Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2005 Apr;43(4):1515–1521. doi: 10.1128/JCM.43.4.1515-1521.2005

Identification of Clinically Relevant Viridans Streptococci by an Oligonucleotide Array

Chao Chien Chen 1, Lee Jene Teng 2, Seng Kaiung 1, Tsung Chain Chang 1,*
PMCID: PMC1081389  PMID: 15814960

Abstract

Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.


Viridans streptococci (VS) can be isolated as part of the normal flora of the respiratory, genital, and alimentary tracts. However, some species of VS are the most common etiologic agents of subacute infective endocarditis and can cause a variety of pyogenic infections (10). Species of VS are also playing an increasing role in infections among immunocompromised patients (29). On the basis of the 16S rRNA gene sequences, species of VS are divided into five major groups: (i) the mutans group, (ii) the salivarius group, (iii) the anginosus group (also called the milleri group), (iv) the sanguinis group, and (v) the mitis group (10).

Nearly 40 conventional tests have been used to differentiate species of VS, but phenotypic tests do not allow the unequivocal identification of some species of this heterogeneous group of bacteria (2, 11, 20). This is because variability in a common phenotypic trait is common among strains of the same species (5, 19). Identification of species of the strains of S. mutans and the anginosus and mitis groups is the most problematic (13, 16, 28).

The clinical significance of VS may differ between species, and sometimes it may be important to identify the individual species associated with diseases (16). In Taiwan, it was found that VS accounted for 9% of all cases of culture-proven bacterial meningitis in adults and that species of the anginosus group comprised more than 80% of isolates of VS responsible for meningitis in adults (7). Jacobs et al. (17) studied 104 isolates of VS recovered from blood cultures and found that S. oralis and S. mitis were the two species that were the most frequently isolated from patients in the hematology unit, whereas strains of the anginosus group were the dominant species isolated from the general hospital population. Among the VS isolated from patients with significant infections, a study conducted in Taiwan revealed that high-level penicillin resistance (MICs ≥ 4 μg/ml) was frequently found in isolates of S. oralis (35%) and S. mitis (20%) (31). In addition, macrolide resistance also occurred most frequently in S. oralis isolates (55%) but in none of the S. mutans isolates (31).

Several molecular biology-based methods have been developed for the identification of VS to the species level. The targets used for molecular diagnosis include the rRNA genes (6, 9, 16, 18, 27); the tRNA gene intergenic spacer (ITS) region (14); and the genes encoding heat shock proteins (groESL) (32), manganese-dependent superoxide dismutase (sodAint) (24), and d-alanine-d-alanine ligase (13). However, strains of S. mitis and S. oralis cannot be differentiated by analyzing either the groESL gene (32) or the sodAint gene (24), as intraspecies sequence variations are higher than interspecies variations.

The 16S-23S rRNA gene ITS region separating the 16S and 23S rRNA genes has been suggested to be a good candidate for bacterial species identification (8, 26, 33) and strain typing (15). Sequences of the ITS regions have been found to have low levels of intraspecies variation and high levels of interspecies divergence (8, 26, 38). In our previous study (8), we demonstrated that species of VS could be effectively differentiated by ITS sequence analysis. On the basis of the results of the previous study, the aim of the present study was to investigate the feasibility of using a panel of oligonucleotide probes designed from the ITS regions to identify 11 clinically relevant VS to the species level by use of an oligonucleotide array.

MATERIALS AND METHODS

Bacterial strains.

A total of 211 strains were used in this study (Table 1). Among these strains, 120 (27 reference isolates and 93 clinical isolates) were strains of the 11 target species of VS and 91 (73 reference and 18 clinical isolates) were strains of other species. Reference strains were obtained from the American Type Culture Collection (ATCC; Manassas, Va.), the Bioresources Collection and Research Center (BCRC; Hsichu, Taiwan, Republic of China), and the Culture Collection of the University of Göteborg (CCUG; Göteborg, Sweden). Clinical isolates were obtained from the National Taiwan University Hospital (Taipei, Taiwan) and the National Cheng Kung University Medical Center (Tainan, Taiwan) (Table 1). Most clinical isolates were recovered from blood cultures and deep abscesses. The clinical isolates of VS were initially identified with the Rapid ID 32 STREP system (bioMérieux Vitek, Marcy l'Etoile, France) and by ITS sequence analysis (8). Clinical isolates that produced discrepant identifications with the Rapid ID 32 STREP system and by ITS sequence analysis were further identified by sequencing of their 16S rRNA gene sequences (25). All strains were subcultured on sheep blood agar, incubated at 35°C for 24 to 48 h, and then used for DNA extraction. Strains of Abiotrophia and Granulicatella were subcultured on chocolate agar.

TABLE 1.

Bacterial strains used in this study and hybridization results obtained with the oligonucleotide array

Species Reference strain(s) No. of clinical isolates Total no. of strains tested No. of strains correctly identified (misidentified)
S. anginosus ATCC 33397, ATCC 700231 7 9 9
S. constellatus ATCC 27513, ATCC 27823 18 20 20
S. gordonii ATCC 10558, ATCC 35105, ATCC 49818 3 3
S. intermedius ATCC 27335, ATCC 16106 17 19 19
S. mitis ATCC 14732 10 11 11
S. mutans ATCC 15255, ATCC 15256 2 2
S. oralis ATCC 9811, ATCC 49456, ATCC 35037, ATCC 55229, ATCC 700233, ATCC 700234 19 25 25
S. parasanguinis ATCC 15912, ATCC 15909 3 5 5
S. salivarius ATCC 13419, ATCC 7073, ATCC 25975 9 12 12
S. sanguinis ATCC 10556 10 11 11
S. uberis ATCC 13386, ATCC 700407, BCRC 12579 3 3
Abiotrophia defectiva ATCC 49176, CCUG 27805 2 0
Acinetobacter baumanii 2 2 0
Bacillus cereus BCRC 14699, BCRC 15070 2 0
Citrobacter diversus BCRC 14803 1 0
Citrobacter freundii 1 1 0
Edwardsiella tarda BCRC 16702 1 0
Acinetobacter baumannii 2 2 0
Bacillus cereus BCRC 14699, BCRC 15070 2 0
Citrobacter diversus BCRC14803 1 0
Citrobacter freundii 1 1 0
Edwardsiella tarda BCRC 16702 1 0
Enterobacter cloacae 2 2 0
Enterococcus avium BCRC 10801, CCUG 34661 2 0
Enterococcus casseliflavus ATCC 12817, CCUG 18657, BCRC 14926 3 0
Enterococcus durans ATCC 19432, CCUG 46232 2 0
Enterococcus faecalis BCRC 10066, BCRC 10789, BCRC 12301 3 0
Enterococcus faecium BCRC 10067, BCRC 12808, BCRC 12809 3 0
Enterococcus gallinarum ATCC 49573, CCUG 29831, CCUG 34517 3 0
Enterococcus hirae ATCC 8043, BCRC 11547, BCRC 12476 3 0
Enterococcus raffinosus ATCC 49427, CCUG 37864, CCUG 37865 3 0
Escherichia coli BCRC 15481, BCRC 15484 2 0
Granulicatella adiacens ATCC 49175, CCUG 27811 2 0
Granulicatella balaenopterae CCUG 37380, 2 0
Granulicatella elegans CCUG 38949, CCUG 26024, CCUG 38949 3 0
Klebsiella pneumoniae 2 2 0
Listeria monocytogenes BCRC 15329, BCRC 15338 2 0
Pseudomonas aeruginosa 2 2 0
Salmonella enterica serovar Choleraesuis BCRC 15568 1 0
Salmonella enterica serovar Typhi BCRC 14875 1 0
Serratia marcescens 2 2 0
Shigella flexneri BCRC 15964 1 2 0
Staphylococcus aureus BCRC 14946, BCRC 14959 2 0
Staphylococcus haemolyticus BCRC 15238 1 0
Staphylococcus saprophyticus BCRC 15283 1 0
Stenotraphomonas maltophilia 2 2 0
Streptococcus agalactiae ATCC 13813 1 0
Streptococcus bovis ATCC 33317 1 0
Streptococcus equi BCRC 14747 1 0
Streptococcus equinus BCRC 12578, CCUG 38926 2 0
Streptococcus equisimilis ATCC 9542, ATCC 35666, CCUG 27479, CCUG 27483 4 0
Streptococcus gallolyticus ATCC 43143, ATCC 9809 1 3 0
Streptococcus pasteurianus ATCC 43144, CCUG 35885 2 0
Streptococcus pneumoniae ATCC 6301, BCRC 14733, BCRC 10794, BCRC 16014 4 (4)a
Streptococcus pyogenes ATCC 14289, BCRC 10797 2 0
Streptococcus zooepidemicus BCRC 14756, BCRC 15414 2 0
Vibrio parahaemolyticus BCRC 10806, BCRC 12864 2 0
Yersinia enterocolitica BCRC 13999 1 0
a

Misidentified as S. mitis.

DNA preparation.

The boiling method was used to extract DNA from the bacteria (34). Briefly, colonies of pure cultures were suspended in 50 μl of sterilized water and heated at 100°C for 15 min in a heating block. After centrifugation in a microcentrifuge (8,000 × g for 10 min), the supernatant containing bacterial DNA was stored at −20°C for further use.

Amplification of ITS fragments for hybridization.

The bacterium-specific universal primers 13BF (5′-GTGAATACGTTCCCGGGCCT-3′) and 6R (5′-GGGTTYCCCCRTTCRGAAAT-3′) (where Y is C or T and R is A or G) were used to amplify a DNA fragment that encompassed a small portion of the 16S rRNA gene region, the ITS region, and a small portion of the 23S rRNA gene region (25). Reverse primer 6R was labeled with digoxigenin at its 5′ end and was obtained from MDBio Inc. (Taipei, Taiwan). The 5′ end of primer 13BF is located at position 1371 of the 16S rRNA gene, and the 5′ end of primer 6R is located at position 108 downstream of the 5′ end of the 23S rRNA gene (Escherichia coli numbering). PCR was performed with 5 μl (1 to 5 ng) of template DNA in a total reaction volume of 50 μl consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.8 mM deoxyribonucleoside triphosphates (0.2 mM each), 0.1 μM (each) primer, 1 U of Taq DNA polymerase, 10 μM digoxigenin-11-dUTP (Roche, Mannheim, Germany), and 50 μl of a mineral oil overlay. The PCR program consisted of 8 cycles of denaturation (94°C for 2 min), annealing (55°C for 1 min), and extension (72°C for 1 min), followed by 30 cycles of denaturation (94°C for 1 min), annealing (60°C for 1 min), and extension (72°C for 1 min) and a final extension step at 72°C for 3 min. An OmniGen thermal cycler (Hybaid Limited, Middlesex, United Kingdom) was used for PCR. DNA extracted from Xanthobacter flavus BCRC 12271 was used as a positive control.

Design of species-specific oligonucleotide probes.

The species-specific oligonucleotide probes (20- to 31-mers) used for identification of the 11 species of VS were designed from the ITS sequences determined in our previous study (8), and their GenBank accession numbers are indicated in Table 2. The ITS sequences of different species were aligned by using the PileUp command of the Wisconsin Genetics Computer Group Package (version 10.3; Accelrys Inc., San Diego, Calif.). The probes that were designed were first screened against the sequences in the GenBank database to detect homology with the sequences of other bacteria; and a total of 19 probes, including 2 positive control probes (probes designed from the ITS sequence of X. flavus), were used for fabrication of the oligonucleotide array (Table 2). The 19 probes had a wide range of melting temperatures (Tms; 43.6 to 60°C). Multiple probes were used to identify S. sanguinis (two probes), S. uberis (three probes), S. intermedius (three probes), and S. salivarius (two probes), whereas only one probe was designed for the identification of each of the remaining seven species of VS (Table 2).

TABLE 2.

Oligonucleotide probes used in this study

Microorganism Probe codea Sequenceb (5′ to 3′) Probe locationc Length (mer) Tmd (°C) GenBank accession no.
S. parasanguinis ATCC 15912 1 ACACTATAGTAGTGTTAAGC 130-149 20 43.6 AY351320
X. flavus BCRC 12271 2e GCTGTATGACATCGTGAATAGGGCATT 577-603 27 60 AY684797
X. flavus BCRC 12271 3e TTCTGACTTAAGATGTCGGAAGCGTTT 490-516 27 60 AY684797
Negative control 4-8f
S. sanguinis ATCC 10556 9 GACACACGGAATGCACTTGA 17-36 20 53.1 AY347565
S. sanguinis ATCC 10556 10 TCTAGTTTGACTAGATAAAGAACTT 141-163 25 48.2 AY347565
S. anginosus ATCC 33397 11 AGAATCCTACTGAACTTAATAAAGAAGTGAT 137-166 31 52.7 AY347541
S. uberis ATCC 13386 12 AAGGATAAGGAACACGTTGGTTAAGTCTT 1-27 29 49 AY347566
S. uberis ATCC 13386 13 GGATACAGTTCAACTGAACTTAATA 149-173 25 47.3 AY347566
S. uberis ATCC 13386 14 CATTGTATCTTAGTATAGTCCATTG 184-280 25 52.1 AY347566
S. mutans ATCC 31377 15 ATCTAGGATACAAAGAGATGTTCGG 258-282 25 52.1 AY351324
S. gordonii ATCC 10558 16 GAAGTTCCAAACTAGTCCATTG 136-158 22 49.3 AY353081
S. mitis BCRC 14732 17 AATAAAACCGAAAACGCTGTAGT 190-211 23 44.8 AY347550
S. oralis BCRC 14749 18 AATAAAACCGAAACGCTGTAGT 190-210 22 44.1 AY347551
S. constellatus ATCC 27513 19 ATCTAGGATGCAAAGAAATGAGATT 129-151 25 50.6 AY347545
S. intermedius ATCC 27335 20 AGGATATGGAATTCACCTTTAGTTG 132-156 25 50.9 AY347549
S. intermedius ATCC 27335 21 ATGATATCCTAAAGTAGCACATTGA 157-181 25 49.9 AY347549
S. intermedius ATCC 27335 22 TTTAGTTGATGATATCCTAAAGTAG 149-173 25 46.3 AY347549
S. salivarius ATCC 13419 23 CATATGTAATTACTTACATATAGATAGTAA 184-213 30 46.1 AY347562
S. salivarius ATCC 13419 24 CTAAGGAAAACGGAATGTACTTGAG 1-26 25 52.1 AY347562
a

Oligonucleotide probes are arranged on the array as indicated in Fig. 1.

b

Ten thymine bases were added to the 3′ end of each probe.

c

The locations of the probes are shown by the nucleotide number of the ITS sequence of the respective strain.

d

Tm was calculated with the melttemp command in the Wisconsin Genetics Computer Group Package (Accelrys Inc.), based on a 50 mM Na+ concentration.

e

Probes 2 and 3 were used as positive controls.

f

Spots 4 to 8 in Fig. 1 contained dye only and were used as negative controls.

Preparation of oligonucleotide arrays.

The arrays (3.5 by 8.5 mm) were made in batches of 20. The oligonucleotide probes were diluted 1:1 (final concentration, 10 μM) with a tracking dye solution (30% [vol/vol] glycerol, 40% [vol/vol] dimethyl sulfoxide, 1 mM EDTA [EDTA, disodium salt], 0.15% [wt/vol] bromophenol blue, 10 mM Tris-HCl [pH 7.5]). The probe solutions were drawn into different wells of a round-bottom microtiter plate and spotted onto a positively charged nylon membrane (Roche) with an automatic arrayer (Wittech, Taipei, Taiwan) by use of a solid pin (diameter, 500 μm). The array contained 24 dots, including 17 dots for the 11 target species of VS, 2 dots for positive controls (probes designed from the ITS region of X. flavus), and 5 dots for negative controls (dye only). Once all the probes had been applied, the membrane was dried and exposed to short-wave UV light (Stratalinker 1800; Stratagene, La Jolla, Calif.) for 30 s. Unbound oligonucleotides were removed by two washes (for 2 min each time) at room temperature in 0.5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS). The arrays were air dried and stored at room temperature for further use.

Hybridization procedures.

Unless indicated otherwise, the hybridization procedures were carried out at room temperature in a hybridization oven with a shaking speed of 60 rpm. All reagents except the buffers used for hybridization were included in the DIG Nucleic Acid Detection kit (catalog no. 1175041; Roche). Each array was prehybridized for 2 h with 1 ml of hybridization solution (5× SSC, 1% [wt/vol] blocking reagent, 0.1% N-laurylsarcosine, 0.02% SDS) in an individual well of a 24-well cell culture plate. The digoxigenin-labeled PCR product amplified from an isolate was heated in a boiling water bath for 5 min and immediately cooled on an ice bath. Ten microliters of denatured PCR product of the test organism and 10 μl of the denatured PCR product amplified from X. flavus (the positive control) were diluted with 0.5 ml of hybridization solution and added to each well. Hybridization was conducted at 50°C for 90 min. After the nonhybridized PCR products were removed, the array was washed four times (for 5 min each time) in 1 ml of washing buffer (0.25× SSC, 0.1% SDS), followed by blocking for 1 h with 1 ml of blocking solution (1% [wt/vol] blocking reagent dissolved in maleic acid buffer [0.1 M maleic acid, 0.15 M NaCl {pH 7.5}]). The blocking solution was then removed, 0.5 ml of alkaline phosphatase-conjugated sheep antidigoxigenin antibodies (diluted 1:2,500 in blocking solution) was added to each well, and the plate was incubated for 1 h. The array was washed three times (for 15 min each time) in 1 ml of washing solution (0.3% [vol/vol] Tween 20 in maleic acid buffer), followed by washing in 1 ml of detection buffer (0.1 M Tris-HCl, 0.15 M NaCl [pH 9.5]) for 5 min. Finally, 0.5 ml of alkaline phosphatase substrate (a stock solution of nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolylphosphate diluted 1:50 in detection buffer) was added to each well and the plate was incubated at 37°C (without shaking). Color development was clearly visible between 30 min and 1 h after the start of the reaction.

Definition of positive reaction, sensitivity, and specificity.

A strain was identified as 1 of the 11 target species of VS when the probe (or all probes) designed to be specific for the species and the two positive control probes (Fig. 1, probes 2 and 3) hybridized. Sensitivity was defined as the number of strains of the target species correctly identified by the array (true positives) divided by the total number of strains of that species tested. Specificity was defined as the number of strains of nontarget microorganisms producing negative hybridization reactions (true negatives) divided by total number of strains of that species tested (22).

FIG. 1.

FIG. 1.

Hybridization of 11 species of VS and other microorganisms to the oligonucleotide arrays. The positions of oligonucleotide probes are indicated in the upper left-hand array, and their sequences are indicated in Table 2. The strain tested is indicated at the bottom of each array. Probes 2 and 3 are positive control probes designed from the ITS region of X. flavus BCRC 12271. Probes 4 to 8 are negative controls (tracking dye only).

RESULTS

Hybridization of VS to the oligonucleotide array.

Of 120 strains (27 reference strains and 93 clinical isolates) belonging to the 11 target species of VS, all strains hybridized to the respective oligonucleotide probe(s) designed for each species (Table 1). Figure 1 shows the hybridization results for the reference strains of VS and the other bacterial species. Since all target strains were correctly identified, the sensitivity of the oligonucleotide array for the identification of the 11 species of VS was 100% (120 of 120 strains). Although the ITS sequences of S. mitis and S. oralis have rather high degrees of similarity (0.93 to 0.95) (8), S. mitis could be effectively differentiated from S. oralis by the oligonucleotide array (Fig. 1G and H).

Multiple probes were used to identify S. sanguinis (two probes), S. uberis (three probes), S. intermedius (three probes), and S. salivarius (two probes). In general, probes with higher Tms tend to produce stronger hybridization signals. For example, probe 23 (Tm = 46.1°C) and probe 24 (Tm = 52.1°C) were used to identify S. salivarius (Table 2), but the hybridization signal of probe 24 was much stronger than that of probe 23 (Fig. 1K). The same phenomenon was observed for the probes used to identify S. sanguinis (Fig. 1B): the signal of probe 9 (Tm = 51.1°C) was evidently stronger than that of probe 10 (Tm = 48.2°C). However, this generality was not always true. For example, probes 12 (Tm = 49°C), 13 (Tm = 47.3°C), and 14 (Tm = 52.1°C) were designed to identify S. uberis; however, probe 12 produced the most intense hybridization signal (Fig. 1D), although probe 13 still had the weakest signal.

Hybridization of other bacteria to the oligonucleotide array.

Ninety-one strains (47 species) of other bacteria, including non-VS, nutritionally variant streptococci (Abiotrophia and Granulicatella), enterococci, staphylococci, and several gram-negative bacteria, were used to test the specificity of the oligonucleotide array. All four reference strains of S. pneumoniae cross-hybridized to probe 17 (Fig. 1N), which was designed to identify S. mitis. However, 87 strains of other bacteria did not cross-hybridize with any of the 17 probes immobilized on the nylon membrane. On the basis of the results obtained with the array, a specificity of 95.6% (87 of 91 strains) for the identification of species of VS by the present array was obtained.

DISCUSSION

Conventional phenotypic tests have already been proven to be difficult for the identification of some species of VS (2, 11, 20). In this study, a reverse hybridization method that could identify 11 species of VS was developed. The 11 target species represented >96% of the identified species of VS isolated from sterile body fluids in the National Taiwan University Hospital (data not shown), with the remaining 2 species being S. sobrinus and S. vestibularis. A pair of universal primers was used to amplify the bacterial ITS regions, followed by hybridization of the digoxigenin-labeled PCR products to the oligonucleotide array. The hybridized spot (diameter, 0.5 mm), which appeared in blue on the white nylon membrane, could easily be read with the naked eye. The whole procedure for the present array method could be finished within a working day (approximately 8 h), starting from the time of colony isolation.

The DNA array (or DNA chip) technology has been found to be a useful tool for the identification of a variety of bacteria, especially those bacteria that are difficult to differentiate by conventional methods and those bacteria for which the identification procedure may take a long time. This methodology has been used to identify Mycobacterium species (12), bacteria in positive blood cultures (3), Campylobacter species (35), Listeria species (36), ammonia-oxidizing bacteria (1), and pathogenic bacteria in cervical swab specimens (23). A variety of target genes encoding the DNA gyrase B subunit (12), the 23S rRNA gene (3, 23), the 16S rRNA gene (1), and other specific genes (35, 36) have been used in hybridization assays. The DNA array generally comprises a solid phase (glass or a membrane) on which multiple DNA probes with known identities are fixed for hybridization with DNA samples.

The good performance of the present array might be due to the fact that the ITS sequence is species specific (11, 17, 18, 27, 28). The region was found to have low levels of intraspecies variation and high levels of interspecies divergence (8, 38) and has been suggested to be a good candidate for bacterial species identification (4). The array used in this study may have the potential to be continually extended by adding additional oligonucleotides to the panel without significantly increasing its cost or complexity.

Although the Tms of some of the probes listed in Table 2 were lower than the array hybridization temperature (50°C), clear hybridization signals were obtained with these probes (Fig. 1). For example, probes 1 (Tm = 43.6°C) and 18 (Tm = 44.1°C), used for the identification of S. parasanguinis and S. oralis, respectively, produced signals that were easily recognized. These results might be partially due to the use of a relatively low stringency buffer (which has a high ionic strength [5× SSC] and a low concentration of detergent [0.02% SDS]) for the hybridization reaction. Volokhov et al. (36) also used several probes with Tms (40 to 44°C) lower than the hybridization temperature (45°C) for the identification of Listeria spp. and obtained good hybridization results.

Although a variety of non-VS (91 strains representing 47 species; Table 1) were used for specificity testing, it does not completely exclude the possibility of cross-hybridization with other bacteria. Therefore, strains should be confirmed to be gram-positive and catalase-negative cocci before they are tested with the array. Multiple probes were used to identify S. sanguinis, S. uberis, S. intermedius, and S. salivarius (Table 2 and Fig. 1). Some of these multiple probes (Table 1, probes 13 and 23) produced relatively weak signals (Fig. 1D and K), and in further applications, it may not be necessary to keep these two probes on the array.

Strains of S. oralis and S. mitis, the two most frequently isolated species of VS from patients in the hematology unit, are difficult to differentiate by analysis of their 16S rRNA gene sequences. The 16S rRNA gene sequence identity of type strains of S. oralis (ATCC 35037) and S. mitis (ATCC 49456) is greater than 99% (18). They also cannot be differentiated by sequence analysis of the groESL (32) and sodAint (24) genes because the intraspecies sequence variations may be higher than the interspecies variations. In addition, it was found that the ITS sequences of S. mitis and S. oralis have high degrees of similarity that range from 0.93 to 0.95 (8). However, strains of S. oralis have single nucleotide deletions at positions 199 and 217 of the ITS sequence of S. mitis. In other words, the ITS region of S. mitis strains is 2 nucleotides longer than that of S. mitis strains. The probes used to differentiate the two species were designed from positions 190 to 210 (or 211) (Table 2) of the ITS regions, and this design made the deletion (or insertion) base at about the midpoints of the probes. This design could effectively differentiate these two closely related species (Fig. 1G and H).

In this study, all S. pneumoniae strains cross-hybridized to the probes used for the identification of S. mitis (Table 1; Fig. 1N). Therefore, S. pneumoniae was misidentified as S. mitis by the array method. For this reason, simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. The cross-hybridization was not unexpected, since the two species have almost identical ITS sequences. The ITS sequence similarity between the type strains of S. pneumoniae (ATCC 33400) and S. mitis (ATCC 49456) is 0.99 (8). Phylogenetic trees constructed by using the genes encoding groESL (32), sodAint (24), the 16S rRNA gene (6, 18), and the ITS region (8) grouped S. mitis and S. pneumoniae together.

The anginosus group contains three species: S. anginosus, S. constellatus, and S. intermedius. S. anginosus isolates are commonly isolated from urogenital and gastrointestinal sources, and S. constellatus is often isolated from respiratory and many other sources, while S. intermedius strains are commonly recovered from brain and liver abscesses (10). The classification and identification of members of the anginosus group have caused a lot of confusion. There are beta-hemolytic strains of each of the three species, and the strains may possess one of four different Lancefield group antigens (F, C, A, and G) or have no group antigen (10). Adding to the confusion is the fact that non-beta-hemolytic strains are more common than beta-hemolytic strains (10). Some investigators (30, 37, 39) have proposed the use of identification systems based on several enzymatic activities, carbohydrate fermentation, and biochemical and serological tests to differentiate members of the anginosus group. Limia et al. (21) found that the Rapid ID 32 STREP system was particularly inaccurate when it was used for the identification of isolates in the anginosus group, with an identification rate of only 57% for S. intermedius strains. However, the three species were effectively differentiated by the present oligonucleotide array (Table 1; Fig. 1C, I, and J).

In conclusion, the identification of clinically relevant species of VS by the oligonucleotide array seems to be reliable, and the array method could be used as an accurate alternative for the identification of these microorganisms. The assay may have the potential to be continually extended by adding specific oligonucleotides to the panel to identify more microorganisms.

Acknowledgments

This project was supported by grants (NSC 93-2323-B006-007 and NSC 93-2323-B006-006) from the National Science Council and, in part, by grants from the Department of Medical Research of the National Taiwan University Hospital, Taipei, Taiwan.

REFERENCES

  • 1.Adamczyk, J., M. Hesselsoe, N. Iversen, M. Horn, A. Lehner, P. H. Nielsen, M. Schloter, P. Roslev, and M. Wagner. 2003. The isotope array, a new tool that employs substrate-mediated labeling of rRNA for determination of microbial community structure and function. Appl. Environ. Microbiol. 69:6875-6887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ahmet, Z., M. Warren, and E. T. Houang. 1995. Species identification of members of the Streptococcus milleri group isolated from the vagina by ID 32 Strep system and differential phenotypic characteristics. J. Clin. Microbiol. 33:1592-1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Anthony, R. M., T. J. Brown, and G. L. French. 2000. Rapid diagnosis of bacteremia by universal amplification of 23S ribosomal DNA followed by hybridization to an oligonucleotide array. J. Clin. Microbiol. 38:781-788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Barry, T., G. Colleran, M. Glennon, L. K. Dunican, and F. Gannon. 1991. The 16S/23S ribosomal spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl. 1:51-56. [DOI] [PubMed] [Google Scholar]
  • 5.Beighton, D., J. M. Hardie, and A. Whiley. 1991. A scheme for the identification of viridans streptococci. J. Med. Microbiol. 35:367-372. [DOI] [PubMed] [Google Scholar]
  • 6.Bentley, R. W., J. A. Leigh, and M. D. Collins. 1991. Intrageneric structure of Streptococcus based on comparative analysis of small-subunit rRNA sequences. Int. J. Syst. Bacteriol. 41:487-494. [DOI] [PubMed] [Google Scholar]
  • 7.Chang, W. N., J. J. Wu, C. R. Huang, Y. C. Tsai, C. C. Chien, and C. H. Lu. 2002. Identification of viridans streptococcal species causing bacterial meningitis in adults in Taiwan. Eur. J. Clin. Microbiol. Infect. Dis. 21:393-396. [DOI] [PubMed] [Google Scholar]
  • 8.Chen, C. C., L. J. Teng, and T. C. Chang. 2004. Identification of clinically relevant viridans streptococci by sequence analysis of the 16S-23S rDNA spacer region. J. Clin. Microbiol. 42:2651-2657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Clarridge, J. E., III, S. M. Attorri, Q. Zhang, and J. Bartell. 2001. 16S ribosomal DNA sequence analysis distinguishes biotypes of Streptococcus bovis: Streptococcus bovis biotype II/2 is a separate genospecies and the predominant clinical isolate in adult males. J. Clin. Microbiol. 39:1549-1552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Facklam, R. 2002. What happed to the streptococci: overview of taxonomic and nomenclature changes. Clin. Microbiol. Rev. 15:613-630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Flynn, C. E., and K. L. Ruoff. 1995. Identification of Streptococcus milleri group isolates to the species level with a commercially available rapid test. J. Clin. Microbiol. 33:2704-2706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fukushima, M., K. Kakinuma, H. Hayashi, H. Nagai, K. Ito, and R. Kawaguchi. 2003. Detection and identification of Mycobacterium species isolates by DNA microarray. J. Clin. Microbiol. 41:2605-2615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Garnier, F., G. Gerbaud, P. Courvalin, and M. Galimand. 1997. Identification of clinically relevant viridans group streptococci to the species level by PCR. J. Clin. Microbiol. 35:2337-2341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gheldre, Y. D., P. Vandamme, H. Goossens, and M. J. Struelens. 1999. Identification of clinically relevant viridans streptococci by analysis of transfer DNA intergenic spacer length polymorphism. Int. J. Syst. Bacteriol. 49:1591-1598. [DOI] [PubMed] [Google Scholar]
  • 15.Gurtler, V., and V. A. Stanisich. 1996. New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology 142:3-16. [DOI] [PubMed] [Google Scholar]
  • 16.Jacobs, J. A., C. S. Schot, A. E. Bunschoten, and L. M. Schouls. 1996. Rapid species identification of “Streptococcus milleri” strains by line blot hybridization: identification of a distinct 16S rRNA population closely related to Streptococcus constellatus. J. Clin. Microbiol. 34:1717-1721. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jacobs, J. A., H. C. Schouten, E. E. Stobberingh, and P. B. Soeters. 1995. Viridans streptococci isolated from the bloodstream. Relevance of species identification. Diagn. Microbiol. Infect. Dis. 22:267-273. [DOI] [PubMed] [Google Scholar]
  • 18.Kawamura, Y., X. Hou, F. Sultana, H. Miura, and T. Ezaki. 1995. Determination of 16S rRNA sequences of Streptococcus mitis and Streptococcus gordonii and phylogenetic relationships among members of the genus Streptococcus. Int. J. Syst. Bacteriol. 45:406-408. [DOI] [PubMed] [Google Scholar]
  • 19.Kilian, M., L. Mikkelsen, and J. Henrichsen. 1989. Taxonomic studies of viridans streptococci: description of Streptococcus gordonii sp. nov. and emended descriptions of Streptococcus sanguis (White and Niven 1946), Streptococcus oralis (Bridge and Sneath 1982), and Streptococcus mitis (Andrewes and Horder 1906). Int. J. Syst. Bacteriol. 39:471-484. [Google Scholar]
  • 20.Kilpper-Bälz, R., B. L. Williams, R. Lutticken, and K. H. Schleifer. 1984. Relatedness of “Streptococcus milleri” with Streptococcus anginosus and Streptococcus constellatus. Syst. Appl. Microbiol. 5:494-500. [Google Scholar]
  • 21.Limia, A., T. Alarcon, M. L. Jimenez, and M. Lopez-Brea. 2000. Comparison of three methods for identification of Streptococcus milleri group isolates to species level. Eur. J. Clin. Microbiol. Infect. Dis. 19:128-131. [DOI] [PubMed] [Google Scholar]
  • 22.McClure, F. D. 1990. Design and analysis of quantitative collaborative studies: minimum collaborative program. J. Assoc. Off. Anal. Chem. 73:953-960. [PubMed] [Google Scholar]
  • 23.Mitterer, G., M. Huber, E. Leidinger, C. Kirisits, W. Lubitz, M. W. Mueller, and W. M. Schmidt. 2004. Microarray-based identification of bacteria in clinical samples by solid-phase PCR amplification of 23S ribosomal DNA sequences J. Clin. Microbiol. 42:1048-1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Poyart, C., G. Quesne, S. Coulon, P. Berche, and P. Trieu-Cuot. 1998. Identification of streptococci to species level by sequencing the gene encoding the manganese-dependent superoxide dismutase. J. Clin. Microbiol. 36:41-47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Relman, D. A. 1993. Universal bacterial 16S rDNA amplification and sequencing, p. 489-495. In D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology. American Society for Microbiology, Washington, D.C.
  • 26.Roth, A., M. Fischer, M. E. Hamid, S. Michalke, W. Ludwig, and H. Mauch. 1998. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences. J. Clin. Microbiol. 36:139-147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Saarela, M., S. Alaluusua, T. Takei, and S. Asikainen. 1993. Genetic diversity within isolates of mutans streptococci recognized by an rRNA gene probe. J. Clin. Microbiol. 31:584-587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Schmidhuber, S., W. Ludwig, and K. H. Schleifer. 1988. Construction of a DNA probe for the specific identification of Streptococcus oralis. J. Clin. Microbiol. 26:1042-1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shenep, J. L. 2000. Viridans-group streptococcal infections in immunocompromised hosts. Int. J. Antimicrob. Agents 14:129-135. [DOI] [PubMed] [Google Scholar]
  • 30.Taketoshi, M., K. Kitada, T. Yakushiji, and M. Inoue. 1993. Enzymatic differentiation and biochemical and serological characteristics of the clinical isolates of Streptococcus anginosus, S. intermedius, and S. constellatus. Microbiology 76:115-129. [PubMed] [Google Scholar]
  • 31.Teng, L. J., P. R. Hsueh, S. W. Ho, and K. T. Luh. 1998. Antimicrobial susceptibility of viridans group streptococci in Taiwan with an emphasis on the high rates of resistance to penicillin and erythromycin in Streptococcus oralis. J. Antimicrob. Chemother. 41:621-627. [DOI] [PubMed] [Google Scholar]
  • 32.Teng, L.-J., P.-R. Hsueh, J.-C. Tsai, P.-W. Chen, J.-C. Hsu, H.-C. Lai, C.-N. Lee, and S.-W Ho. 2002. groESL sequence determination, phylogenetic analysis, and species differentiation for viridans group streptococci. J. Clin. Microbiol. 40:3172-3178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Uemori, T., K. Asada, I. Kato, and R. Harasawa. 1992. Amplification of the 16S-23S spacer region in rRNA operons of mycoplasmas by the polymerase chain reaction. Syst. Appl. Microbiol. 15:181-186. [Google Scholar]
  • 34.Vaneechoutte, M., L. Dijkshoorn, I. Tjernberg, A. Elaichouni, P. de Vos, G. Claeys, and G. Verschraegen. 1995. Identification of Acinetobacter genomic species by amplified ribosomal DNA restriction analysis. J. Clin. Microbiol. 33:11-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Volokhov, D., V. Chizhikov, K. Chumakov, and A. Rasooly. 2003. Microarray-based identification of thermophilic Campylobacter jejuni, C. coli, C. lari, and C. upsaliensis. J. Clin. Microbiol. 41:4071-4080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Volokhov, D., A. Rasooly, K. Chumakov, and V. Chizhikov. 2002. Identification of Listeria species by microarray-based assay. J. Clin. Microbiol. 40:4720-4728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Whiley, R. A., D. Beighton, T. G. Winstanley, H. Y. Fraser, and J. M. Hardie. 1992. Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus (the Streptococcus milleri group): association with different body sites and clinical infections. J. Clin. Microbiol. 30:243-244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Whiley, R. A., B. Duke, J. M. Hardie, and L. M. C. Hall. 1995. Heterogeneity among 16S-23S rRNA intergenic spacers of species within the “Streptococcus milleri group.” Microbiology 141:1461-1467. [DOI] [PubMed] [Google Scholar]
  • 39.Whiley, R. A., H. Fraser, J. M. Hardie, and D. Beighton. 1990. Phenotypic differentiation of Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus strains within the “Streptococcus milleri group.” J. Clin. Microbiol. 48:1497-1501. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES