Skip to main content
Journal of Feline Medicine and Surgery logoLink to Journal of Feline Medicine and Surgery
. 2021 Oct 27;24(10):1060–1064. doi: 10.1177/1098612X211053477

Experimental infection of cats with Cryptosporidium felis

Andrea V Scorza 1,, Phyllis Tyrrell 2, Sara Wennogle 3, Ramaswamy Chandrashekar 2, Michael R Lappin 1
PMCID: PMC10812321  PMID: 34704500

Abstract

Objectives

The aims of this study were to experimentally inoculate cats with Cryptosporidium felis oocysts and compare fecal detection by fluorescent antibody assay (FA) and quantitative PCR (qPCR), and document clinical signs associated with infection.

Methods

Cryptosporidium felis oocysts were concentrated from the feces of a naturally infected cat and orally inoculated into six cats that tested negative for C felis by an FA and fecal flotation (FF). Cats were observed daily for the presence of clinical signs consistent with infection. Fecal samples from all cats on days 0 and 9, and one sample per cat (days 18–21), were evaluated by all assays. On day 31, two cats negative for C felis by FF and FA were administered methylprednisolone acetate and all assays were repeated on days 34, 36 and 38. Samples from all cats were tested by FF and FA on days 41, 43, 45 and 48.

Results

A total of 41 samples were tested, 25 of which were compared by FA and qPCR. Cryptosporidium felis was detected in 2/25 (8%) and in 19/25 (76%) samples by FA and by qPCR, respectively; the other 16 samples were tested by FF and FA. None of the cats was positive for C felis by FF or FA in samples collected on days 0, 9 or 18–21. One, five and six samples tested positive by qPCR on days 0, 9 and 18–21, respectively. The cats administered methylprednisolone acetate tested positive for C felis by FA on day 36 and by qPCR on days 31, 34, 36 and 38. None of the cats showed clinical signs of disease.

Conclusions and relevance

Clinical signs were not recognized in any of the cats for the duration of the study. FA was insensitive compared with qPCR for detecting cats with subclinical C felis infection.

Keywords: Cryptosporidium felis, qPCR, experimental infection, direct fluorescent assay

Introduction

Cryptosporidium species are protozoan parasites that inhabit the epithelium of the respiratory and digestive systems of reptiles, birds, mammals and can also be isolated from cats. 1 Cats are generally infected with Cryptosporidium felis; however, Cryptosporidium parvum and Cryptosporidium muris can also be detected.17 The risk of humans of acquiring cryptosporidiosis from cats is relatively low; C felis infection has mainly been reported in immunocompromised humans. 8 Cryptosporidium species can be primary pathogens or secondary invaders of immunosuppressed individuals. Infection occurs via the fecal–oral route, and can be subclinical, or result in acute or chronic diarrhea; clinical disease is more common in young cats. 9 Cryptosporidium species have been diagnosed in cats worldwide; a meta-analysis reported a pool prevalence of 6%.912

The fluorescent antibody assay (FA) is considered a gold standard for detection of feline cryptosporidiosis.1315 Additionally, several PCR assays have been designed to detect Cryptosporidium species in feces, reporting different sensitivities and specificities depending on whether the objective was screening or diagnosis.13,1623

The reported seroprevalence of C felis in cats has been reported to range from 8.3% to 87.0%,24,25 and the natural infection of cats has been studied; however, there are limited data available on experimental C felis infection. A few studies experimentally inoculated other Cryptosporidium species oocysts into cats, but – to our knowledge – molecularly characterized C felis oocysts have not been experimentally administered to cats.2630 The aims of this study were to infect cats with a genetically characterized C felis field isolate and follow fecal diagnostic test results and clinical findings over time.

Materials and methods

Experimental inoculation

Cryptosporidium species oocysts were collected from a naturally infected cat with diarrhea, oocysts were identified by FA (Merifluor Cryptosporidium/Giardia; Meridian Bioscience) and confirmed as C felis after Sanger sequencing of the heat shock protein 70 and 18S rRNA genes.31,32

Six domestic shorthair cats (8 months old) were purchased from a commercial breeder and housed individually. Three samples per cat collected a week prior to inoculation were negative by fecal flotation (FF) and FA. An inoculum of 5000 C felis oocysts was prepared as described previously. 33 C felis oocysts were resuspended in phosphate buffered saline and administered to each cat by stomach tube while sedated with ketamine (100 mg/ml) 25 mg intravenously (IV) and diazepam (5 mg/ml) 1 mg IV. Food was withheld for 24 h and then the cats were fed a commercial diet ad libitum and observed daily for the presence of inappetence, vomiting or diarrhea.

Assays performed

Fecal samples were evaluated by fecal flotation (1 g) using Sheather sugar solution (sg 1.26) and by FA (1 g). For FA, samples were concentrated following a published protocol, 33 and then FA was performed following the manufacturer’s instructions. Fecal samples from all six cats on days 0, 9 and one sample per cat collected between days 18 and 21 were evaluated by FA, FF and quantitative PCR (qPCR). On day 31, two cats that were negative for C felis oocysts by FF and FA were administered methylprednisolone acetate (5 mg/kg IM) and all assays repeated on days 34, 36 and 38. Samples from all cats were tested by FF and FA on days, 41, 43, 45 and 48. The sample collection was designed based on a previous study performed in our laboratory, 12 in which cats experimentally infected with C parvum oocysts showed peaks of oocyst shedding between days 2 and 15 and then between days 20 and 30.

To assess the analytical sensitivity of FA, 3 g of cat feces were mixed with dilutions of C parvum oocysts in reagent grade water, to a dilution range of 102–105/g feces and processed as described. 33 The oocysts used to determine analytical sensitivity were purchased from the Wisconsin Hygiene Laboratory. The oocysts were C parvum, Iowa strain, which were propagated in calves and counted by flow cytometry.

Fecal aliquots of each sample were stored at −20°C until shipment to IDEXX Laboratories, where qPCR was performed (IDEXX Laboratories, Westbrook, ME, USA). Fecal DNA was isolated using the High Pure PCR Template Preparation Kit (Roche Diagnostics). Cryptosporidium oocyst wall protein-specific primer and probes were designed to amplify a 336 base pair fragment common to the C felis GenBank sequences (AF266263, AY282700, JQ349377, JQ349378). Specificity was determined through alignment of the amplicon sequence against C muris, Cryptosporidium canis and C parvum oocyst wall protein (COWP) sequences. Asymmetric PCR with a locked nucleic acid dual hybridization probe was the format for the molecular detection of C felis.3436 The reactions contained 0.2 pmol felOWP forward primer (5′ CTGGTAAACAATGCGTACAGT 3′), 0.6 pmol felOWP rp361 reverse primer (5′ CATCACCTGAATCAGTATAACCAG 3′), 0.3 pmol of felOWP FL-1 donor probe (5′ GA[+C]AA[+C]AAT[+G]TATG[+G]CACC – FL 3′), 0.3 pmol felOWP LC640-1 reporter probe (5′ LC640 – AAT[+C]AA[+C]TGA[+G]TT[+G]GA[+G]T – PH 3′) (TIB MOLBIOL) and 5 μl sample DNA (LightCycler 480 Genotyping Master; Roche Diagnostics). Cycling conditions were as follows: 95°C for 10 mins and 55 amplification cycles of 95°C for 20 s, 60°C for 30 s and 72°C for 20 s. A post-amplification melt curve analysis was performed as follows: 95°C for 1 min, 45°C for 1 min and then ramp up to 80°C at a rate of 0.04°C/s. Each qPCR was run with DNA extraction negative controls (water), and both positive (C felis DNA) and negative qPCR controls.

Ethical approval

This work involved the use of experimental animals and therefore it had ethical approval from the Colorado State University Institutional Animal Care and Use Committee (12-3323A).

Results

The FA detected 3/5 fecal samples spiked with 104 C parvum oocysts/g and 5/5 fecal samples spiked with 105 C parvum oocysts/g. C felis DNA dilutions of 106 copies and 101 copies were used as qPCR positive controls. These dilutions were detected at cycles 20.74 and 38.46, respectively. The melting temperature (Tm) of C felis DNA dilutions of 106 copies and 101 copies was 66.41°C and 66.59°C, respectively. The melt curve analysis after amplification provided additional confirmation for the presence of C felis DNA.

In this pilot study, only data from days on which the diagnostic tests were compared are presented. A total of 41 samples were tested, 25 of which were compared by FA and qPCR. C felis was detected in 2/25 samples (8%) and in 19/25 (76%) by FA and by qPCR, respectively (Table 1); the other 16 samples were tested by FF and FA. None of the cats was positive for C felis oocysts by FF or FA in samples collected on days 0, 9 or 18–21. One, five and six samples tested positive by qPCR on days 0, 9 and 18–21, respectively. The two cats that were administered methylprednisolone acetate had detectable oocysts by FA only on days 34 and 36, and then on days 41–45. One of the cats shed a larger number of oocysts and the other cat shed only one oocyst/slide 2 days after immunosuppression, and then both cats shed only one oocyst/slide on days 41–45. Two of the non-immunosuppressed cats shed only 1 or 2 oocysts/slide on days 41 and 45, respectively. qPCR on samples from the two immunosuppressed cats was positive on days 31, 34 and 36 for both cats, and on day 38 for the one cat tested on that day. All the crossing points were considered positive for C felis by qPCR.

Table 1.

Experimental infection of cats with Cryptosporidium felis: results of fecal flotation (FF), fluorescent antibody assay (FA) and quantitative PCR (qPCR) for the C felis-infected cats at several points in time

Cat ID Day FFCystoisospora felis FFC felis (oocyst count) FAC felis (oocyst count) qPCR(crossing point) qPCR testedTm
HDV2 0 0 0 0 Negative ND
9 0 0 0 33.56 65.98
18–21 20 0 0 31.94 65.98
HDY2 0 0 0 0 Negative ND
9 0 0 0 37.18 66.07
18–21 0 0 0 32.27 65.90
31 2 0 0 28.97 65.85
34 16 0 68 32.84 65.95
36 106 0 0 29.53 65.83
HEF1 0 0 0 0 Negative ND
9 0 0 0 42.76 66.08
18–21 1 0 0 32.17 65.92
ODU4 0 0 0 0 Negative ND
9 0 0 0 40.25 66.15
18–21 1 0 0 30.47 65.84
OED6 0 0 0 0 Negative ND
9 0 0 0 Negative ND
18–21 41 0 0 39.82 65.99
OEE2 0 0 0 0 38.82 66.05
9 0 0 0 36.95 65.94
18–21 0 0 0 38.03 66.02
31 1 0 0 38.17 65.84
34 0 0 0 34.77 65.83
36 TNTC 0 1 33.64 65.84
38 16 0 0 40.31 65.99

ND = not detected; Negative = negative control: water (no template); Tm = temperature melting; TNTC = too numerous to count

None of the cats showed clinical signs of disease. Cystoisospora felis oocysts were detected by FF from each of the six cats over the course of the study. However, none of the cats showed signs of inappetence, vomiting or diarrhea.

Discussion

To our knowledge this is the first study to have experimentally infected cats with molecularly characterized C felis oocysts. Our findings, including the absence of clinical signs, patent period and low oocyst excretion numbers and rate, were consistent with those of previous researchers. The first study that inoculated Cryptosporidium oocysts from five naturally infected cats to four adult cats used an inoculation dose of 5 × 105 oocysts. 27 The naturally infected cats excreted numerous oocysts, while the experimentally infected cats excreted small numbers of oocysts without clinical signs. 27 In another study, kittens experimentally inoculated with C parvum excreted oocysts after a prepatent period of 2–11 days; the patent periods lasted 2–25 days and no clinical signs were observed. 28 Cryptosporidium oocysts isolated from a cat were inoculated at different doses (0.6–20 × 105) to six cats. 29 The prepatent period was 8–10 days, peak oocyst excretion was seen at 9–11 days and the duration of excretion ranged between 69 and 203 days. 29

After the administration of prednisone (10 mg/kg daily for 4–9 days) oocyst excretion restarted and the cats did not show clinical signs. 29 Cryptosporidium oocysts (calf origin) were administered at a dose of 5 × 105 to a kitten and fecal samples were analyzed for 45 days. 30

Peak oocyst excretion occurred on days 6–10 post-infection, after which shedding intensity was low, and no oocysts were detected between days 13 and 45, except on days 34–35. 30 The administration of 1 × 106 oocysts of C parvum to specific pathogen-free cats resulted in chronic infection with minimal clinical signs of disease, even after the administration of glucocorticoids. 12

Based on previous studies of Cryptosporidium species-infected cats, day 9 post-infection was chosen for sample collection. As all cats were qPCR positive for C felis on day 9, we speculate that the prepatent period for C felis is likely similar to other Cryptosporidium species.

Previous studies inoculated cats with high concentrations of oocyst and detected them by microscopic examination.2730 We believe that we detected DNA on day 9 because our inoculation dose was lower than the ones used in previous studies.

There is no known optimal dose of C felis oocysts to administer to initiate an infection. The infection dose used here was based, in part, on the number of oocysts excreted by the naturally infected cat in this study. The maximum number of oocysts that could be collected to equally administer to the six cats in the study was 5000 per cat. As naturally infected cats with and without diarrhea shed approximately 1800 oocysts/g feces and 191 oocysts/g feces respectively, 37 we considered this infection dose optimal for this pilot study. The experimentally infected cats were young adults which also may explain the absence of clinical signs.

Similar to another study, 15 FF was insensitive for the detection of fecal Cryptosporidium species shedding. In a number of studies, FA had the highest sensitivity and specificity in comparison with other diagnostic methods (FF and immunoassays) for the detection of Cryptosporidium species oocysts in cats.14,38

The reported analytical sensitivity of FA was 1000 C parvum oocysts/g feces in bovine spike samples. 15 This sensitivity is similar to the present findings, and those of a previous study in our laboratory in which FA detected 104–105 oocysts of C parvum spiked into feline feces. 13 FA was less sensitive than acid-fast staining in only one study; the authors concluded that this was due to loss of oocysts during FA washing, and the method was subsequently modified to minimize this loss. 38 In other studies, FA had a higher diagnostic sensitivity than PCR.15,16,38

Previous PCR assays designed for genotyping were less sensitive than FA for the detection of Cryptosporidium species shedding in cats,16,19,20 but PCR assays aimed at a higher sensitivity of detection have been developed whose sensitivity exceeds that of FA.21,23

The qPCR assay used in this study amplified C felis DNA from 19/25 samples (76%), while the FA detected oocysts in 2/25 samples (8%). It would have been optimal to perform the dilutions for FA using C felis oocysts; however, as there was no commercial source of C felis oocysts, C parvum oocysts were used. FA detects oocysts of several Cryptosporidium species, including C felis and C parvum, so we believe the results of our titration experiment to be accurate.16,39 The 17 samples that were positive for C felis DNA but negative for oocysts could be considered false qPCR positives or true qPCR positives. As the controls performed as expected, we believe that these discordant results were true positive qPCR results. In addition, late amplification samples were not included and melt curve analysis was performed after each run to confirm detection of C felis specific amplicon. It would have been optimal to verify the performance of our qPCR assay on fecal samples spiked with known concentrations of C felis oocysts, and on samples from naturally infected cats.

Cryptosporidium infection in immunocompromised people can cause severe diarrhea that can be fatal. 8 Although there are only a few reports of C felis infection in humans, this qPCR assay may have value in identifying cats shedding C felis living with immunocompromised owners.

Conclusions

Cats experimentally infected with a 5000 oocyst dose of a C felis field strain failed to develop clinical signs of gastrointestinal disease even when coinfected with Cystoisospora felis or after immunosuppression. The FF and FA techniques used in the study were insensitive, compared with qPCR.

Footnotes

Accepted: 17 September 2021

Author note: This manuscript was presented at the 2014 American College of Veterinary Internal Medicine Forum in Nashville, Tennessee. The abstracts program was published in the Journal of Veterinary Internal Medicine 2014; 28: 976–1134.

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding: The authors received no financial support for the research, authorship, and/or publication of this article.

Ethical approval: The work described in this manuscript involved the use of experimental animals and the study therefore had prior ethical approval from an established (or ad hoc) committee as stated in the manuscript.

Informed consent: Informed consent (verbal or written) was obtained from the owner or legal custodian of all animal(s) described in this work (experimental or non-experimental animals, including cadavers) for all procedure(s) undertaken (prospective or retrospective studies). No animals or people are identifiable within this publication, and therefore additional informed consent for publication was not required.

ORCID iD: Andrea V Scorza Inline graphic https://orcid.org/0000-0003-1839-2033

References

  • 1. Xiao L, Fayer R, Ryan U. Cryptosporidium taxonomy: recent advances and implications for public health. Clin Microbiol Rev 2004; 17: 72–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Xiao L, Feng Y. Zoonotic cryptosporidiosis. FEMS Immunol Med Microbiol 2008; 52: 309–323. [DOI] [PubMed] [Google Scholar]
  • 3. Ryan U, Zahedi A, Paparini A. Cryptosporidium in humans and animals – a one health approach to prophylaxis. Parasite Immunol 2016; 38: 535–547. [DOI] [PubMed] [Google Scholar]
  • 4. Feng Y, Ryan UM, Xiao L. Genetic diversity and population structure of Cryptosporidium. Trends Parasitol 2018; 34: 997–1011. [DOI] [PubMed] [Google Scholar]
  • 5. Santin M, Trout JM. Companion animals. In: Ortega P. (ed). Giardia and Cryptosporidium: from molecules to disease. Wallingford: CAB International, 2008, pp 437–449. [Google Scholar]
  • 6. Pavlasek I, Ryan U. The first finding of a natural infection of Cryptosporidium muris in a cat. Vet Parasitol 2007; 144: 349–352. [DOI] [PubMed] [Google Scholar]
  • 7. Fayer R, Santín M, Trout JM, et al. Detection of Cryptosporidium felis and Giardia duodenalis assemblage F in a cat colony. Vet Parasitol 2006; 140: 44–53. [DOI] [PubMed] [Google Scholar]
  • 8. Lucio-Forster A, Griffiths JK, Cama VA, et al. Minimal zoonotic risk of cryptosporidiosis from pet dogs and cats. Trends Parasitol 2010; 26: 174–179. [DOI] [PubMed] [Google Scholar]
  • 9. Scorza V, Tangtrongsup S. Update on the diagnosis and management of Cryptosporidium spp infections in dogs and cats. Top Companion Anim Med 2010; 25: 163–167. [DOI] [PubMed] [Google Scholar]
  • 10. Mtambo MMA, Nash AS, Wright SE, et al. Prevalence of specific anti-Cryptosporidium IgG, IgM and IgA antibodies in cat sera using an indirect immunofluorescence antibody test. Vet Parasitol 1995; 60: 37–43. [DOI] [PubMed] [Google Scholar]
  • 11. Scorza AV, Willmott A, Gunn-Moore D, et al. Cryptosporidium felis in faeces from cats in the UK. Vet Rec 2014; 174: 609. DOI: 10.1136/vr.102205. [DOI] [PubMed] [Google Scholar]
  • 12. Taghipour A, Olfatifar M, Bahadory S, et al. The global prevalence of Cryptosporidium infection in dogs: a systematic review and meta-analysis. Vet Parasitol 2020; 281: 109093. DOI: 10.1016/j.vetpar.2020.109093. [DOI] [PubMed] [Google Scholar]
  • 13. Scorza AV, Brewer MM, Lappin MR. Polymerase chain reaction for the detection of Cryptosporidium spp. in cat feces. J Parasitol 2003; 89: 423–426. [DOI] [PubMed] [Google Scholar]
  • 14. Mekaru SR, Marks SL, Felley AJ, et al. Comparison of direct immunofluorescence, immunoassays, and fecal flotation for detection of Cryptosporidium spp. and Giardia spp. in naturally exposed cats in 4 Northern California animal shelters. J Vet Intern Med 2007; 21: 959–965. [DOI] [PubMed] [Google Scholar]
  • 15. Xiao L, Herd RP. Quantitation of Giardia cysts and Cryptosporidium oocysts in fecal samples by direct immunofluorescence assay. J Clin Microbiol 1993; 31: 2944–2946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Tangtrongsup S, Scorza AV, Reif JS, et al. Seasonal distributions and other risk factors for Giardia duodenalis and Cryptosporidium spp. infections in dogs and cats in Chiang Mai, Thailand. Prev Vet Med 2020; 174: 104820. DOI: 10.1016/j.prevetmed.2019.104820. [DOI] [PubMed] [Google Scholar]
  • 17. de Lucio A, Bailo B, Aguilera M, et al. No molecular epidemiological evidence supporting household transmission of zoonotic Giardia duodenalis and Cryptosporidium spp. from pet dogs and cats in the province of Álava, Northern Spain. Acta Trop 2017; 170: 48–56. [DOI] [PubMed] [Google Scholar]
  • 18. Gil H, Cano L, de Lucio A, et al. Detection and molecular diversity of Giardia duodenalis and Cryptosporidium spp. in sheltered dogs and cats in Northern Spain. Infect Genet Evol 2017; 50: 62–69. [DOI] [PubMed] [Google Scholar]
  • 19. Ballweber LR, Panuska C, Huston CL, et al. Prevalence of and risk factors associated with shedding of Cryptosporidium felis in domestic cats of Mississippi and Alabama. Vet Parasitol 2009; 160: 306–310. [DOI] [PubMed] [Google Scholar]
  • 20. Kostopoulou D, Claerebout E, Arvanitis D, et al. Abundance, zoonotic potential and risk factors of intestinal parasitism amongst dog and cat populations: the scenario of Crete, Greece. Parasit Vectors 2017; 10: 43. DOI: 10.1186/s13071-017-1989-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Yang R, Ying JL, Monis P, et al. Molecular characterization of Cryptosporidium and Giardia in cats (Felis catus) in Western Australia. Exp Parasitol 2015; 155: 13–18. [DOI] [PubMed] [Google Scholar]
  • 22. Santín M, Trout JM, Vecino JA, et al. Cryptosporidium, Giardia and Enterocytozoon bieneusi in cats from Bogota (Colombia) and genotyping of isolates. Vet Parasitol 2006; 141: 334–339. [DOI] [PubMed] [Google Scholar]
  • 23. Rojas-Lopez L, Elwin K, Chalmers RM, et al. Development of a gp60-subtyping method for Cryptosporidium felis. Parasit Vectors 2020; 13: 39. DOI: 10.1186/s13071-020-3906-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. McReynolds CA, Lappin MR, Ungar B, et al. Regional seroprevalence of Cryptosporidium parvum-specific IgG of cats in the United States. Vet Parasitol 1999; 80: 187–195. [DOI] [PubMed] [Google Scholar]
  • 25. Tzipori S, Campbell I. Prevalence of Cryptosporidium antibodies in 10 animal species. J Clin Microbiol 1981; 14: 455–456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Darabus G, Olariu R. The homologous and interspecies transmission of Cryptosporidium parvum and Cryptosporidium meleagridis. Pol J Vet Sci 2003; 6: 225–228. [PubMed] [Google Scholar]
  • 27. Iseki M. Cryptosporidium felis sp. n. (Protozoa: Eimeriorina) from the domestic cat. Jpn J Parasitol 1979; 28: 285–307. [Google Scholar]
  • 28. Augustin-Bichl G, Boch J, Henkel G. Cryptosporidial infections in dogs and cats [in German]. Berl Munch Tierarztl Wochenschr 1984; 97: 179–181. [PubMed] [Google Scholar]
  • 29. Asahi H, Koyama T, Arai H, et al. Biological nature of Cryptosporidium sp. isolated from a cat. Parasitol Res 1991; 77: 237–240. [DOI] [PubMed] [Google Scholar]
  • 30. Pavlasek I. Experimental infection of cat and chicken with Cryptosporidium sp. oocysts isolated from a calf. Folia Parasitol 1983; 30: 121–122. [PubMed] [Google Scholar]
  • 31. Morgan UM, Monis PT, Xiao L, et al. Molecular and phylogenetic characterization of Cryptosporidium from birds. Int J Parasitol 2001; 31: 289–296. [DOI] [PubMed] [Google Scholar]
  • 32. Rochelle PA, De Leon R, Steward MH, et al. Comparison of primers and optimization of PCR conditions for detection of Cryptosporidium parvum and Giardia lamblia in water. Appl Environ Microbiol 1997; 63: 106–114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. O’Handley RM, Olson ME, Fraser D, et al. Prevalence and genotypic characterization of Giardia in dairy calves from Western Australia and Western Canada. Vet Parasitol 2000; 90: 193–200. [DOI] [PubMed] [Google Scholar]
  • 34. Cruz RE, Shokoples SE, Manage DP, et al. High-throughput genotyping of single nucleotide polymorphisms in the Plasmodium falciparum dhfr gene by asymmetric PCR and melt-curve analysis. J Clin Microbiol 2010; 48: 3081–3087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Lo CLH, Leung PHM, Yip SP, et al. Rapid detection of pathogenic Vibrio parahaemolyticus by a sensitive and specific duplex PCR-hybridization probes assay using LightCycler. J Applied Microbiol 2007; 105: 575–584. [DOI] [PubMed] [Google Scholar]
  • 36. Lyon E, Wittwer CT. LightCycler technology in molecular diagnostics. J Mol Diag 2009; 11: 93–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Uga S, Matsumura T, Ishibashi K, et al. Cryptosporidiosis in dogs and cats in Hyogo Prefecture, Japan. Jap J Parasitol 1989; 38: 139–143. [Google Scholar]
  • 38. Marks SL, Hanson TE, Melli AC. Comparison of direct immunofluorescence modified acid fast staining, and enzyme immunoassay techniques for detection of Cryptosporidium spp. in naturally exposed kittens. J Am Vet Med Assoc 2004; 225: 1549–1553. [DOI] [PubMed] [Google Scholar]
  • 39. Scorza AV, Lappin MR. Prevalence of selected zoonotic and vector-borne agents in dogs and cats on the Pine Ridge Reservation. Vet Sci 2017; 4: 43. DOI: 10.3390/vetsci4030043. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Feline Medicine and Surgery are provided here courtesy of SAGE Publications

RESOURCES