  28. Madej J.P., Chrząstek K., Piasecki T., Wieliczko A. New insight into the structure, development, functions and popular disorders of bursa Fabricii. Anat. Histol. Embryol. 2013;42:321–331. doi: 10.1111/ahe.12026. [DOI] [PubMed] [Google Scholar]
  29. Madej J.P., Stefaniak T., Bednarczyk M. Effect of in ovo-delivered prebiotics and synbiotics on lymphoid-organs’ morphology in chickens. Poult. Sci. 2015;94:1209–1219. doi: 10.3382/ps/pev076. [DOI] [PubMed] [Google Scholar]
  30. Miyazaki Y., Takahashi K., Akiba Y. Developmental changes in mRNA expression in immune-associated cells of intestinal tract of broiler chickens after hatch and by dietary modification. Anim. Sci. J. 2007;78:527–534. [Google Scholar]
  31. Moeller A.H., Gomes-Neto J.C., Mantz S., Kittana H., Segura Munoz R.R., Schmaltz R.J., Ramer-Tait A.E., Nachman M.W. Experimental evidence for adaptation to species-specific gut microbiota in house mice. mSphere. 2019;4:e00387-19. doi: 10.1128/mSphere.00387-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mowat A.M., Agace W.W. Regional specialization within the intestinal immune system. Nat. Rev. Immunol. 2014;14:667–685. doi: 10.1038/nri3738. [DOI] [PubMed] [Google Scholar]
  33. Nagler-Anderson C. Man the barrier! strategic defences in the intestinal mucosa. Nat. Rev. Immunol. 2001;1:59–67. doi: 10.1038/35095573. [DOI] [PubMed] [Google Scholar]
  34. Nagy N., Magyar A., Tóth M., Oláh I. Origin of the bursal secretory dendritic cell. Anat. Embryol. 2004;208:97–107. doi: 10.1007/s00429-003-0378-6. [DOI] [PubMed] [Google Scholar]
  35. Ng L.G., Sutherland A.P.R., Newton R., Qian F., Cachero T.G., Scott M.L., Thompson J.S., Wheway J., Chtanova T., Groom J., Sutton I.J., Xin C., Tangye S.G., Kalled S.L., Mackay F., Mackay C.R. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells. J. Immunol. 2004;173:807–817. doi: 10.4049/jimmunol.173.2.807. [DOI] [PubMed] [Google Scholar]
  36. Oláh I., Felföldi B., Benyeda Z., Kovács T., Nagy N., Magyar A. The bursal secretory dendritic cell (BSDC) and the enigmatic chB6+ macrophage-like cell (Mal) Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Oláh I., Glick B., Toro I. Bursal development in normal and testosterone-treated chick embryos. Poult. Sci. 1986;65:574–588. doi: 10.3382/ps.0650574. [DOI] [PubMed] [Google Scholar]
  38. Otsubo Y., Chen N., Kajiwara E., Horiuchi H., Matsuda H., Furusawa S. Role of bursin in the development of B lymphocytes in chicken embryonic bursa of Fabricius. Dev. Comp. Immunol. 2001;25:485–493. doi: 10.1016/s0145-305x(00)00070-7. [DOI] [PubMed] [Google Scholar]
  39. Palojoki E., Lassila O., Jalkanen S., Toivanen P. Involvement of the avian mu heavy chain in recolonization of the bursa of Fabricius. Scand. J. Immunol. 1992;36:251–260. doi: 10.1111/j.1365-3083.1992.tb03097.x. [DOI] [PubMed] [Google Scholar]
  40. Paramithiotis E., Ratcliffe M.J. Survivors of bursal B cell production and emigration. Poult. Sci. 1994;73:991–997. doi: 10.3382/ps.0730991. [DOI] [PubMed] [Google Scholar]
  41. Ratcliffe M.J. Antibodies, immunoglobulin genes and the bursa of Fabricius in chicken B cell development. Dev. Comp. Immunol. 2006;30:101–118. doi: 10.1016/j.dci.2005.06.018. [DOI] [PubMed] [Google Scholar]
  42. Reicher N., Melkman-Zehavi T., Dayan J., Wong E.A., Uni Z. Nutritional stimulation by in-ovo feeding modulates cellular proliferation and differentiation in the small intestinal epithelium of chicks. Anim. Nutr. 2022;8:91–101. doi: 10.1016/j.aninu.2021.06.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Romano N., Baldassini M.R., Abelli L., Aita M., Mastrolia L. Ultrastructural study on the plical epithelium of the bursa of Fabricius in chick embryos: influence of partial decerebration and hypophyseal allografts. J. Anat. 1996;188:29–41. [PMC free article] [PubMed] [Google Scholar]
  44. Saxena A., Khosraviani S., Noel S., Mohan D., Donner T., Hamad A.R.A. Interleukin-10 paradox: a potent immunoregulatory cytokine that has been difficult to harness for immunotherapy. Cytokine. 2015;74:27–34. doi: 10.1016/j.cyto.2014.10.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Schat K.A. The importance of the bursa of Fabricius, B cells and T cells for the pathogenesis of Marek's disease: a review. Viruses. 2022;14:2015. doi: 10.3390/v14092015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Schneider K. Chicken BAFF—a highly conserved cytokine that mediates B cell survival. Int. Immunol. 2004;16:139–148. doi: 10.1093/intimm/dxh015. [DOI] [PubMed] [Google Scholar]
  47. Shehata A.M., Paswan V.K., Attia Y.A., Abdel-Moneim A.-M.E., Sh. Abougabal M., Sharaf M., Elmazoudy R., Alghafari W.T., Osman M.A., Farag M.R., Alagawany M. Managing gut microbiota through in ovo nutrition influences early-life programming in broiler chickens. Animals. 2021;11:3491. doi: 10.3390/ani11123491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Sławinska A., Siwek M.Z., Bednarczyk M.F. Effects of synbiotics injected in ovo on regulation of immune-related gene expression in adult chickens. Am. J. Vet. Res. 2014;75:997–1003. doi: 10.2460/ajvr.75.11.997. [DOI] [PubMed] [Google Scholar]
  49. Smith A.L., Powers C., Beal R.K., Schat K.A., Kaspers B., Kaiser P. Pages 303-326 in Avian Immunology. Third Edition. Academic Press; Cambridge, MA: 2014. The avian enteric immune system in health and disease. [Google Scholar]
  50. Sorvari T., Sorvari R., Ruotsalainen P., Toivanen A., Toivanen P. Uptake of environmental antigens by the bursa of Fabricius. Nature. 1975;253:217–219. doi: 10.1038/253217a0. [DOI] [PubMed] [Google Scholar]
  51. Stefaniak T., Madej J.P., Graczyk S., Siwek M., Łukaszewicz E., Kowalczyk A., Sieńczyk M., Maiorano G., Bednarczyk M. Impact of prebiotics and synbiotics administered in ovo on the immune response against experimental antigens in chicken broilers. Animals. 2020;10:643. doi: 10.3390/ani10040643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Taha-Abdelaziz K., Alkie T.N., Hodgins D.C., Shojadoost B., Sharif S. Characterization of host responses induced by Toll-like receptor ligands in chicken cecal tonsil cells. Vet. Immunol. Immunopathol. 2016;174:19–25. doi: 10.1016/j.vetimm.2016.04.002. [DOI] [PubMed] [Google Scholar]
  53. Taha-Abdelaziz K., Alkie T.N., Hodgins D.C., Yitbarek A., Shojadoost B., Sharif S. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni. Vet. Microbiol. 2017;212:67–74. doi: 10.1016/j.vetmic.2017.11.010. [DOI] [PubMed] [Google Scholar]
  54. Taha-Abdelaziz K., Hodgins D.C., Lammers A., Alkie T.N., Sharif S. Effects of early feeding and dietary interventions on development of lymphoid organs and immune competence in neonatal chickens: a review. Vet. Immunol. Immunopathol. 2018;201:1–11. doi: 10.1016/j.vetimm.2018.05.001. [DOI] [PubMed] [Google Scholar]
  55. Teague K.D., Graham L.E., Dunn J.R., Cheng H.H., Anthony N., Latorre J.D., Menconi A., Wolfenden R.E., Wolfenden A.D., Mahaffey B.D., Baxter M., Hernandez-Velasco X., Merino-Guzman R., Bielke L.R., Hargis B.M., Tellez G. In ovo evaluation of FloraMax®-B11 on Marek's disease HVT vaccine protective efficacy, hatchability, microbiota composition, morphometric analysis, and Salmonella enteritidis infection in broiler chickens. Poult. Sci. 2017;96:2074–2082. doi: 10.3382/ps/pew494. [DOI] [PubMed] [Google Scholar]
  56. Udoumoh A.F., Nwaogu I.C., Igwebuike U.M., Obidike I.R. Pre-hatch and post-hatch development of the bursa of Fabricius in broiler chicken: a morphological study. Vet. Res. Forum. 2022;13:301–308. doi: 10.30466/vrf.2020.127741.2953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yoshimoto T. The hunt for the source of primary interleukin-4: how we discovered that natural killer T cells and basophils determine T helper type 2 cell differentiation in vivo. Front. Immunol. 2018;9:716. doi: 10.3389/fimmu.2018.00716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhu J., Yamane H., Paul W.E. Differentiation of effector CD4 T cell populations. Annu. Rev. Immunol. 2010;28:445–489. doi: 10.1146/annurev-immunol-030409-101212. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES