Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Feb 1.
Published in final edited form as: Cancer Gene Ther. 2022 Jul 28;29(12):1961–1974. doi: 10.1038/s41417-022-00512-y

CYP2E1-dependent upregulation of SIRT7 is response to alcohol mediated metastasis in hepatocellular carcinoma

Chen Zhang 1,2,3,8, Jinqiu Zhao 4,8, Jie Zhao 5, Bohao Liu 1,2,3, Wenbin Tang 1,2,3, Yi Liu 6, Wenxiang Huang 4, Steven A Weinman 5,7, Zhuan Li 1,2,3,5,✉
PMCID: PMC10832389  NIHMSID: NIHMS1959789  PMID: 35902730

Abstract

Long-term alcohol use is a confirmed risk factor of liver cancer tumorigenesis and metastasis. Multiple mechanisms responsible for alcohol related tumorigenesis have been proposed, including toxic reactive metabolite production, oxidative stress and fat accumulation. However, mechanisms underlying alcohol-mediated liver cancer metastasis remain largely unknown. We have previously demonstrated that SIRT7 regulates chemosensitivity by altering a p53-dependent pathway in human HCC. In the current study, we further revealed that SIRT7 is a critical factor in promoting liver cancer metastasis. SIRT7 expression is associated with disease stage and high SIRT7 predicts worse overall and disease-free survival. Overexpression of SIRT7 promotes HCC cell migration and EMT while knockdown of SIRT7 showed opposite effects. Mechanistically, we found that SIRT7 suppresses E-Cadherin expression through FOXO3-dependent promoter binding and H3K18 deacetylation. Knockdown of FOXO3 abolished the suppressive effect of SIRT7 on E-cadherin transcription. More importantly, we identified that alcohol treatment upregulates SIRT7 and suppresses E-cadherin expression via a CYP2E/ROS axis in hepatocytes both in vitro and in vivo. Antioxidant treatment in primary hepatocyte or CYP2E1−/− mice fed with alcohol impaired those effects. Reducing SIRT7 activity completely abolished alcohol-mediated promotion of liver cancer metastasis in vivo. Taken together, our data reveal that SIRT7 is a pivotal regulator of alcohol-mediated HCC metastasis.

BACKGROUND

Hepatocellular carcinoma (HCC), the most common pathological form of primary liver cancer, is the fifth leading cause of cancer-related human death worldwide and its incidence is still increasing [1]. Despite great efforts made during the last decades to improve diagnosis and treatment for intrahepatic lesions, advanced HCC often has a poor prognosis with a five-year survival rate less than 18% mainly due to drug resistance, tumor metastasis and recurrence [1, 2]. While extensive research has identified a number of molecular biomarkers, cellular networks and signaling pathways affected in liver cancer, mechanisms underlying tumor metastasis are poorly understood [2].

Alcohol is a confirmed risk factor of liver cancer and long-term alcohol use has been linked to an increased risk of liver cancer tumorigenesis as well as distant metastasis [3–6]. It appears that there is linear dose–response relationship between alcohol consumption and liver cancer progression. Multiple mechanisms are responsible for alcohol related tumorigenesis, including production of toxic reactive metabolites, oxidative stress and fat accumulation in hepatocytes. All of these pathological changes result in hepatocyte death, inflammation, fibrosis deposition and ultimately liver cancer [4, 7, 8]. There is clear evidence that alcohol increases HCC cell migration in vitro [9] and chronic alcohol exposure promotes HCC metastasis in vivo [10]. Alcohol exposure causes cancer stem cell activation and WNT/β-catenin dependent epithelial-mesenchymal transition (EMT) [9, 10], both of which are reported to facilitate cancer cell metastasis [11]. However, mechanisms and factors responsible for alcohol-mediated liver cancer metastasis remain largely unknown. Notably, one of the most significant events occurring after alcohol exposure is the induction of cytochrome P450 2E1 (CYP2E1) [12]. CYP2E1 is mainly expressed in the liver and plays a major role in the metabolism of alcohol and other toxicants. Many pathways have been suggested to contribute to alcohol-induced hepatotoxicity and mutagenesis, and one central pathway seems to be the induction of a state of oxidative stress by CYP2E1. High CYP2E1 activity positively correlates with liver fibrogenesis and carcinogenesis in the liver [13, 14]. Most importantly, CYP2E1 has been suggested to regulate the response to the oxidative stress and migration of breast cancer cells as well as liver metastasis of colon cancer [15–17].

EMT is the most common feature when advanced cancer initiates metastasis [18, 19]. EMT is utilized by liver cancer cells to initiate metastatic spread. A critical molecular feature responsible for liver cancer cell EMT is the downregulation of E-cadherin which is a cell adhesion molecule present in most normal epithelial cell plasma membranes but is frequently repressed or degraded in cancer cells [20]. Mechanisms underlying the functional loss of E-cadherin in cancer cells include posttranslational loss of protein function, transcriptional silencing due to promoter hypermethylation, and the activation of several transcription repressors, such as Snail, Slug, Sip1 and Ets [20, 21]. Previous studies have shown that alcohol was able to promote liver cancer EMT and metastasis but the factors and mechanisms underlying alcohol mediated EMT remain elusive [6, 9].

SIRT7 is a NAD+-dependent class III histone deacetylases (HDAC III), but the enzymatic activity and functions of SIRT7 are poorly understood. SIRT7 is predominantly localized in the nucleus where it regulates RNA polymerase I transcription by acting as an H3K18 deacetylase [22]. Besides H3K18, SIRT7 has also been reported to target several non-histone proteins, including p53 [23], GABP-β [24], FOXO3 [25], and U3-55k [26] for deacetylation, and has been implicated in multiple cellular functions including hepatic lipid metabolism, mitochondrial homeostasis and adipogenesis. Emerging evidence has also implicated SIRT7 in cancer biology [27–29]. H3K18 deacetylation by SIRT7 is important for maintaining the fundamental properties of the cancer cell phenotype [27]. In prostate cancer cells, SIRT7 cooperates with SIRT1 to suppress E-cadherin regulatory genes to promotes EMT and high SIRT7 levels are associated with metastatic disease and poor prognosis [29]. In HCC, SIRT7 expression is also upregulated in a large cohort of HCC patients [28] and we have shown that elevated SIRT7 expression is associated with chemosensitivity by regulating TP53 activity [30]. However, it is unclear whether SIRT7 regulates metastasis in HCC.

In the present study, we demonstrated that SIRT7 as a critical regulator of liver cancer metastasis. SIRT7 expression is closely associated with disease stage and high SIRT7 predicts worse survival. Overexpression of SIRT7 promotes HCC cell migration and EMT while knockdown of SIRT7 showed opposite effects. Alcohol treatment upregulates SIRT7 and suppresses E-cadherin expression via a CYP2E/ROS axis in hepatocytes both in vitro and in vivo. Reducing SIRT7 activity completely abolished alcohol-mediated promotion of liver cancer metastasis in vivo. The current findings present a novel mechanism that controls alcohol-mediated HCC metastasis and reveals SIRT7 as a pivotal regulatory factor in regulating EMT and determining metastasis in human HCC.

MATERIALS AND METHODS

Cell culture, plasmids and transfection

Huh7.5 cells were provided by Dr. Charles Rice (Rockefeller University), HepG2 cells were provided by Dr. Tiangang Li (University of Kansas Medical Center), Hep3B cells were provided by Dr. Stanley Lemon, University of North Carolina, Chapel Hill, NC, SK-Hep1 cells were purchased from ATCC (Manassas, VA). All cells were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen, NY) containing 10% fetal bovine serum (FBS), 50 U/ml penicillin and 50 mg/ml streptomycin. Flag-SIRT7, proE-cad670-Luc (E-cadherin promoter region from −670 to +92) plasmids were respectively provided by Drs. Eric Verdin and Kumiko Ui-Tei via Addgene (Cambridge, MA). To generate mutants of E-cadherin luciferase reporter plasmids, proE-cad670-Luc was used as template and mutants were reconstituted by using the Q5 Site-Directed Mutagenesis Kit from New England BioLabs (Ipswich, MA). Primer sequences were as follows: E-cadherin E-BOX 1: 5’-GGCTCATACCCGAAATCCTA-3’; E-cadherin E-BOX 2: 5’-GGTGTGTACCCGTACTCCCA-3’; E-cadherin E-BOX 3: 5’-GATCCTACCCGTTAGTGAGC-3’; E-cadherin E-BOX 4: 5’-GAACCGTGTACCCGAACTAA-3’; E-cadherin ELK 4: 5’-GCCATCGACGGGGCT-3’; E-cadherin FOXO3 1: 5’-GGCAAAAGACCAAAAATTA-3’; E-cadherin FOXO3 2: 5’-GCCAAGTGTACCAGCCCTT-3’.

Cells were transfected in serum-free medium (Opti-MEM, Invitrogen) by using X-tremeGENE™ HP DNA Transfection Reagent (Roche, Indianapolis, IN) as previously described [31]. siRNA targeting SIRT7 (SMARTpool: ON-TARGET plus human SIRT7 siRNA) was purchased from GE Dharmacon (Lafayette, CO). shRNA targeting SIRT7 (MISSION® esiRNA targeting human SIRT7 TRCN0000359594, TRCN0000359663) and shRNA targeting FOXO3 (MISSION® TRC shRNA TRCN0000040100) were purchased from Sigma-Aldrich (St. Louis, MO).

Antibodies and chemicals

Anti-SIRT7 (D3K5A), anti-SIRT1 (D1D7), anti-β-actin (8H10D10), anti-FOXO3 (75D8), anti-E-cadherin (24E10) and anti-acetyl-histone H3 (Lys18) (D8Z5H) were purchased from Cell Signaling Technology (Boston, MA). Anti-GAPDH (FL-335) anti-α-SMA (SC53124) and anti-Vimentin (SC6260) were purchased from Santa Cruz Biotechnology (Dallas, TX). Anti-beta actin (AC-15), anti-acetyl-histone H3 (Lys56) (17-10259) and anti-Flag (M2) were purchased from Sigma-Aldrich. Anti-SIRT7 (PA5-87543) was purchased from Invitrogen. Twist1 (ABP60796) was purchased from Abbkine (Wuhan, China), Snail2 (A12301) was purchased from ABclonal (Wuhan, China). Daidzin, Fomepizole, Alizarin, N-acetyl-L-cysteine (NAC), and 4-Hydroxynonenal (4-HNE) were purchased from Selleckchem.

Animal model

Male NSG mice (6 week) were purchased form The Jackson Laboratory (Bar Harbor, ME) and Gempharmatech (Nanjing, China). Mice were housed in a temperature-controlled, pathogen-free environment with 12-hour light-dark cycles. All animal handing procedures were approved by the Institutional Animal Care and Use Committees at The University of Kansas Medical Center and Hunan Normal University School of Medicine.

Mice received a single tail vein injection of 1 × 106 cells suspended in 100 μL DMEM and tumor formation was determined in lung 4 weeks after injection by using Hematoxylin &Eosin (H&E) staining. Alcohol feeding procedures were previously described [32]. One week after cell injection, mice were initially fed the control Lieber-DeCarli diet ad libitum for 5 days to acclimatize them to a liquid diet. Then mice were subsequently allowed free access to the ethanol Lieber-DeCarli Diet containing 5% (vol/vol) ethanol for 2 weeks, and control-fed groups were pair-fed with an isocaloric control diet. All mice were sacrificed 4 weeks after injection and lungs were collected for determining tumor formation. Liver sections from CYP2E1−/− and control mice were kindly provided by Dr. Laura Nagy as previously described [33].

Human specimens and immunohistochemistry

De-identified human liver specimens from liver explants were obtained from The University of Kansas Medical Center Liver Center Biorepository core, The First Affiliated Hospital of Chongqing Medical University, and The Affiliated Hospital of Hunan Normal University (People’s Hospital of Hunan Province). Written informed consent was obtained from all patients and all studies using human tissue samples were approved by the Human Subjects Committee of the University of Kansas Medical Center, Chongqing Medical University and Hunan Normal University School of Medicine. Immunohistochemistry was performed as previously described [30, 32].

Isolation of human and mouse primary hepatocyte

Primary human hepatocytes were freshly isolated from liver resections as previously described [31, 34] by the Cell Isolation Core at the University of Kansas Medical Center. All human tissues were obtained with informed consent from each patient, according to ethical and institutional guidelines. The study was approved by the Institutional Review Board at the University of Kansas Medical Center.

Mouse primary hepatocyte were isolated by using a multi-step collagenase procedure [34]. The liver was perfused with calcium-free solution and then digested with a collagenase (Sigma-Aldrich) perfusion. Dispersed cells were released from the isolated liver, hepatocytes were collected by 50 × g centrifugation and then seeded on collagen coated plates and allowed to attach in a humidified 37 °C, 5% CO2 incubator overnight. For in vitro alcohol treatment, cells were treated with 50 mM ethanol for indicated times.

Quantitative polymerase chain reaction (qRCR)

Total RNA was isolated from cells using the TRIzol reagent (Thermo Fisher Scientific), followed by cDNA synthesis using an RNA reverse transcription kit (Applied Biosystems). Subsequently, a CFX96 real-time system (Bio-Rad, CA) was used to perform qPCR. Primer sequences for human SIRT7 and E-cadherin were as follows: SIRT7-forward: 5’-GACCTGGTAACGGAGCTGC-3’, SIRT7-reverse:5’-CGACCAAGTATTTGGCGTTCC-3’; E-cadherin forward: 5’-GGGGTCTGTCATGGAAGGTG -3’, E-cadherin reverse: 5’- CAAAATCCAAGCCCGTGGTG -3’;GAPDH forward:5’-GAAGGTGAAGGTCGGAGTC-3’, GAPDH reverse: 5’-GAAGATGGTGATGGGATTTC-3’.

Chromatin immunoprecipitation (ChIP) assay

ChIP assays were performed as described previously [30, 31]. Briefly, cells were fixed, washed, and harvested, followed by shearing of genomic DNA by sonication. Sonicated DNA (20 μl) was purified and 1% of DNA was used as input DNA control. Chromatin-bound DNAs were immunoprecipitated using antibodies as indicated. Primer sets used were as following: pro-Ecad A forward: 5’-GGCTGCTAGCTCAGTGGCTC-3’, pro-Ecad A reverse: 5’-TGGGCTCAAGCGGTCCTCT-3’; pro-Ecad B forward: 5’-AACTCCAGGCTAGAGGGTCACC-3’, pro-Ecad B reverse: 5’- GGCTGGAGTCTGAACTGACTTCC -3’.

Western blotting

As previously described [30], cell lysates were separated on a 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Membranes were blocked with 5% skim milk for 1 h at room temperature. Following incubation with primary antibodies (1:1000) overnight at 4 °C, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies. Signals were detected using the ECL Western Blotting Detection system (Thermo Fisher Scientific). Quantifications of Western blots were performed by densitometry analysis using the ImageJ Gel Analysis tool (NIH, USA) where gel background was removed individually for each band, and relative band intensities were normalized against GAPDH.

Immunofluorescence

As previously described [31], cells grown on coverslips were fixed with 4% paraformaldehyde at room temperature for 5 min and 0.2% Triton X-100 was used for cell permeation. Cells were incubated with primary antibodies as indicated. followed by incubation with Alexa Fluor-conjugated secondary antibodies (Molecular Probes; Thermo Fisher Scientific, Inc.). Dihydrochloride (DAPI) was added to stain nuclear DNA. Images were acquired using a Nikon Eclipse microscope (Nikon Corporation).

Wound healing assay

2 × 104 cells were plated in 24-well plates. When cells reached 100% confluence, sterile pipette tips (100 μl) were used to scratch the wound. Cell motility was assessed by measuring the movement of cells into the scratched wound after 24 h incubation.

Migration assay

The 24-well transwell plates (0.4 μm pore size, Corning) were used to measure the migration ability of the cells. HCC cells (2 × 103) in 200 μl FBS-free media were added into the upper chamber and 600 μl of media with 10% FBS was added to the bottom chambers. Cells were fixed with methanol after a 24 h incubation. Cells that migrated through the membrane were stained with crystal violet and the number of migratory cells was counted under a microscope.

Kaplan–Meier survival curve analysis

The preprocessed level 3 RNA-seq data and corresponding clinical information of cancer patients were collected from The Cancer Genome Atlas (TCGA) database (http://cancergenome.nih.gov/). The optimal cut-off value of level 3 RNA-seq data was calculated according to the Youden index [(sensitivity + specificity) −1], and the patient samples were divided into two cohorts according to the cut-off value of the genes (high vs. low expression). Log-rank P-values and HRs with 95% confidence intervals were determined on the survival R package.

Downloading and Screening Data

UALCAN (http://ualcan.path.uab.edu/index.html) was used to predict the expression difference of SIRT7 and the relationship between SIRT7 and tumor stage. The sequencing data and corresponding clinical data of HCC patients were downloaded from TCGA database. UALCAN now provides protein expression analysis options using data from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) Confirmatory/Discovery dataset. We evaluated the expression of SIRT7 in liver cancer by Wilcoxon signed rank test using the ggpubr R package.

Statistical Analysis

For cell culture experiments, each experiment was repeated at least three times unless indicated otherwise as this was generally sufficient to achieve statistical significance for differences. Sample sizes for individual experiments are specified in figure legends. For human sample experiments we had no a priori information on effect magnitude or standard deviation so sample sizes were chosen based on subject availability. For mice experiment, we used at least five animals for each group. These numbers were sufficient to achieve statistical significance for multiple measures. Data are presented as mean ± sem. Statistical significance between groups was calculated by using one-way ANOVA followed by Turkey’s test. Statistical significance between two groups was calculated by 2-tailed unpaired Student’s t-test. Variance between groups met the assumptions or the appropriate test. Unless otherwise stated, a P-value of <0.05 was considered statistically significant. The Kaplan–Meier method was used to estimate the survival rates for SIRT7 expression. Equivalences of the survival curves were tested by log-rank statistics.

RESULTS

Aberrantly increased SIRT7 expression was associated with HCC metastasis and poorer survival

To explore the clinical significance of SIRT7 in human HCC, we analyzed RNA sequencing data collected from The Cancer Genome Atlas (TCGA) public database. The results showed that SIRT7 expression was increased in HCC tissues and positively correlated with disease progression at all stages except stage IV and this was due to limited sample size (Fig. 1A). The Kaplan–Meier method (using the log-rank test) also suggested that lower SIRT7 expression was associated with increased overall survival (Fig. 1B) and disease-free survival (Fig. 1C) compared with those of patients with higher levels of SIRT7. To further evaluate whether SIRT7 contributed to HCC metastasis, we collected HCC tumor samples from patients who underwent surgical resection or transplantation and examined SIRT7 expression by IHC and western blot. We found that SIRT7 expression in tumors showing evidence of vascular invasion (vascular invasion (+)) was significantly higher than in tumors that lacked this more aggressive, metastasis-promoting feature (vascular invasion (−)) (Fig. 1D, E). IHC staining results indicated that in both normal and cirrhotic liver sections, SIRT7 staining was undetectable. However, SIRT7 showed positive staining in HCC and strong nuclear staining in HCC tissue that showed evidence of vascular invasion (Fig. 1F).

Fig. 1. Elevated SIRT7 expression in human HCC and associated with poor prognosis.

Fig. 1

Open in a new tab

A Analysis of SIRT7 mRNA expression in normal tissue (n = 50) and differential stage based on TNM classification of HCC (n = 346) from the TCGA public database. B, C Kaplan–Meier analysis of overall survival (n = 346) and disease free survival (n = 346) in liver cancer patients based on SIRT7 expression. D Western blot analysis of SIRT7 protein levels in HCC patients with (vascular invasion (+)) or without (vascular invasion (−)) vascular invasion. Numbers indicate individual patients. E Quantifications of Western blot results as in D by measuring relative band intensity normalized to GAPDH. Graphs show mean ± SEM, ***P < 0.001, Student’s t-test. F Representative IHC staining for protein levels of SIRT7 in normal, cirrhotic, primary, and HCC with or without vascular invasion. Scale bar indicates 50 μm.

SIRT7 is critical for HCC metastasis both in vitro and in vivo

To further confirm the role of SIRT7 in HCC metastasis, we transiently knocked down SIRT7 in HCC cells using siRNA (Fig. 2A) and evaluated cell migration by using a wound healing and migration assay. Knockdown of SIRT7 significantly impaired the cell migration capability in Huh7 and HepG2 cells compared with those of controls (Fig. 2B–D). Notably, no significant changes in proliferation were observed under the time frame of these experiments (data not shown). We further stably knocked down SIRT7 in SK-Hep1 cells with two different lentiviruses (shSIRT7#1 and shSIRT7#2) and evaluated whether SIRT7 regulates HCC metastasis in vivo (Fig. 2E–G). Similar to siRNA experiments, we found that stable knockdown of SIRT7 markedly decreased lung metastasis compared with controls (shTRC, Fig. 2F, G). In contrast, overexpression of SIRT7 in HepG2 cells resulted in a significant increase of lung metastasis compared with those formed by control cells (UT, p < 0.001, Fig. 2H, I).

Fig. 2. SIRT7 promotes HCC metastasis.

Fig. 2

Open in a new tab

A Huh7.5 and HepG2 cells were treated with siRNA targeting SIRT7 (siSIRT7) for 72 h, protein levels of SIRT7 were evaluated by WB, the number blow the lane indicate relative band intensity normalized to GAPDH. Cell migration were evaluated by using wound healing B and migration assay C, D. E Knockdown efficiency of SK-Hep1 cells were treated with scramble (shTRC) or shRNA targeting SIRT7 (shSIRT7) for 72 h. The number blow the lane indicate relative band intensity normalized to GAPDH. F 1 × 106 cells in E were randomly injected into NSG mice via tail vein injection, tumor formation was determined in lung 4 weeks after injection and quantified data shown in G. H, I HepG2 cells were transfected with SIRT7 for 24 h and then 1 × 106 cells were injected into NSG mice via tail vein injection, tumor formation was determined in lung 4 weeks after injection and quantified data shown in I. Graphs show mean ± SEM of at least three independent experiments. **P < 0.01, ***P < 0.001, Student’s t-test. Arrow heads indicate metastatic foci in lung. Scale bar indicates 50 μm.

SIRT7 promotes EMT in HCC

Previous reports demonstrated that SIRT7 promotes cancer cell EMT in both prostate and colorectal cancer cells [29, 35]. We thus assessed whether SIRT7 promoted HCC cell migration and metastasis by regulating EMT. We examined EMT associated markers in HCC cell lines by using western blotting analysis. As expected, significantly downregulated E-cadherin and upregulated vimentin were observed in Huh7.5 cells overexpressing SIRT7 compared with those transfected with empty vectors (EV). Knockdown of SIRT7 showed the opposite effects (Fig. 3A). We measured EMT associated transcription factors including Twist and Snail2 in SIRT7 overexpressing and knockdown Huh7.5 cells but we did not find obvious changes of these proteins in either case (Fig. 3B). Immunofluorescence showed similar effects of SIRT7 knockdown and demonstrated increased E-cadherin and panclaudin and decreased vimentin levels (Fig. 3C). We further performed western blot and IHC staining to compare expression of SIRT7, E-cadherin and vimentin in HCC samples with or without metastasis (Fig. 3D–F). Higher SIRT7 levels were present in metastatic HCC samples compared with non-metastatic HCC tissue. SIRT7 expression patterns were negatively correlated with E-cadherin expression level (Fig. 3D–F). Spearman correlation analysis showed a strong negative correlation between SIRT7 and E-cadherin (ρ = −0.566, p < 0.05) (Fig. 3G). Kaplan–Meier method suggested that lower E-cadherin expression was associated with decreased overall survival (Fig. 3H). Most importantly, high expression of SIRT7 and low E-cadherin was associated with the lowest survival probability (Fig. 3I).

Fig. 3. SIRT7 regulates EMT of HCC cells.

Fig. 3

Open in a new tab

A Huh7.5 cells were transfected with SIRT7 or siSIRT7. Protein levels of EMT related genes were evaluated by WB. The number blow the lane indicate relative band intensity normalized to GAPDH. B Huh7.5 cells were transfected with SIRT7 or shSIRT7. Protein levels were evaluated by WB. The number blow the lane indicate relative band intensity normalized to GAPDH. C Immunofluorescence for epithelial cell marker (Green) and mesenchymal cell marker (red) in cells treated with siSIRT7 as in A. Scale bar indicates 50 μm. D, E WB analysis D and representative IHC staining E for SIRT7 and E-cadherin primary and metastatic HCC. F Quantifications of Western blot results as in D by measuring relative band intensity normalized to GAPDH. Graphs show mean ± SEM, *P < 0.05, Student’s t-test. G Spearman correlation between SIRT7 and E-cadherin expression as in D (ρ = −0.566, p < 0.05). H, I Kaplan–Meier analysis of overall survival in liver cancer patients based on E-cadherin H or SIRT7 and E-cadherin I expression.

SIRT7 induces H3K18 deacetylation and suppresses E-cadherin via a FOXO3-dependent mechanism

Downregulation of E-cadherin is a pivotal process of EMT in cancer cells and our data indicated that SIRT7 overexpression reduced E-cadherin expression. We thus sought to determine the mechanisms of SIRT7 suppression of E-cadherin. Overexpression of SIRT7 significantly decreased transcriptional activity of the E-cadherin promoter (Fig. 4A), indicating that SIRT7 suppresses E-cadherin at a transcriptional level. To assess whether SIRT7 binds to the E-cadherin promoter we performed ChIP assays. As shown in Fig. 4B, SIRT7 showed positive binding to E-cadherin promoter compared with IgG and this binding was significantly abolished in cells treated with siSIRT7. SIRT7 is involved in deacetylating H3K18 and this is responsible for gene silencing and maintenance of oncogenic transformation in human cancer cells [27]. We thus examined whether SIRT7 suppresses E-cadherin through similar mechanisms by performing ChIP assays to measure H3K18 acetylation levels at the E-cadherin promoter region. The results show that knockdown of SIRT7 resulted in significantly elevated H3K18 but not H3K56 acetylation level (Fig. 4C). This demonstrates that SIRT7 is responsible for H3K18 deacetylation at the E-cadherin promoter.

Fig. 4. SIRT7 induces H3K18 deacetylation and suppresses E-cadherin via FOXO3.

Fig. 4

Open in a new tab

A Luciferase activity from Huh7.5 were transfected with luciferase reporter plasmid containing E-cadherin promoter with empty vector (EV) or Flag-SIRT7. B Huh7.5 cells were transfected with nontargeted siRNA (siCON) or siRNA targeting SIRT7 (siSIRT7). ChIP assay was performed with SIRT7 antibody. C Huh7.5 cells were treated with scramble (shTRC) or shRNA targeting SIRT7 (shSIRT7) for 72 h, acetylation levels within promoter regions of E-cadherin (pro-Ecah-A and pro-Ecah-B) were measured by ChIP assay by using antibodies as indicated. D Luciferase assays from Huh7.5 were transfected with Flag-SIRT7 and luciferase reporter plasmid containing E-cadherin promoter (WT) or promoters with mutations of E-box, ELK4 or FOXO3 binding sites as indicated. **P < 0.01 vs WT, One way ANOVA. E Huh7.5 cells were treated with scramble (shTRC) or shRNA targeting FOXO3 (shFOXO3) for 72 h, Protein level of FOXO3 were evaluated by WB. The number blow the lane indicate relative band intensity normalized to GAPDH. F Luciferase assays from cells in E were transfected with luciferase reporter plasmid containing E-cadherin promoter and empty vector (EV) or Flag-SIRT7. All graphs show mean ± SEM of at least three independent experiments. **P < 0.01 VS EV, #P < 0.05 VS shTRC. One-way ANOVA. G–I Kaplan–Meier analysis of overall survival G and disease free survival H in liver cancer patients based on FOXO3 H or SIRT7 and FOXO3 I expression.

We further sought to determine how SIRT7 is recruited to the E-cadherin promoter since SIRT7 lacks known sequence-specific DNA binding domains [27]. We analyzed E-cadherin promoter regions and identified putative binding sits for FOXO3, ELK4 and E-box within this region. We thus made a series of mutants and performed luciferase assays to investigate whether those sites are required for SIRT7-mediated E-cadherin repression (Fig. 4D). The results showed overexpression of SIRT7 suppressed transcriptional activity of E-cadherin. Mutations of E-box or ELK4 showed no effect on SIRT7-dependent repression. However, mutants of either FOXO3 binding site completely abolished SIRT7-mediated suppression (Fig. 4D). To further address whether FOXO3 is required for SIRT7-mediated E-cadherin repression, we knocked down FOXO3 (Fig. 4E) and performed luciferase assays in those cells. We found that FOXO3 knockdown enhanced transcriptional activity of E-cadherin (Fig. 4F). As expected, in the absence of FOXO3, SIRT7 no longer suppressed transcriptional activity of E-cadherin compared with empty vectors (Fig. 4F). We further investigated whether FOXO3 and SIRT7 expression patterns determined disease progression in human liver cancer. Kaplan–Meier method suggested that high FOXO3 expression was associated with decreased overall survival (Fig. 4G) and disease-free survival (Fig. 4H) compared with those of patients with lower levels of FOXO3. Most importantly, high expressions of SIRT7 and FOXO3 was associated with the lowest survival probability while low expressions of SIRT7 and FOXO3 were associated with the highest survival probability compared with other expression patterns, respectively (Fig. 3I).

Elevated SIRT7 expression in hepatocytes upon ethanol exposure

Alcohol is well known to promote HCC metastasis [9, 11] and our above results clearly demonstrated that SIRT7 is a critical factor in mediating HCC metastasis. We thus tested whether alcohol promotes HCC metastasis through SIRT7. We first determined whether ethanol treatment modulates SIRT7 expression in HCC cells. Consistent with a previous report [36], ethanol treatment of HCC cells resulted in downregulation of SIRT1 expression, but SIRT7 expression was significantly upregulated in both SK-Hep1 and Hep3B cells (Fig. 5A). Elevated mRNA levels of SIRT7 were also observed in SK-Hep1 cells starting from 24 h after alcohol exposure (Fig. 5B), indicating ethanol treatment regulates SIRT7 at a transcriptional level. In primary human and mouse hepatocytes, ethanol treatment resulted in increased SIRT7 expression and concomitantly decreased E-cadherin expression, similar to Huh7.5 cells (Fig. 5C). We further examined SIRT7 expression in liver from mouse fed with 5 weeks of alcohol as previously reported [37]. The results showed that alcohol feeding increased SIRT7, and significantly decreased E-cadherin expression compared with a control diet (Fig. 5D, E). To address whether alcohol feeding increased SIRT7 expression in hepatocytes, we isolated hepatocytes from mouse liver and analyzed protein levels by western blot, the results indicated that alcohol feeding significantly increases SIRT7 expression and suppressed E-cadherin expression in hepatocytes (Fig. 5F, G).

Fig. 5. EtOH upregulates SIRT7 expression.

Fig. 5

Open in a new tab

A WB analysis of SIRT7 protein levels SK-Hep1 and Hep3B cell after EtOH treatment (50 mM) for 48 h. The number blow the lane indicate relative band intensity normalized to GAPDH. B mRNA levels of SIRT7 after EtOH (50 mM) treatment. Graphs show mean ± SEM of at least three independent experiments, ***P < 0.001, One way ANOVA. C Protein levels of SIRT7 and E-cadherin after EtOH (50 mM) treatment in primary hepatocytes and Huh7.5 cells. The number blow the lane indicate relative band intensity normalized to GAPDH. D Protein levels of SIRT7 and E-cadherin in liver from mice were pair-fed or fed with alcohol for 5 weeks. E Quantifications of Western blot results as in D by measuring relative band intensity normalized to GAPDH. Graphs show mean ± SEM, *P < 0.05, Student’s t-test. F Protein levels of SIRT7 and E-cadherin in primary hepatocyte from mice were pair-fed or fed with alcohol for 5 weeks. G Quantifications of Western blot results as in F by measuring relative band intensity normalized to GAPDH. Graphs show mean ± SEM, **P < 0.01, ***P < 0.001,Student’s t-test.

CYP2E1-dependent oxidative stress is responsible for alcohol mediated SIRT7 induction

Two major enzyme systems are responsible for ethanol metabolism in the liver, alcohol dehydrogenase and the cytochrome P450-dependent ethanol oxidizing system. To determine whether these two systems were responsible for alcohol mediated SIRT7 induction, we treated cells with acetaldehyde (ALD) or ethanol in the presence of inhibitors of either aldehyde dehydrogenase (ALDH), alcohol dehydrogenase (ADH) or CYP2E1 and measured SIRT7 mRNA levels (Fig. 6A). We found that ethanol increased SIRT7 mRNA level almost 3-fold but ALD treatment did not change SIRT7 mRNA level. The CYP2E1 inhibitor (CYP2E1 inhi) alizarin completely abolished the ethanol induced SIRT7 elevation, while neither the alcohol dehydrogenase inhibitor (ADH inhi) fomepizole nor the aldehyde dehydrogenase inhibitor (ALDH inhi) daidzin showed any effects (Fig. 6A). We further confirmed these findings by using immunofluorescence (IF) and similar results were observed (Fig. 6B). Next, we measured CYP2E1 expression after ethanol treatment and found significant induction of CYP2E1 after 48 h of ethanol treatment both in primary human hepatocyte and HepG2 cells (Fig. 6C). To further confirm whether CYP2E1 was required for ethanol induced SIRT7 elevation, we performed IHC staining in liver sections from wild type (WT) or CYP2E1−/− mice fed with control or alcohol diet as previously reported [33]. We observed that in WT mice, alcohol feeding resulted in a significant increase of SIRT7 staining which predominantly localized in nuclei. This increase was not seen with control diet. Consistent with our in vitro data, decreased E-cadherin levels were also observed in the liver after alcohol feeding compared with control diet (Fig. 6D). In contrast, in CYP2E1−/− mice, there were no obvious changes of SIRT7 staining after alcohol feeding compared with control diet and the decrease of E-cadherin levels reduced when compared with WT mice after alcohol (Fig. 6D). Since CYP2E1 has been suggested as a major contributor to ethanol-induced oxidant stress [8], we thus investigated whether reactive oxygen species (ROS) were responsible for ethanol induced SIRT7 elevation by using N-acetyl-cysteine (NAC) as an ROS inhibitor and 4-hydroxynonenal (4-HNE) as an inducer of oxidative stress (Fig. 6E, F). NAC treatment significantly decreased while 4-HNE further enhanced ethanol mediated SIRT7 mRNA elevation (Fig. 6E, F). More importantly, we found that 4-HNE treatment itself was sufficient to increase SIRT7 level in HepG2 cells (Fig. 6G).

Fig. 6. CYP2E1-dependent oxidative stress is responsible for alcohol mediated SIRT7 induction.

Fig. 6

Open in a new tab

A Hep3B were untreated (Control), treated with aldehyde (ALD, 5 mM), or EtOH (50 mM) in the absence or present of fomepizole (ADH inhi,50 μM), daidzin (ALDH inhi, 20 μM), or alizarin (CYP2E1 inhi,10 μM) for 24 h and SIRT7 mRNA level were evaluated by qRT-PCR. Graphs show mean ± SEM of at least three independent experiments, **P < 0.001 vs Control, ##P < 0.001 vs EtOH, One way ANOVA. B Immunofluorescence for SIRT7 protein (Green) in cells as in A. Scale bar indicates 50 μm. C Immunofluorescence for CYP2E1 protein (Green) in primary hepatocytes and HepG2 cells treated with EtOH (50 mM) for 48 h. Scale bar indicates 50 μm. D Representative IHC staining of SIRT7 and E-cadherin in WT and CYP2E1−/− mice were pair- or alcohol-fed for 5 weeks. E Hep3B were untreated (Control) or treated with EtOH in the absence or present of N-acetly-cysteine (NAC, 1 mM) or 4-hydroxynonenal (4-HNE,100 μM) for 24 h, mRNA levels of SIRT7 were evaluated by qRT-PCR. Graphs show mean ± SEM of at least three independent experiments, *P < 0.05 vs Control, #P < 0.05 vs EtOH, One way ANOVA. F Immunofluorescence for SIRT7 protein (Green) in cells as in E. Scale bar indicates 50 μm. G Immunofluorescence for SIRT7 protein (Green) in Hep3B cells were treated with 4-HNE for 24 h. Scale bar indicates 50 μm.

Knockdown SIRT7 abolished alcohol mediated HCC metastasis in vivo

The above studies demonstrate that alcohol promotes SIRT7 which is critical for HCC metastasis, suggesting that SIRT7 may play a role in alcohol mediated HCC metastasis. To test this, we first compared SIRT7 and E-cadherin expression in clinical samples (Table 1) from HCC patients with and without a history of alcohol consumption (Fig. 7A, B). Consistent with our previous observations, SIRT7 expression in alcohol-associated tumors was significantly higher than in tumors not associated with alcohol (Fig. 7A, Table 1). IHC staining results indicated mild SIRT7 staining in the non-alcohol tumors but in the alcohol-associated tumors, SIRT7 showed strong nuclear and cytosolic staining which might be due to post translational modifications caused by alcohol [38] (Fig. 7B). In contrast, E-cadherin expression was significantly decreased in alcohol-associated tumors compared with those from non-alcohol patients (Fig. 7A, B). These results suggest that alcohol consumption modulates SIRT7 and E-cadherin expression in human HCC. To further confirm the role of SIRT7 in alcohol mediated HCC metastasis, we used an established pulmonary metastasis model and fed mice with control diet or alcohol. Due to high mortality after 5 weeks of alcohol feeding, even for the control mice that did not receive tumor cells, we fed our mice with alcohol for shorter period of time (2 weeks) one week after tail vein injection of the tumor cells (Fig. 7C–E). We found that 2 weeks of alcohol feeding did not cause obvious liver damage [32] but markedly increased lung metastasis compared to control diet. This was evidenced by surface tumor formation (Fig. 7C), IHC staining (Fig. 7D) and tumor number (Fig. 7E). This effect was completely abolished by knockdown of SIRT7 in SK-Hep1 cells with lentiviruses (shSIRT7#2, p < 0.01). These data clearly indicate that SIRT7 plays a crucial role in alcohol mediated HCC metastasis in vivo.

Table 1.

Correlative analysis of alcohol consumption with SIRT7 levels or clinicopathological features by using a nonparametric Fisher’s Exact Test.

Clinicopatholigic Parameters Number of specimens Alcohol P value
YES NO
Sex 0.7806
 Female 8 0 8
 Male 11 8 3
Age(mean ± SD) 61 ± 9.62 50.1 ± 19.59 0.1534
Tumorsize 0.6491
 >3 cm 16 10 6
 <3 cm 3 2 1
Multiple Tumor 0.3251
 YES 4 1 3
 NO 15 2 13
Vascular invasion 0.2482
 YES 5 1 4
 NO 14 2 12
Stage 0.3308
 I 2 1 1
 II 7 4 3
 III 7 2 5
 IV 3 0 3
SIRT7 expression 0.0186
 High 9 7 2
 Low 8 2 6
Open in a new tab

Fig. 7. Knockdown SIRT7 prevents alcohol mediated HCC metastasis.

Fig. 7

Open in a new tab

A Analysis of SIRT7 and E-cadherin mRNA levels in HCC with (n = 7) or without (n = 5) alcohol consumption. Data are presented as the mean ± SEM, **P < 0.01, ***P < 0.001, Student’s t-test. B Representative IHC staining for protein levels of SIRT7 and E-cadherin in liver sections from HCC patients with (n = 8) or without (n = 9) alcohol consumption. C–E SK-Hep1 cells were treated with scramble (shTRC) or shRNA targeting SIRT7 (shSIRT7) for 72 h, 1 × 106 cells were injected into NSG mice (n = 5 each group) via tail vein injection and one week after injection, mice were randomly divided into two groups and pair or alcohol fed for 2 more weeks, gross image C and H&E stained D lung tissues that showed metastasized HCC cell mass and quantified data shown in E. Data are presented as the mean ± SEM, **P < 0.01 vs pair fed/shTRC, one way ANOVA. Scale bar indicates 50 μm.

DISCUSSION

Alcohol has long been recognized as a risk factor for liver cancer tumorigenesis and metastasis [3–6]. Multiple mechanisms seem to be related to alcohol-induced liver cancer tumorigenesis including production of toxic reactive metabolites, oxidative stress and fat accumulation in hepatocyte. These factors all trigger hepatocyte death and promote inflammation [3, 39]. Evidence also suggests that alcohol use is associated with cancer stem cell activation and EMT which facilitates cancer metastasis [6, 9]. However, factors and mechanisms that are responsible for alcohol-mediated liver cancer metastasis remain elusive. In the present study, we revealed that SIRT7 can contribute to alcohol-mediated HCC metastasis. Alcohol upregulates SIRT7 which in turn promotes EMT and increases risk of metastasis. This provides a molecular mechanism responsible for alcohol-mediated HCC metastasis.

SIRT7 activity is important for human cancer [28, 40–42] and high SIRT7 expression is associated with an aggressive cancer phenotype, distant metastasis and poor patient survival [27, 30, 35, 43]. Our findings fit well with previous findings that SIRT7 is important for regulating cancer cell metastasis, and SIRT7 inactivation reverses metastatic phenotypes in both prostate and colorectal cancers [29, 35]. Our work extends these findings to human HCC. We demonstrated that SIRT7 is a crucial EMT regulator in HCC by FOXO3-denpendent E-cadherin suppression. Our findings further highlight the importance of SIRT7 in maintaining metastatic phenotype in human cancer. EMT is the most common feature of advanced cancers, and it initiates metastatic spread [18, 19]. In the case of liver cancer, downregulation of E-cadherin expression is the critical molecular feature responsible for cancer cell EMT [44]. While promoter hypermethylation and activation of transcriptional repressors are reported to suppresses E-cadherin [20, 21], our data further revealed that SIRT7 selectively deacetylates H3K18 at the E-cadherin promoter and acts as an E-cadherin repressor in human HCC. In the absence of FOXO3, SIRT7 no longer suppress E-cadherin transcription. While the precise role of FOXO3 in suppression of E-cadherin expression is unknown, it is possible that either FOXO3 is required to recruit SIRT7 to the E-cadherin promoter or that SIRT7 deacetylates both FOXO# and H3K18 and the two processes act synergistically to suppress gene expression. As E-cadherin is a well-documented biomarker of liver cancer prognosis [44, 45], our data suggested that SIRT7 may cooperate with FOXO3 in determining liver cancer progression. Consistent with this, we observed that patients with both high SIRT7 and FOXO3 expression showed the worst survival rate when compared with other expression patterns.

FOXO3 is a well characterized transcription factor responsible for antioxidant response, cell cycle arrest, apoptosis and longevity by directly inducing or mediating gene expression [46]. Activity and specificity of FOXO3 is critically regulated by multiple mechanisms including protein-protein interactions (co-activator or co-repressor) and post translational modifications (PTMs). For example, CHOP and PP2A directly interact with FOXO3 and increase FOXO3 transcriptional activity [47, 48] while interactions between c-Myc, p53 and FOXO3 are shown to repress FOXO3 mediated gene expression [49, 50]. In this study, we observed that SIRTT7 cooperates with FOXO3 to suppress E-cadherin expression. Our data further highlight the importance of co-factors in regulating FOXO3 transcriptional activity. PTMs are the other fundamental process for the regulation of FOXO3 function. These cause changes in subcellular location, DNA-binding affinity, and protein-protein interactions. We have previously shown that SIRT7 interacts with and deacetylates FOXO3 which prevents serine 574 phosphorylation and interferes with its ability to activate pro-apoptotic gene expression [25, 31]. It is still unclear whether and how interactions between SIRT7 and FOXO3 alter specificity of FOXO3 binding to E-cadherin promoter.

SIRT7 is frequently upregulated in various types of human cancer [51]. Studies have been mainly focused on its functional roles and the therapeutic impact of targeting SIRT7 [30, 35, 43, 52] while mechanisms underlying its regulation have been less well studied. Here we provide evidence that alcohol has the ability to upregulate SIRT7 in both normal liver and human HCC. We further revealed that this upregulation requires CYP2E1 which constitutes the major component of the ethanol oxidizing system. The catalytic activity of the CYP2E1 enzyme results in the generation of ROS which are involved in the initiation and perpetuation of alcohol-associated liver disease [12, 39]. By interacting with proteins, ROS have impact on several signaling pathways involved in cell proliferation and apoptosis [53, 54]. They also play a role in signal transduction and cellular physiology by interacting with transcription factors including Nrf2 and FOXO family proteins to influence expression of a wide range of genes [12, 55, 56]. Consistent with these observations, our data indicated that oxidative stress signaling is crucial in alcohol induced SIRT7 upregulation as an anti-oxidant (NAC) prevented and an ROS-inducing reactive aldehyde (4-HNE) upregulated SIRT7 mRNA level. Our findings thus provide evidence that ROS serves as a critical factor responsible for alcohol induced SIRT7 upregulation in human HCC. However, even though ROS is a main product of CYP2E1 mediated ethanol oxidation, how ROS activates SIRT7 transcription and whether ROS is primarily responsible for alcohol induced SIRT7 upregulation requires further investigation.

In summary, our data illustrate molecular mechanisms responsible for alcohol-mediated HCC metastasis and demonstrate a crucial role of SIRT7 in alcohol-mediated HCC. Our findings thus highlight the importance of SIRT7 in alcohol-mediated HCC progression and provide a useful target for the development of mechanism-based cancer therapeutic strategies.

ACKNOWLEDGEMENTS

This study was supported by grant 81974458, 82170607 from the National Natural Science Foundation of China, grant 2021JJ30463 from Hunan Provincial Natural Science Foundation of China, grant 2019RS1042, 2018RS3072, 2019TP1035 from the China Hunan Provincial Science/Technology Department, grant P30 GM118247 from the National Institute of General Medical Sciences from the National Institutes of Health (USA), grants 2022XKQ0205, KF2022001 and a startup grant from Hunan Normal University, and grants AA026025 and AA012863 to SAW from the National Institute on Alcohol Abuse and Alcoholism of the National Institutes of Health (USA). JQZ was supported by grant CSTC2020JCYJ-MSXMX0224 from Chongqing Natural Science Foundation. The specimens used in this study were provided, in part, by the University of Kansas Liver Center Biorepository. The authors acknowledge Dr Laura Nagy (Cleveland Clinic) who provided key materials for this study.

Footnotes

CONFLICT OF INTEREST

The authors declare no competing interests.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

All animal handling procedures were approved by the Institutional Animal Care and Use. Committee at The University of Kansas Medical Center. Liver specimens were obtained from the University of Kansas Medical Center, the First Affiliated Hospital of Chongqing Medical University, and the Affiliated Hospital of Hunan Normal University. All studies using human tissue samples were approved by the Human Subjects Committee of the University of Kansas Medical Center. Written informed consent was obtained from all patients and all studies using human tissue samples were approved by the Human Subjects Committee of the University of Kansas Medical Center, Chongqing Medical University and Hunan Normal University School of Medicine.

DATA AVAILABILITY

All data are within the manuscript and supporting information. Any additional information or data is available upon request.

REFERENCES

  • 1.Altekruse SF, McGlynn KA, Reichman ME. Hepatocellular carcinoma incidence, mortality, and survival trends in the United States from 1975 to 2005. J Clin Oncol 2009;27:1485–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Aravalli RN, Steer CJ, Cressman EN. Molecular mechanisms of hepatocellular carcinoma. Hepatology 2008;48:2047–63. [DOI] [PubMed] [Google Scholar]
  • 3.Parker R, Kim SJ, Gao B. Alcohol, adipose tissue and liver disease: mechanistic links and clinical considerations. Nat Rev Gastroenterol Hepatol. 2018;15:50–9. [DOI] [PubMed] [Google Scholar]
  • 4.Huang CS, Ho CT, Tu SH, Pan MH, Chuang CH, Chang HW, et al. Long-term ethanol exposure-induced hepatocellular carcinoma cell migration and invasion through lysyl oxidase activation are attenuated by combined treatment with pterostilbene and curcumin analogues. J Agric Food Chem. 2013;61:4326–35. [DOI] [PubMed] [Google Scholar]
  • 5.Brandon-Warner E, Walling TL, Schrum LW, McKillop IH. Chronic ethanol feeding accelerates hepatocellular carcinoma progression in a sex-dependent manner in a mouse model of hepatocarcinogenesis. Alcohol-Clin Exp Res. 2012;36:641–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Szabo G. Alcoholic liver disease accelerates early hepatocellular cancer in a mouse model. Adv Exp Med Biol. 2018;1032:71–9. [DOI] [PubMed] [Google Scholar]
  • 7.McKillop IH, Schrum LW. Role of alcohol in liver carcinogenesis. Semin Liver Dis. 2009;29:222–32. [DOI] [PubMed] [Google Scholar]
  • 8.Lu Y, Cederbaum AI. CYP2E1 and oxidative liver injury by alcohol. Free Radic Biol Med. 2008;44:723–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen DL, Yu DD, Wang XY, Liu Y, He YJ, Deng RQ, et al. Epithelial to mesenchymal transition is involved in ethanol promoted hepatocellular carcinoma cells metastasis and stemness. Mol Carcinog. 2018;57:1358–70. [DOI] [PubMed] [Google Scholar]
  • 10.Chen D, Yan Y, Wang X, Li S, Liu Y,Yu D, et al. Chronic alcohol exposure promotes HCC stemness and metastasis through beta-catenin/miR-22-3p/TET2 axis. Aging 2021;13:14433–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.McKillop IH, Schrum LW, Thompson KJ. Role of alcohol in the development and progression of hepatocellular carcinoma. Hepatic Oncol. 2016;3:29–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Leung TM, Nieto N. CYP2E1 and oxidant stress in alcoholic and non-alcoholic fatty liver disease. J Hepatol. 2013;58:395–8. [DOI] [PubMed] [Google Scholar]
  • 13.Zhou J, Wen Q, Li SF, Zhang YF, Gao N, Tian X, et al. Significant change of cytochrome P450s activities in patients with hepatocellular carcinoma. Onco-target 2016;7:50612–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gao J, Wang GJ, Wang Z, Gao N, Li J, Zhang YF, et al. High CYP2E1 activity correlates with hepatofibrogenesis induced by nitrosamines. Oncotarget 2017;8:112199–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Leung T, Rajendran R, Singh S, Garva R, Krstic-Demonacos M, Demonacos C. Cytochrome P450 2E1 (CYP2E1) regulates the response to oxidative stress and migration of breast cancer cells. Breast cancer Res: BCR. 2013;15:R107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mohr AM, Gould JJ, Kubik JL, Talmon GA, Casey CA, Thomas P, et al. Enhanced colorectal cancer metastases in the alcohol-injured liver. Clin Exp metastasis. 2017;34:171–84. [DOI] [PubMed] [Google Scholar]
  • 17.Wang RY, Chen XW, Zhang WW, Jiang F, Liu MQ, Shen XB. CYP2E1 changes the biological function of gastric cancer cells via the PI3K/Akt/mTOR signaling pathway. Mol Med Rep. 2020;21:842–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Acloque H, Adams MS, Fishwick K, Bronner-Fraser M, Nieto MA. Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J Clin Investig. 2009;119:1438–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-mesenchymal transitions in development and disease. Cell 2009;139:871–90. [DOI] [PubMed] [Google Scholar]
  • 20.Larue L, Bellacosa A. Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3’ kinase/AKT pathways. Oncogene 2005;24:7443–54. [DOI] [PubMed] [Google Scholar]
  • 21.Yoshida J, Horiuchi A, Kikuchi N, Hayashi A, Osada R, Ohira S, et al. Changes in the expression of E-cadherin repressors, Snail, Slug, SIP1, and Twist, in the development and progression of ovarian carcinoma: the important role of Snail in ovarian tumorigenesis and progression. Med Mol Morphol. 2009;42:82–91. [DOI] [PubMed] [Google Scholar]
  • 22.Ford E, Voit R, Liszt G, Magin C, Grummt I, Guarente L. Mammalian Sir2 homolog SIRT7 is an activator of RNA polymerase I transcription. Genes Dev. 2006;20:1075–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Vakhrusheva O, Smolka C, Gajawada P, Kostin S, Boettger T, Kubin T, et al. Sirt7 increases stress resistance of cardiomyocytes and prevents apoptosis and inflammatory cardiomyopathy in mice. Circ Res. 2008;102:703–10. [DOI] [PubMed] [Google Scholar]
  • 24.Ryu D, Jo YS, Lo Sasso G, Stein S, Zhang H, Perino A, et al. A SIRT7-dependent acetylation switch of GABPbeta1 controls mitochondrial function. Cell Metab. 2014;20:856–69. [DOI] [PubMed] [Google Scholar]
  • 25.Li Z, Bridges B, Olson J, Weinman SA. The interaction between acetylation and serine-574 phosphorylation regulates the apoptotic function of FOXO3. Oncogene 2017;36:1887–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen S, Blank MF, Iyer A, Huang B, Wang L, Grummt I, et al. SIRT7-dependent deacetylation of the U3-55k protein controls pre-rRNA processing. Nat Commun. 2016;7:10734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Barber MF, Michishita-Kioi E, Xi Y, Tasselli L, Kioi M, Moqtaderi Z, et al. SIRT7 links H3K18 deacetylation to maintenance of oncogenic transformation. Nature 2012;487:114–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kim JK, Noh JH, Jung KH, Eun JW, Bae HJ, Kim MG, et al. Sirtuin7 oncogenic potential in human hepatocellular carcinoma and its regulation by the tumor suppressors MiR-125a-5p and MiR-125b. Hepatol (Baltim, Md). 2013;57:1055–67. [DOI] [PubMed] [Google Scholar]
  • 29.Malik S, Villanova L, Tanaka S, Aonuma M, Roy N, Berber E, et al. SIRT7 inactivation reverses metastatic phenotypes in epithelial and mesenchymal tumors. Sci Rep. 2015;5:9841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhao J, Wozniak A, Adams A, Cox J, Vittal A, Voss J, et al. SIRT7 regulates hepatocellular carcinoma response to therapy by altering the p53-dependent cell death pathway. J Exp Clin Cancer Res. 2019;38:252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Li Z, Zhao J, Tikhanovich I, Kuravi S, Helzberg J, Dorko K, et al. Serine 574 phosphorylation alters transcriptional programming of FOXO3 by selectively enhancing apoptotic gene expression. Cell Death Differ. 2016;23:583–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Li Z, Zhao J, Zhang S, Weinman SA. FOXO3-dependent apoptosis limits alcohol-induced liver inflammation by promoting infiltrating macrophage differentiation. Cell Death Disco. 2018;4:16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sebastian BM, Roychowdhury S, Tang H, Hillian AD, Feldstein AE, Stahl GL, et al. Identification of a cytochrome P4502E1/Bid/C1q-dependent axis mediating inflammation in adipose tissue after chronic ethanol feeding to mice. J Biol Chem. 2011;286:35989–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Xie Y, McGill MR, Dorko K, Kumer SC, Schmitt TM, Forster J, et al. Mechanisms of acetaminophen-induced cell death in primary human hepatocytes. Toxicol Appl Pharm. 2014;279:266–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yu HY, Ye W, Wu JX, Meng XQ, Liu RY, Ying XF, et al. Overexpression of Sirt7 exhibits oncogenic property and serves as a prognostic factor in colorectal cancer. Clin Cancer Res. 2014;20:3434–45. [DOI] [PubMed] [Google Scholar]
  • 36.Yin H, Hu M, Liang X, Ajmo JM, Li X, Bataller R, et al. Deletion of SIRT1 from hepatocytes in mice disrupts lipin-1 signaling and aggravates alcoholic fatty liver. Gastroenterology 2014;146:801–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tumurbaatar B, Tikhanovich I, Li Z, Ren J, Ralston R, Kuravi S, et al. Hepatitis C and alcohol exacerbate liver injury by suppression of FOXO3. Am J Pathol. 2013;183:1803–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Parira T, Figueroa G, Laverde A, Casteleiro G, Gomez Hernandez ME, Fernandez-Lima F, et al. Novel detection of post-translational modifications in human monocyte-derived dendritic cells after chronic alcohol exposure: role of inflammation regulator H4K12ac. Sci Rep. 2017;7:11236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tan HK, Yates E, Lilly K, Dhanda AD. Oxidative stress in alcohol-related liver disease. World J Hepatol. 2020;12:332–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wang HL, Lu RQ, Xie SH, Zheng H, Wen XM, Gao X, et al. SIRT7 exhibits oncogenic potential in human ovarian cancer cells. Asian Pac J Cancer Prev. 2015;16:3573–7. [DOI] [PubMed] [Google Scholar]
  • 41.Zhang S, Chen P, Huang Z, Hu X, Chen M, Hu S, et al. Sirt7 promotes gastric cancer growth and inhibits apoptosis by epigenetically inhibiting miR-34a. Sci Rep. 2015;5:9787. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 42.Paredes S, Villanova L, Chua KF. Molecular pathways: emerging roles of mammalian Sirtuin SIRT7 in cancer. Clin Cancer Res. 2014;20:1741–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Li H, Tian Z, Qu Y, Yang Q, Guan H, Shi B, et al. SIRT7 promotes thyroid tumorigenesis through phosphorylation and activation of Akt and p70S6K1 via DBC1/SIRT1 axis. Oncogene 2019;38:345–59. [DOI] [PubMed] [Google Scholar]
  • 44.Loh CY, Chai JY, Tang TF, Wong WF, Sethi G, Shanmugam MK, et al. The E-cadherin and N-cadherin switch in epithelial-to-mesenchymal transition: signaling, therapeutic implications, and challenges. Cells-Basel. 2019;8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Han LL, Jia L, Wu F, Huang C. Sirtuin6 (SIRT6) Promotes the EMT of hepatocellular carcinoma by stimulating autophagic degradation of E-cadherin. Mol Cancer Res: MCR. 2019;17:2267–80. [DOI] [PubMed] [Google Scholar]
  • 46.Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, et al. Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Sci (NY). 2004;303:2011–5. [DOI] [PubMed] [Google Scholar]
  • 47.Ghosh AP, Klocke BJ, Ballestas ME, Roth KA. CHOP potentially co-operates with FOXO3a in neuronal cells to regulate PUMA and BIM expression in response to ER stress. PLoS ONE. 2012;7:e39586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Singh A, Ye M, Bucur O, Zhu S, Tanya Santos M, Rabinovitz I, et al. Protein phosphatase 2A reactivates FOXO3a through a dynamic interplay with 14-3-3 and AKT. Mol Biol Cell. 2010;21:1140–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Miyaguchi Y, Tsuchiya K, Sakamoto K. P53 negatively regulates the transcriptional activity of FOXO3a under oxidative stress. Cell Biol Int. 2009;33:853–60. [DOI] [PubMed] [Google Scholar]
  • 50.Chandramohan V, Mineva ND, Burke B, Jeay S, Wu M, Shen J, et al. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. J Cell Biochem. 2008;104:2091–106. [DOI] [PubMed] [Google Scholar]
  • 51.Blank MF, Grummt I. The seven faces of SIRT7. Transcription 2017;8:67–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Tang X, Shi L, Xie N, Liu Z, Qian M, Meng F, et al. SIRT7 antagonizes TGF-beta signaling and inhibits breast cancer metastasis. Nat Commun. 2017;8:318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Zhou D, Shao L, Spitz DR. Reactive oxygen species in normal and tumor stem cells. Adv Cancer Res. 2014;122:1–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Diebold L, Chandel NS. Mitochondrial ROS regulation of proliferating cells. Free Radic Biol Med. 2016;100:86–93. [DOI] [PubMed] [Google Scholar]
  • 55.Klotz LO, Sanchez-Ramos C, Prieto-Arroyo I, Urbanek P, Steinbrenner H, Monsalve M. Redox regulation of FoxO transcription factors. Redox Biol. 2015;6:51–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kovac S, Angelova PR, Holmstrom KM, Zhang Y, Dinkova-Kostova AT, Abramov AY. Nrf2 regulates ROS production by mitochondria and NADPH oxidase. Biochim Biophys Acta. 2015;1850:794–801. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are within the manuscript and supporting information. Any additional information or data is available upon request.

RESOURCES