Establishment of synthetic microbial consortia with Corynebacterium glutamicum and Pseudomonas putida: Design, construction, and application to production of γ‐glutamylisopropylamide and l‐theanine

Abstract

Microbial synthetic consortia are a promising alternative to classical monoculture for biotechnological applications and fermentative processes. Their versatile use offers advantages in the degradation of complex substrates, the allocation of the metabolic burden between individual partners, or the division of labour in energy utilisation, substrate supply or product formation. Here, stable synthetic consortia between the two industrially relevant production hosts, Pseudomonas putida KT2440 and Corynebacterium glutamicum ATCC13032, were established for the first time. By applying arginine auxotrophy/overproduction and/or formamidase‐based utilisation of the rare nitrogen source formamide, different types of interaction were realised, such as commensal relationships (+/0 and 0/+) and mutualistic cross‐feeding (+/+). These consortia did not only show stable growth but could also be used for fermentative production of the γ‐glutamylated amines theanine and γ‐glutamyl‐isopropylamide (GIPA). The consortia produced up to 2.8 g L⁻¹ of GIPA and up to 2.6 g L⁻¹ of theanine, a taste‐enhancing constituent of green tea leaves. Thus, the advantageous approach of using synthetic microbial consortia for fermentative production of value‐added compounds was successfully demonstrated.

Stable synthetic consortia between the two industrially relevant production hosts, Pseudomonas putida KT2440 and Corynebacterium glutamicum, were established for the first time. By applying arginine auxotrophy/overproduction and formamidase‐based utilisation of the rare nitrogen source formamide, commensal (0/+ and +/0) and mutualistic (+/+) consortia were constructed, characterised and used for fermentative production of the γ‑glutamylated amines γ‑glutamyl‑isopropylamide (GIPA) and l‐theanine.

INTRODUCTION

The conversion of complex substrates in nature relies on the cooperation of mixed‐species microbial consortia with often unknown functions and compositions (Jiang et al., 2017), for example in fermented foods, waste treatment and agriculture (McCarty & Ledesma‐Amaro, 2019). While stable communities may form for bioconversion of nutrition and energy (Thuan et al., 2022), the composition is often not known and the consortia can only be used for black‐box applications (Sgobba & Wendisch, 2020). There are bioinformatic approaches to reveal the compositions of natural consortia for use in synthetic consortia with the desired function (Kumar et al., 2021). Consortia with non‐engineered strains can be used for the production of natural products, for example due to the induction of silent gene clusters (Thuan et al., 2022), but these consortia often convert the substrates not only into the desired product but also by‐products are produced, which lowers the overall yield of the process (Ben Said & Or, 2017). To circumvent this disadvantage, synthetic microbial consortia with defined compositions can be designed. In these consortia, engineered interdependencies are typically used to reduce heterogeneities (Sgobba & Wendisch, 2020; Zhang et al., 2018). For the design of these synthetic consortia, the interactions, mechanisms and structures of natural inter‐ and intrakingdom consortia need to be studied and understood (Zhang et al., 2018). Synthetic microbial consortia have several advantages over monocultures, for example due to the division of labour; reduction of metabolic loads; avoidance of the influence of different functions; optimal catalytic environments for enzymes derived from different sources; balance of cofactor and energy levels; higher adaptability and stability to environmental fluctuations (Harcombe et al., 2018; Pan et al., 2023; Shong et al., 2012). Most biotechnological processes are based on feedstocks, which are homogenous and continuously available, and thus, specialised monocultures can be used. For feedstocks with varying supply and composition, adjusted microbial consortia can be applied that match the respective process steps of substrate conversion and/or product formation (Liu et al., 2019). Microbial consortia can often use less defined substrates than monocultures, which lowers cost since purification is not required (Ben Said & Or, 2017; Zhang et al., 2018). One type of application uses a synthetic consortium that consists of a substrate converter and a producer strain (Sgobba & Wendisch, 2020; Thuan et al., 2022). For example, in a synthetic Escherichia coli and Corynebacterium glutamicum consortium, starch‐based production of lysine by substrate‐converting E. coli and lysine production by starch‐negative C. glutamicum was established (Sgobba et al., 2018). A consortium of Pseudomonas putida and Synechococcus elongatus was designed in which the cyanobacterium fixes CO₂ and secretes carbohydrates, which P. putida in turn can use for growth and the degradation of environmental pollutants. Also, a synthetic consortium for butanol production by Thermoanaerobacterium thermosaccharolyticum M5 with Clostridium acetobutylicum NJ4 by use of lignocellulosic biomass as substrate was established (Jiang et al., 2020). It has to be noted that division of labour in consortia requires the transport of compounds over the cellular membrane, for example the uptake or export of substrates, intermediates and products via transport proteins (Lu et al., 2019; Sgobba & Wendisch, 2020). During the design of a synthetic consortium, different technical hurdles need to be solved, like improving the production parameters or developing process parameters for storage and maintaining the stability of the composition (Sgobba & Wendisch, 2020). For complex biosynthesis pathways, consortia can be developed to partition individual biosynthetic steps among two or more microbial strains and/or species. This lowers the metabolic burden of the single microorganism (Brenner et al., 2008; Lu et al., 2019; Thuan et al., 2022; Tsoi et al., 2018) and can be used to circumvent the accumulation of inhibitory intermediates (Ben Said & Or, 2017). This division of labour can lead to higher production as genes or modules are shared (Bittihn et al., 2018). The sum of implemented genetic modifications, which is limited to a single strain, is higher, and the desired features of different strains or species can be combined in a coordinated manner (Cui et al., 2019; Wang et al., 2018). Also, complicated metabolic and genetic manipulation can be reduced by the use of specialised members in the consortia (Re & Mazzoli, 2023). A number of design rules exist for this subdivision, comprising availability of transport proteins, inhibition due to substrates, intermediates or products and distinct biochemical requirements of subpathways regarding NADPH, ATP or oxygen (Sgobba & Wendisch, 2020). Consortia provide a kind of compartmentalisation such that undesired cross‐reactions and side products can be reduced through active or passive transport of substrates and intermediates (Shong et al., 2012). By dividing metabolic pathways, incompatibilities between gene elements and host cells can be bypassed, for example in the E. coli and Saccharomyces cerevisiae co‐culture used to produce oxygenated taxanes (Zhou et al., 2015). Production of bioactive compounds by consortia may support plug‐and‐play biosynthesis: strains used in co‐cultures are genetically designed to adapt to each biosynthesis pathway module more precisely than monocultures to the entire pathway, and the consortium is optimised in host selection, construction of module pathways, initial ratio of strains and culture conditions (Thuan et al., 2022). For best production, the selection of the intermediate metabolic node is necessary and important for balancing cofactor and energy supply (Li et al., 2019; Pan et al., 2023). To establish robust processes of synthetic consortia, different levels of interdependency through cross‐feeding or auxotrophies can be used: no interaction (0/0), competition (−/−), commensalism (0/+) or mutual cooperation (+/+) (Sgobba & Wendisch, 2020). Polycultures consisting of more than two host organisms can be designed to express genes of a biosynthetic route of a complex compound and maintain the metabolic flux balance, precursor and energy supply (Thuan et al., 2022).

In this study, synthetic microbial consortia of P. putida and C. glutamicum strains were constructed for the production of γ‐glutamylated amines such as theanine. For the design of the consortia, different prerequisites, such as growth conditions, growth medium, co‐existence and dependencies, should be noticed. Therefore, two different types of dependent consortia were established by using an arginine‐dependent consortium or an ammonium‐dependent consortium as a commensal consortium (+/0 or 0/+) and an arginine‐ and ammonium‐dependent consortium as mutually cooperative consortium (+/+) for the growth and production of the γ‐glutamylated amines theanine and γ‐glutamyl‐isopropylamide (GIPA). Theanine is the most abundant free amino acid in green tea leaves and can be used in the food and pharmaceutical industries as taste enhancer or for relaxation, respectively (Mu et al., 2015). GIPA is naturally involved in the l‐alaninol pathway of Pseudomonas sp. strain KIE171 (de Azevedo Wäsch et al., 2002; Pan et al., 2020). For the production of both amines, monocultures of P. putida Thea1 have been described (Benninghaus et al., 2021, 2023) and the strain was developed further for use in consortia with C. glutamicum. The enzyme γ‐glutamyl‐methylamide synthetase (EC 6.3.4.12, GMAS), encoded by gmaS, from Methylorubrum extorquens, was used and monoethylamine (MEA) or isopropylamine (IPA) was added as amine donor for production of theanine or GIPA, respectively. The enzyme GMAS is part of the N‐methylglutamate pathway for monomethylamine assimilation in methylotrophs and catalyses the ATP‐dependent methylamidation of glutamate to γ‐glutamyl‐methylamide (Gruffaz et al., 2014; Nayak & Marx, 2014). By addition of MEA or IPA as amine donor, the enzyme can catalyse the conversion of glutamate and MEA or IPA to theanine or GIPA, respectively. The enzyme was used for fermentative production of theanine in C. glutamicum, E. coli and P. putida (Benninghaus et al., 2021; Hagihara et al., 2021; Ma et al., 2020) and also tested with lyophilised E. coli cells for the substrate spectrum using several different amines, including MEA and IPA (Pan et al., 2020).

EXPERIMENTAL PROCEDURES

Bacterial strains and growth conditions

Used microorganisms and plasmids are listed in Table 1. E. coli DH5α was used as cloning host, and C. glutamicum ATCC13032 and P. putida KT2440 were used as platform strains for co‐cultivation. Pre‐cultivation was performed in lysogeny broth (LB) inoculated from a fresh LB agar plate for all microorganisms. E. coli was cultivated in LB in 100 mL baffled flasks at 37°C on a rotary shaker (180 rpm).

TABLE 1.

Strains and vectors used in this work.

Name	Relevant characteristics	Source
Strains
C. glutamicum ATCC13032	Wild type	Kinoshita et al. (1957)
C. glutamicum ATCC13032 (pECXT_Psyn‐gfp UV)	Wild type, with plasmid pECXT_Psyn‐gfp UV	Henke et al. (2021)
C. glutamicum ARG2	Wild type with in‐frame deletion of ΔargR with plasmid pVWEx1‐argB fbr	Peters‐Wendisch et al. (2014)
C. glutamicum ARG2 (pECXT_Psyn‐gfp UV)	ARG2 derivative; with plasmid pECXT_Psyn‐gfp UV	This work
P. putida KT2440	P. putida mt‐2 hsdRl hsdM	Bagdasarian et al. (1981), Franklin et al. (1981)
P. putida KT2440 (pEV1‐crimson)	KT2440 with plasmid pEV1‐crimson	This work
P. putida KT2440 Δupp	P. putida mt‐2 hsdRl hsdM Δupp	Graf and Altenbuchner (2011)
P. putida ΔargH	P. putida mt‐2 hsdRl hsdM Δupp ΔargH	This work
P. putida ΔargH (pEV1‐crimson)	KT2440 derivative; Δupp ΔargH with plasmid pEV1‐crimson	This work
P. putida ΔargH FORM	KT2440 derivative; Δupp ΔargH with plasmid pEV3‐amiF	This work
P. putida Thea1	P. putida KT2440 Δupp ΔglpR::Ptac‐gdhA with plasmid pEV1‐gmaS	Benninghaus et al. (2021)
P. putida Thea1 ΔargH	Thea1 derivative, ΔargH	This work
P. putida Thea1 FORM	Thea1 derivative with plasmid pEV3‐amiF	This work
P. putida Thea1 ΔargH FORM	Thea1 ΔargH derivative with plasmid pEV3‐amiF	This work
E. coli DH5α	F‐thi‐1 endA1 hsdr17(r‐, m‐) supE44 ΔlacU169 (Φ80lacZΔM15) recA1 gyrA96	Hanahan (1983)
Vectors
pEV1‐crimson	pEV1 derivative for l‐rhamnose inducible expression of crimson	This work
pEV1‐gmaS	pEV1 derivative for l‐rhamnose inducible expression of gmaS from M. extorquens DM4 containing an artificial ribosome binding site (RBS) 5′‐CTAGGAGGATTCGTC‐3′	Benninghaus et al. (2021)
pEV3‐amiF	pEV3 derivate for expression of amiF from Helicobacter pylori 26695 containing an artificial RBS 5′‐AAGGCTGAGAGGCGCAATTATTCAAAAATTAAGGAGGTATTTTT‐3′	This work
pUC57_amiF‐ptxD	AmpR, cloning plasmid with sequences of codon‐optimised versions of amiF from H. pylori 26695 and ptxD from P. stutzeri WM88	Schwardmann et al. (2022)
pECXT_Psyn‐gfp UV	pECXT99A derivative for constitutive expression of gfp UV	Henke et al. (2021)
pECXT99A‐crimson	pECXT99A derivative for IPTG inducible expression of crimson	Sgobba et al. (2018)
pKOPp	pJOE6261.2 derivate for deletions in P. putida KT2440	Graf and Altenbuchner (2011)
pKOPp‐ΔargH	pKOPp derivate for deletion of argH in P. putida KT2440	This work

For growth and production experiments of P. putida and C. glutamicum strains, the cells of pre‐cultures were washed once in TN buffer (pH 6.3, 50 mM Tris, 50 mM NaCl) and inoculated to an initial optical density at 600 nm (OD₆₀₀) of 1.0 (for monocultures) or 2.0 (for co‐cultures). Standard cultivations were performed in minimal medium (Table S1) with 20 g L⁻¹ glucose as carbon source supplemented with biotin (0.82 μM), protocatechuic acid (0.19 mM) and trace elements (Table S2) in 100 mL baffled flasks on a rotary shaker (120 rpm) at 30°C. Gene expression from pEV1 or pEV3 and pVWEx1‐based plasmids was induced by the addition of 0.05% (w/v) L‐rhamnose or 1 mM IPTG, respectively. For selection in P. putida of pEV1 or pEV3 tetracycline (50 μg mL⁻¹) or kanamycin (50 μg mL⁻¹) and for selection in C. glutamicum of pECXT‐P_syn or pVWEx1 tetracycline (5 μg mL⁻¹) or kanamycin (25 μg mL⁻¹) were added, respectively. Production cultivations were performed in 1 mL in the Biolector®flowerplate microcultivation system (Beckman Coulter GmbH, Aachen, Germany) at 1100 rpm and 30°C.

Molecular biology techniques

Standard molecular techniques were performed as described elsewhere (Green et al., 2012). Competent E. coli DH5α (Hanahan, 1983) cells were prepared according to the CaCl₂ method, and transformation was performed by heat shock at 42°C for 45 s (Green et al., 2012). P. putida cells were washed with 10% (v/v) glycerol and transformed via electroporation (2.5 kV, 200 W, 25 F) according to a published method (Iwasaki et al., 1994). The plasmids were introduced by electroporation into C. glutamicum strains as described in a previous study (Eggeling & Bott, 2005).

Preparation of plasmid DNA from E. coli was performed using GeneJet Plasmid Miniprep Kit from Thermo Scientific with the protocol according to the manufacturer. PCR amplification was performed with Phusion High‐Fidelity DNA polymerase and ALLin™ HiFi DNA Polymerase according to the manufacturer (New England Biolabs, UK or highQu GmbH, GER). PCR clean‐up was done according to the protocol of GeneJET PCR Purification Kit and GeneJET Gel Extraction Kit of Thermo Fisher Scientific (USA). Restriction enzymes were purchased from Thermo Fisher Scientific (USA). The isothermal assembly method for assembly of multiple fragments was used as described previously (Gibson et al., 2009). All cloned DNA fragments were confirmed by DNA sequence analysis (Sequencing Core Facility, Bielefeld University).

Construction of new expression vectors

For plasmid‐based expression of amiF from H. pylori 26695, the amiF gene was amplified from plasmid pUC57_amiF‐ptxD (Table 1) using the primers P1 and P2 (Table 2) for addition of artificial RBS and based on the purified PCR product with the primers P3 and P2 (Table 2) for instruction of overhangs for pEV3 plasmid backbone. The purified PCR product was cloned into EcoRI digested plasmid pEV3 with Gibson Assembly (Gibson et al., 2009). The constructed plasmid pEV3‐amiF (Table 1) was sequenced using primers P4–P7 (Table 2).

TABLE 2.

Used primer.

Name	Sequence 5′–3′
P1	AAGGCTGAGAGGCGCAATTATTCAAAAATTAAGGAGGTATTTTTATGGGCTCCATTGGTTCTATGGG
P2	CCGGGTACCGAGCTCGAATTTTACTTACCGAAGCGACCGCC
P3	CAATTTCACACAGGAAACAGAAGGCTGAGAGGCGCAATTATTC
P4	GTATGGCTGTGCAGGTCGTAAATC
P5	GCAACATCCGCATTAAAATCTAGCGAG
P6	CTGTTCCCATGGAATCCAATCGAAC
P7	GTTTGACCTACATCAAGGATCTGGCAG
P8	AGATCCGCGGGGGCCCTCCAAAGTTCAGAGGTAGTCATGGATAGCACTGAGAACG
P9	TCGCACCTGGTGTTTAAACCTACTGGAACAGGTGGTG
P10	CAGGAAATGCGGTGAGCATC
P11	CGAGGCCCTTTCGTCTTC
P12	GCCAAGCTTGCATGCCTGCAGAGGCTGTTTC GTCATGCTCAAG
P13	GTTCACGCCTGCAATGAGTGAATCTCGCTAA TCCCCCAAGGC
P14	GCCTTGGGGGATTAGCGAGATTCACTCATTG CAGGCGTGAAC
P15	GGCCGCTTTGGTCCCGGATCCTTCGTGACGC AAGGTCACATAC
P16	GTGCGATGGCCAAAGATTCACTC
P17	CCTAGGATGGGATGCAACAGTGTG
P18	CGCTGCAAGCGTTCGATG

For plasmid‐based expression of crimson, the crimson gene was amplified from plasmid pECXT99A‐crimson (Table 1) using primers P8 and P9 (Table 2). The purified PCR product was cloned into XhoI digested plasmid pEV1 with Gibson Assembly (Gibson et al., 2009). The constructed plasmid pEV1‐crimson (Table 1) was sequenced using primers P10 and P11 (Table 2).

Chromosomal gene replacement

Gene deletion in P. putida was performed by homologous recombination for marker less gene deletions as described before (Graf & Altenbuchner, 2011) by using the suicide vector pKOPp. The P. putida gene sequences for the suicide vector pKOPp‐ΔargH were amplified using the primers P12 and P13 (1000 bp upstream of argH) and P14 and P14 (1000 bp downstream of argH) (Table 2). Screening of the mutants was performed on LB agar supplemented with 0.04 mg mL⁻¹ 5‐fluorouracil. The replacement of the argH gene was verified by sequencing using the primer P15, P16 and P17 (Table 2).

Fluorescence analysis by flow cytometry

Strain identity of monocultures and the composition of co‐cultures were analysed by fluorescence of Gfp_UV‐ or Crimson‐expressing cells using flow cytometry (flow cytometer Gallios™, Beckman Coulter, Krefeld, Germany). Mono‐ or co‐cultures were cultivated in minimal medium for 24 h and analysed immediately. The OD₆₀₀ of samples was adjusted to 0.1 in TN buffer (pH 6.3) for analysis of 20,000 cells per sample, using a blue solid‐state laser at an excitation wavelength of 405 nm to monitor fluorescence via the forward‐ (FSC) and side‐scatter (SSC) signals. The two 525/50 nm and 660/20 nm band‐pass filters were used to detect the Gfp_UV and Crimson signals, respectively. The measurement was adjusted for autofluorescence with respective wild‐type cells of C. glutamicum and P. putida.

Fluorescence microscopy analysis of monocultures and co‐cultures

For confirmation and visualisation of the fluorescence analysis by flow cytometry, the composition of selected cultures was analysed by fluorescence microscopy. The OD₆₀₀ was adjusted to 0.1 with TN puffer (pH 6.3). Microscope slides were prepared with 1% agarose to prevent moving of bacteria. The fluorescence of Gfp_UV and Crimson was measured using a Keyence BZ‐X810 fluorescence microscope (Keyence Deutschland GmbH, Neu‐Isenburg, Germany) with GFP/FITC/A488 and RFP/A555/P filters. Pictures were taken in bright field and fluorescence channels with a magnification of 60× in immersion oil and processed with the Keyence software.

Analytical quantification of amino acids and carbohydrates

Extracellular amino acids were quantified by analytical high‐performance liquid chromatography (HPLC, 1200 series, Agilent Technologies Deutschland GmbH, GER). For quantification, the supernatant of production experiments was used. The derivatisation with 9‐fluorenylmethyl chloroformate (FMOC) according to published methods (Schneider et al., 2012) with modifications (Jensen & Wendisch, 2013) was performed for detection of primary and secondary amines. The separation was performed with a pre‐column (LiChrospher 100 RP8 EC‐5 μ (40 × 4.6 mm), CS‐Chromatographie Service GmbH, GER) and a main column (LiChrospher 100 RP8 EC‐5 μ (125 × 4.6 mm), CS‐Chromatographie Service GmbH, GER). The detection was performed with a fluorescence detector (FLD G1321A, 1200 series, Agilent Technologies, USA) with excitation and emission wavelengths of 263 and 310 nm, respectively.

Derivatisation and quantification were carried out with the following modifications for the quantification of FMOC‐derivatised samples: l‐isoleucine was used for derivatisation instead of glycine, and proline was used as internal standard. The used mobile phases were 50 mM sodium acetate (pH 4.2) (A) and acetonitrile (B) with the gradient: 0 min 38% B, 5 min 38% B, 12 min 57% B, 14 min 76% B, 15 min 76% B and 18 min 38% B.

The measurement of carbohydrates was performed using a column for organic acids (Aminex 300 × 8 mm, 10 μm particle size, 25 Å pore diameter, CS‐Chromatographie Service GmbH, Germany) under isocratic conditions for 17 min at 60°C with 5 mM sulfuric acid and a flow rate of 0.8 mL min⁻¹. For detection, a refractive index detector (RID G1362A, 1200 series, Agilent Technologies) and a diode array detector (DAD) at 210 nm were used.

RESULTS AND DISCUSSION

Design of synthetic microbial consortia with P. putida and C. glutamicum

Culture media have been developed for growth of bacteria in monocultures, but media for consortia may need different compositions, also depending on their type of interaction (Figure 1A). In this study, interactions between P. putida and C. glutamicum (P. putida/C. glutamicum) are indicated with ‘0’ for neutral (the strain does not benefit from the co‐culture) and ‘+’ for positive interaction (the strain benefits from the co‐culture). In a consortium without any interaction (interaction type 0/0), both strains, for example the wild‐type (WT) strains P. putida KT2440 and C. glutamicum ATCC13032, can grow independently from each other (Figure 1B). In a consortium with commensalism (interaction type +/0 or 0/+), the former or the latter strain benefits from the second strain. In this study, an arginine‐auxotrophic strain P. putida KT2440 ΔargH lacking the argininosuccinate lyase gene was constructed in order to establish a dependency on the arginine‐producing strain C. glutamicum ARG2 (Figure 1C). The latter strain is neither benefiting nor suffering from the former strain, thus being neutral with respect to the presence of the second strain. In reverse direction, an ammonium dependency (0/+) was used, in which the P. putida strain was constructed for plasmid‐based expression of formamidase gene amiF from Helicobacter pylori. This strain can grow with formamide as sole nitrogen source, and it liberates ammonium to the medium. The C. glutamicum wild‐type strain cannot utilise formamide and is therefore dependent on ammonium release by P. putida FORM (Figure 1D). To establish a cooperative or mutually dependent consortium (interaction type +/+), the P. putida strain KT2440 ΔargH was constructed for plasmid‐based expression of amiF. The formamidase‐negative strain C. glutamicum ARG2 cannot utilise formamide, thus, is dependent on ammonium released by P. putida strain FORM. Therefore, in mineral salts media with formamide as sole nitrogen source, the arginine‐auxotrophic strain P. putida ΔargH FORM requires arginine from the arginine‐overproducing C. glutamicum ARG2 that in turn requires ammonium from P. putida strain FORM (Figure 1E).

FIGURE 1.

Design of synthetic microbial consortia with P. putida and C. glutamicum. (A) Monoculture of P. putida KT2440 (WT) and C. glutamicum ATCC13032 (WT) with the fluorescence proteins Crimson and Gfp_UV indicated with the colours red and green, respectively. (B) Co‐culture with P. putida WT and C. glutamicum WT without any interaction (0/0) growing in the same medium. (C) Co‐culture of P. putida KT2440 ΔargH as arginine‐auxotrophic strain with the arginine‐overproducer C. glutamicum ARG2 in a commensal consortium (+/0) via arginine dependency of P. putida. (D) Co‐culture of P. putida FORM as formamide‐utilising strain with formamidase‐negative C. glutamicum WT in a commensal consortium (0/+) via ammonium dependency of C. glutamicum. (E) Co‐culture of the arginine‐auxotrophic, formamide‐utilising strain P. putida KT2440 ΔargH FORM with the arginine‐overproducer strain C. glutamicum ARG2, which cannot utilise formamide, in a cooperative consortium (+/+) via arginine and ammonium interdependency.

Here, binary microbial consortia of the industrially relevant bacteria P. putida and C. glutamicum were developed for the first time. Four interaction types (0/0, +/0, 0/+ and +/+) were designed and tested for production of the food and beverage additive theanine and the related GIPA. In microbial consortia, intra‐ and interspecies interactions exist, such as mutualism or competition for nutrients, which affect metabolism and product yields (Jiang et al., 2017).

Natural consortia are rarely binary but mostly consist of many species. The complexity of designing ternary synthetic consortia (or of even higher valency) exceeds that of binary consortia considerably. In principle, a ternary consortium may be based on the here established mutualistic consortium with arginine‐auxotrophic, formamidase‐positive P. putida and arginine‐overproducing, formamidase‐negative C. glutamicum with the addition of an α‐amylase‐positive E. coli. This will require a dependency of E. coli on one of the other partners, for example by means of lysine auxotrophy that could be supplemented by the low lysine concentrations (1 mM) excreted from a C. glutamicum strain (Sgobba et al., 2018). Ternary consortia have already been designed, constructed and used, for example for the production of rosmarinic acid with three E. coli strains designed for mutually exclusive access to the carbon sources glucose and xylose and subdivision of the biosynthetic pathway into three modules (Li et al., 2019). Future work will guide the construction of higher order interspecies consortia, but we will focus on a binary consortium for the production of theanine and GIPA.

Medium for co‐culturing P. putida and C. glutamicum without interaction (0/0)

To enable the growth of a synthetic consortium, media conditions are needed in which each partner can grow. Therefore, the minimal media M12 (described for P. putida) and CgXII (described for C. glutamicum) were prepared without the addition of the respective trace element solutions. For growth, both trace element solutions and 20 g L⁻¹ glucose as carbon source for the growth of wild‐type strains P. putida KT2440 and C. glutamicum ATCC13032 were used, respectively. As is regular for CgXII, biotin and PKS were also added to the M12 minimal medium. The recorded growth data are listed in Table 3. C. glutamicum ATCC13032 reached a higher biomass in CgXII minimal medium independent of the used trace elements, while the growth rates of C. glutamicum ATCC13032 and P. putida KT2440 were comparable. In M12 minimal medium with PKS and biotin, both strains reached a similar growth rate and biomass concentration independently of the used trace elements. Since the choice of either trace element solution did not have significant influence, adapted trace elements have been developed. For this purpose, both compositions were compared (Table S2). For the same component, the lower concentration was used, only one component per element was used and possible carbon sources were avoided. For the microbial consortia, a medium called M12‐C was found and was based on M12 minimal medium with 20 g L⁻¹ glucose as a carbon source, ammonium sulphate as the sole nitrogen source (if not mentioned otherwise), PKS and biotin and adapted trace elements. All further experiments were performed with this medium, as it enabled the growth of both partners.

TABLE 3.

Growth data of P. putida KT2440 and C. glutamicum ATCC13032 in CgXII or M12 minimal media with both trace elements.

	CgXII trace elements			M12 trace elements			Minimal medium
	μ [h−1]	Biomass [g L−1]	YX/S [g g−1]	μ [h−1]	Biomass [g L−1]	YX/S [g g−1]
C. glutamicum ATCC13032	0.32 ± 0.01	13.3 ± 0.2	0.67	0.32 ± 0.01	6.7 ± 0.3	0.34	CgXII—trace elements + 20 g L−1 glucose
P. putida KT2440	0.29 ± 0.06	4.4 ± 0.1	0.22	0.30 ± 0.07	3.3 ± 0.6	0.17
C. glutamicum ATCC13032	0.40 ± 0.01	3.8 ± 0.3	0.19	0.40 ± 0.02	4.0 ± 0.2	0.20	M12—trace elements + biotin + PKS + 20 g L−1 glucose
P. putida KT2440	0.42 ± 0.01	4.0 ± 0.7	0.20	0.46 ± 0.06	3.9 ± 0.6	0.20

Interaction type 0/0 co‐culture

With the developed medium, growth in co‐cultures without interaction (type 0/0) was observed. Preliminary cell counting by flow cytometry showed that the cell numbers of P. putida and C. glutamicum strains correlate with respective proportions of shared total biomass in co‐cultivation. Differentiation of strains was realised by fluorescence proteins through equipment of P. putida and C. glutamicum with plasmids encoding fluorescence reporter proteins Crimson and Gfp_UV, respectively. Cells were analysed by FACS measurement for the determination of strain ratios (Figure 2A). In monoculture, both wild‐type strains grew to similar biomass, and only one fluorescence protein was detected. In the co‐culture of P. putida WT and C. glutamicum WT, the number of cells detected for Crimson fluorescence was higher than that of those detected for Gfp_UV, indicating a higher ratio of P. putida in the co‐culture without any interaction. In conclusion, a co‐culture without any interactions (0/0) between wild‐type strains of P. putida and C. glutamicum was established as both strains grew; however, the initial 50:50 ratio between the strains was not maintained.

FIGURE 2.

Growth of monocultures and inter‐species consortia of P. putida and C. glutamicum strains without any interaction (0/0) and with obligate arginine cross‐feeding (+/0) between arginine‐overproducing C. glutamicum ARG2 and arginine‐auxotrophic P. putida ΔargH with the respective wild‐type strain of each organism as negative controls. Strains of P. putida and C. glutamicum were differentiated by the fluorescence of Crimson and Gfp_UV, respectively. Mono‐ and co‐cultivations were inoculated to the indicated ratio and cultivated in M12‐C for 24 h. Culture compositions were determined by flow cytometry (A) according to scatter plots (B) and fluorescence microscopy overlays (C) as exemplarily shown for the co‐cultivation of P. putida ΔargH and C. glutamicum ARG2, inoculated to equal (50:50) proportions.

The growth of both bacteria was confirmed without dependencies in an adapted medium, which is an important step for a potential consortium for the production of value‐added compounds (Zhang et al., 2018). Interestingly, consortia of type (0/0) showed a tendency to shift towards P. putida, and the biomass formation and growth rate were about the same as P. putida showed in the monoculture. Here, either unknown promotion of P. putida by C. glutamicum or inhibition of C. glutamicum by P. putida through exported metabolites or proteins could have favoured propagation of P. putida (Zhang et al., 2018). In‐depth metabolome or proteome analysis may help to learn more about the exchange of metabolites or proteins potentially affecting the P. putida–C. glutamicum consortia.

A commensal consortium (interaction type +/0) with dependency of arginine‐auxotrophic P. putida ΔargH on arginine‐producing C. glutamicum ARG2

Since the synthetic consortium of interaction type 0/0 was not balanced (P. putida dominated over C. glutamicum, s. above), it was investigated if arginine can serve to impose unilateral obligate dependency of arginine‐auxotrophic P. putida ΔargH on arginine‐overproducing C. glutamicum ARG2 in a commensal co‐culture (+/0). Therefore, both strains were grown in M12‐C medium as monocultures or co‐cultures with different cell ratios at inoculum (Figure 2A). As expected, the monoculture of the arginine‐auxotrophic strain P. putida ΔargH did not grow, while the monoculture of C. glutamicum ARG2 grew. Due to arginine overproduction, strain ARG2 grew to a lower biomass concentration compared to C. glutamicum WT. In the control co‐culture of arginine prototrophic P. putida KT2440 with arginine‐overproducing C. glutamicum ARG2, only Crimson fluorescence was detected after 24 h, indicating that the P. putida KT2440 strain took over the cultivation completely. In the control co‐culture of the arginine‐requiring P. putida ΔargH with C. glutamicum ATCC13032, which does not overproduce arginine, the C. glutamicum strain dominated the co‐culture. Notably, in the commensal co‐culture of the arginine‐requiring P. putida ΔargH with the arginine‐producing C. glutamicum ARG2, both strains co‐existed. When inoculated with ratios of 70/30, 50/50, 30/70 and 10/90 of P. putida ΔargH and C. glutamicum ARG2, the consortia contained 69%, 62%, 68% and 81%, of P. putida ΔargH cells, respectively, after growth for 24 h. As shown exemplarily, the flow cytometry determinations (Figure 2B) were corroborated by fluorescence microscopy (Figure 2C). In conclusion, a commensal consortium (+/0) between the arginine‐requiring P. putida ΔargH and the arginine‐producing C. glutamicum ARG2 via arginine dependency was established.

Also, the commensal arginine‐dependent (+/0) consortia showed a tendency to shift towards P. putida. This was also discussed in the consortium without dependency. Even in the commensal arginine‐dependent (+/0) consortia, in which P. putida required arginine from C. glutamicum for growth, P. putida was dominant. This may be explained by the fact that already low concentrations of arginine are sufficient as a supplement for the growth of the arginine‐auxotrophic P. putida strain in arginine‐dependent (+/0) consortia; thus, few C. glutamicum cells provide enough arginine. In a consortium of lysine‐auxotrophic E. coli with lysine‐overproducing C. glutamicum, low amounts of C. glutamicum were needed, indicating enough production for cross‐feeding (Sgobba et al., 2018).

A mutualistic consortium (interaction type +/+) with formamidase and arginine interdependencies

For mutual interdependency by cross‐feeding, a second constraint was introduced in addition to arginine dependency. Formamidase‐dependent formamide hydrolysis to enable the use of formamide as the sole source of nitrogen was established by plasmid‐based expression of amiF in P. putida KT2440 ΔargH, yielding strain P. putida ΔargH FORM. Based on our previous work on formamidase‐positive C. glutamicum strains, which released sufficient ammonium to allow growth of co‐cultivated formamidase‐deficient C. glutamicum strains (Schwardmann, Wu, et al., 2023), it was tested if strain P. putida ΔargH FORM can grow in media with formamide as the sole nitrogen source and if it releases enough ammonium to support growth of co‐cultivated formamidase‐negative C. glutamicum strain ARG2. Since the crimson gene was replaced by the amiF gene in strain P. putida KT2440 ΔargH FORM, Gfp_UV fluorescence was used to identify C. glutamicum cells and all non‐fluorescent cells were assigned to P. putida. The strains were grown in nitrogen‐free M12‐C medium with 68 mM formamide added as the sole nitrogen source (Figure 3). In monoculture, P. putida ΔargH FORM did not grow with formamide as a nitrogen source. C. glutamicum ARG2 could not utilise formamide for growth. Co‐cultures of formamidase‐positive P. putida ΔargH FORM with formamidase‐negative C. glutamicum strain ARG2 did grow under these conditions, and a ratio of 59:41 was observed after 24 h of cultivation. Thus, co‐cultivation of P. putida and C. glutamicum with obligate interdependent mutual cross‐feeding (+/+) is possible, and nutritional constraints can be exploited to steer culture dynamics.

FIGURE 3.

Biomass formation of arginine‐auxotrophic, formamidase‐positive P. putida strain ΔargH FORM and arginine‐overproducing, formamidase‐deficient C. glutamicum strain ARG2, grown as monocultures or as mutualistic inter‐species consortia (+/+). Strains of C. glutamicum and P. putida were differentiated by the Gfp_UV fluorescence of C. glutamicum, while P. putida cells were non‐fluorescent. Mono‐ and co‐cultivations were inoculated to the indicated ratio and cultivated in a modified nitrogen‐free version of M12‐C with 68 mM formamide as a nitrogen source for 24 h. Culture compositions were determined by flow cytometry.

The introduction of one dependency each (0/+ or +/0) was used as preparation for a consortium with mutualistic interaction. Mutual interdependencies of both species (+/+) are engineered to ensure the survival of both partners, which can also be used for the production of certain compounds (Zhang et al., 2018). Consortia of the (+/+)‐type were based on the presence/absence of formamidase for utilisation of the rare nitrogen source formamide on the one hand and on arginine production/auxotrophy on the other hand, and their composition was shown to be stable. A more balanced ratio between the strains could only be reached within 24 h in the mutualistic (+/+) consortium, in which P. putida releases ammonium as a nitrogen source for C. glutamicum, which in turn secretes arginine to supplement growth by the arginine‐auxotrophic P. putida. In a consortium with formamidase‐positive and formamidase‐negative strains of C. glutamicum, only lower ratios of formamidase‐positive strains were necessary to support growth of formamidase‐negative C. glutamicum strain (Schwardmann, Rieks, et al., 2023).

Theanine production by synthetic consortia

As an application of the designed synthetic microbial consortium, the production of theanine was chosen as example. For production, the concentration of glucose as carbon source and ammonium sulphate as nitrogen source in the medium was adjusted. As glutamate‐derived theanine, and also arginine are nitrogen‐containing substances, the nitrogen concentration in the M12‐C medium is likely to be increased. Our previously developed theanine producing strain of P. putida was used (Benninghaus et al., 2021) and 50 mM MEA were added as ethylamine donor for alkylation of endogenously synthesised glutamate by GMAS to theanine. Different concentrations of glucose (10, 20, 40 g L⁻¹) were tested. Higher glucose concentrations did not show growth benefits, but production of theanine was increased with 20 g L⁻¹ glucose. Since no further increase with 40 g L⁻¹ was determined (Figure S1A,B), 20 g L⁻¹ glucose was used for following production experiments. Also, different concentrations of ammonium sulphate (17, 34, 51 mM) were tested. No significant differences were observed in growth and only slight differences were found in the production of theanine and glutamate by consortia. In the monocultures of C. glutamicum ATCC13032 and C. glutamicum ARG2 production of glutamate and arginine was detected only when higher concentrations of the nitrogen source were provided (Figure S2A,B). Therefore, in the production experiments 34 mM ammonium sulphate as sole nitrogen source was used in M12‐C medium.

For theanine production, the producer strain P. putida Thea1 (Benninghaus et al., 2021) was used. In a consortium without any dependencies (0/0), the growth rate and biomass formation were higher compared the P. putida Thea1 monoculture, but lower compared the C. glutamicum ATCC13032 (Table 4). The co‐culture Thea1+ATCC13032 produced 1.5‐fold more theanine (2.40 ± 0.08 g L⁻¹) compared to the P. putida Thea1 monoculture (1.54 ± 0.07 g L⁻¹) (Figures 4A and S3A). The glutamate concentration in the C. glutamicum ATCC13032 monoculture (0.45 ± 0.01 g L⁻¹) was higher compared to the co‐culture Thea1+ATCC13032 (0.11 ± 0.01 l‐L⁻¹).

TABLE 4.

Growth and production data for theanine production in consortia without interaction (0/0), with arginine‐ (+/0) or ammonium‐dependency (0/+) or in a cooperative consortium with arginine‐ and ammonium‐dependency (+/+).

	Biomass [g L−1]	μ [h−1]	Glutamate [g L−1]	Arginine [g L−1]	Theanine [g L−1]	YP/X [g g−1]	YP/S [g g−1]
No interaction (0/0)
P. putida Thea1	1.0 ± 0.1	0.09 ± 0.01	0.04 ± 0.01	n.d.	1.54 ± 0.07	1.6	0.17
C. glutamicum ATCC13032	7.9 ± 0.3	0.43 ± 0.01	0.45 ± 0.01	n.d.	n.d.
P. putida Thea1 + C. glutamicum ATCC13032	4.6 ± 0.1	0.24 ± 0.02	0.11 ± 0.01	n.d.	2.40 ± 0.08	0.5	0.13
Arginine dependency (+/0)
P. putida Thea1 ΔargH	0.2 ± 0.1	0.01 ± 0.01	0.09 ± 0.01	n.d.	1.16 ± 0.04	6	0.75
C. glutamicum ARG2	4.7 ± 0.3	0.31 ± 0.01	0.13 ± 0.06	1.27 ± 0.03	n.d.
P. putida Thea1 ΔargH + C. glutamicum ARG2	3.4 ± 0.1	0.21 ± 0.01	0.14 ± 0.04	n.d.	2.57 ± 0.14	0.8	0.17
Ammonium dependency (0/+)
P. putida Thea1 FORM	2.1 ± 0.1	0.12 ± 0.01	n.d.	n.d.	4.03 ± 0.08	1.9	0.20
C. glutamicum ATCC13032	0.3 ± 0.1	0.07 ± 0.01	n.d.	n.d.	n.d.
P. putida Thea1 FORM + C. glutamicum ATCC13032	6.5 ± 0.5	0.34 ± 0.01	n.d.	n.d.	0.11 ± 0.01	0.02	0.01
Mutual dependency (+/+)
P. putida Thea1 ΔargH FORM	0.1 ± 0.1	0.00 ± 0.00	n.d.	n.d.	0.10 ± 0.02	1	0.03
C. glutamicum ARG2	0.2 ± 0.1	0.04 ± 0.01	n.d.	n.d.	n.d.
P. putida Thea1 ΔargH FORM + C. glutamicum ARG2	3.3 ± 0.4	0.20 ± 0.01	n.d.	n.d.	1.26 ± 0.51	0.4	0.07

FIGURE 4.

Production of theanine by various P. putida and C. glutamicum strains grown as monocultures or as various consortia. Concentrations of theanine (green), glutamate (blue) and arginine (yellow) in mono‐ and co‐cultures of P. putida Thea1 and C. glutamicum ATCC13032 without interdependency (0/0) (A), P. putida Thea1 ΔargH and C. glutamicum ARG2 with arginine‐dependency (+/0) (B), P. putida Thea1 FORM and C. glutamicum ATCC13032 with ammonium‐dependency (0/+) (C) and P. putida Thea1 ΔargH FORM and C. glutamicum ARG2 with arginine‐ and ammonium‐dependency (+/+) (D).

An arginine‐dependent co‐culture was established by using P. putida Thea1 ΔargH and C. glutamicum ARG2 for theanine production. The monoculture of P. putida Thea1 ΔargH did not grow, while the monoculture of C. glutamicum ARG2 grew to higher biomass formation and a faster growth rate compared to the arginine‐dependent co‐culture (Table 4). The production of theanine in the co‐culture was 2.2‐fold higher (2.57 ± 0.14 g L⁻¹) than the P. putida monoculture (1.16 ± 0.04 g L⁻¹) (Figures 4B and S3B). Glutamate concentrations were comparable in all three cultivations (around 0.1 g L⁻¹) and arginine was only detected in the monoculture of C. glutamicum ARG2 (1.27 ± 0.03 g L⁻¹).

After production of theanine was shown to be higher in both (0/0 and +/0) co‐cultivations compared to the respective monocultures, a ammonium‐dependent consortium (0/+) using formamidase‐negative strain C. glutamicum ATCC13032 with formamide‐utilising strain P. putida Thea1 FORM (Figures 4C and S3C, Table 4) and a cooperative consortium (+/+) with the arginine‐producing, formamidase‐negative strain C. glutamicum ARG2 and the arginine‐auxotrophic, but formamide‐utilising strain P. putida Thea1 ΔargH FORM were used (Figures 4D and S3D, Table 4).

For all production samples, carbohydrates, especially glucose, gluconate and ketogluconate, were measured and the yield Y_P/S was calculated based on the utilised glucose. In all measurements, gluconate and ketogluconate concentrations were below 0.02 g l ⁻¹. Glucose was measured using RID, while gluconate and ketogluconate were measured using DAD, thus a differentiation of the components was possible (Figure S4).

To initiate growth, very low concentrations (1/100) of ammonium sulphate (0.34 mM for the formamidase‐negative C. glutamicum ARG2) and arginine (0.04 mM for the arginine‐auxotrophic P. putida Thea1 ΔargH FORM) were added to the medium. Formamide was used as a nitrogen source at a concentration of 68 mM and 20 g L⁻¹ glucose were used as a carbon source. In monoculture, P. putida Thea1 FORM produced 4.03 ± 0.08 g L⁻¹ theanine with formamide as nitrogen source. The consortium with C. glutamicum ATCC13032 produced much less theanine (0.11 ± 0.01 g L⁻¹) (Figure 4C). The monoculture of P. putida Thea1 ΔargH FORM produced 0.10 ± 0.02 g L⁻¹ theanine, while the consortium with C. glutamicum ARG2 produced much more theanine (1.26 ± 0.51 g L⁻¹) (Figure 4D). As a conclusion, a cooperative consortium with arginine and nitrogen dependency was established for the production of theanine.

As shown here for the synthetic consortia producing theanine, the addition of arginine and ammonium helped to kickstart the growth of the mutualistic consortia (compare Table 4). Thus, arginine as a supplement and ammonium as a more accessible nitrogen source are critical compounds that can be used to fine‐tune the composition of the synthetic consortia. Bacteria can utilise different nitrogen sources, ranging from simple inorganic compounds like nitrate to complex nitrogen‐containing compounds like amino acids or nucleosides (Merrick & Edwards, 1995). The most preferred nitrogen source is ammonia, with supporting high growth rates. The use of other nitrogen sources is strictly regulated by the synthesis of the necessary transporters (Merrick & Edwards, 1995). Formamide is a reduced C1 nitrogen compound, such as methylamine, ammonium carbamate and carbamoyl phosphate. The latter two decompose to yield ammonia, while the first two need enzyme‐catalysed reactions for nitrogen liberation (Pols et al., 2021; Schwardmann, Wu, et al., 2023). Formamide is a rare nitrogen source in biotechnology (Schwardmann, Wu, et al., 2023) and was used in the here developed consortia with ammonium dependency (+/0 and +/+). Cross‐feeding of ammonium was shown between formamidase‐positive and formamide‐negative C. glutamicum strains (Schwardmann, Rieks, et al., 2023) and here for interspecies consortia with P. putida and C. glutamicum. Production of glutamate with formamide as a nitrogen source was also established by engineering C. glutamicum for expression of amiF from H. pylori. Comparing the product titre, there was a 2.5‐fold increase in glutamate production with formamide instead of ammonium sulphate and urea (Schwardmann, Rieks, et al., 2023). This is in line with our observations for the highest production of theanine with strain Thea1 FORM (Figure 4C) with formamide as a nitrogen source. Since formamide is also a carbon source accessible to some methylotrophs, formamide may be relevant to fine‐tune and impose nitrogen and/or carbon dependencies in synthetic interspecies microbial consortia that grow with one‐carbon C sources such as methanol or formate (Schwardmann, Benninghaus, et al., 2023).

GIPA production by synthetic consortia

Production of GIPA is similar to theanine production as GMAS is able to use isopropylamide (IPA) for alkylation of glutamate to yield GIPA. Therefore, the co‐culture design of theanine production could easily be transferred to GIPA production and the same strains were used. Instead of MEA, 50 mM IPA was added as alkylamine.

For the co‐culture without dependencies (0/0; P. putida Thea1 and C. glutamicum ATCC13032), the growth during the production of GIPA was similar to the growth during theanine production (Table S3). The production in monoculture of GIPA was 0.82 ± 0.05 g L⁻¹, while the production in co‐culture was reduced to about half with 0.46 ± 0.03 g L⁻¹ (Figure S5A). In the co‐culture, glutamate was not detected as a by‐product, while both monocultures accumulated glutamate (Thea1: 0.04 ± 0.01 g L⁻¹, ATCC13032: 0.50 ± 0.01 g L⁻¹). In the arginine‐dependent co‐culture (+/0), the growth was also comparable with the theanine‐producing co‐culture (Table S3). The production of GIPA in mono‐ and co‐culture was similar (Thea1 ΔargH: 0.57 ± 0.001 g L⁻¹; Thea1 ΔargH+ARG2: 0.59 ± 0.05 g L⁻¹) (Figure S5B). In the co‐culture, neither glutamate nor arginine were detected, while 1.31 ± 0.01 g L⁻¹ arginine accumulated in the C. glutamicum ARG2 monoculture. In conclusion, GIPA production in co‐cultures was realised and the production in the arginine‐dependent co‐culture was comparable with monoculture production.

During the production of GIPA in both, mono‐ and co‐culture, a decreased pH value of 4 to 5 was measured in all tested interaction types. To prevent this decrease, GIPA production was also tested with 100 mM potassium phosphate buffer in minimal medium (Table 5), as there is no buffer component in the used M12‐C medium. The production of GIPA was increased in monoculture of P. putida Thea1 (2.22 ± 0.23 g L⁻¹) and co‐culture of P. putida Thea1 with the C. glutamicum ATCC13032 (1.47 ± 0.13 g L⁻¹) (Figures 5A and S6A). No glutamate was measured in C. glutamicum ATCC13032 monoculture, unlike the production without buffer. In the arginine‐dependent co‐culture, 2.33 ± 0.24 g L⁻¹ GIPA was produced, while the P. putida Thea1 ΔargH monoculture produced 2.33 ± 0.49 g L⁻¹ GIPA (Figure 5B and S6B). In all cultivations, neither glutamate nor arginine could be detected. In conclusion, a balanced producing system for commensal (+/0) consortia with arginine dependency was found. Lastly, an ammonium‐dependent consortium (0/+) using the formamidase‐negative strain C. glutamicum ATCC13032 with the formamide‐utilising strain P. putida Thea1 FORM (Figures 5C and S6C, Table 5) and a cooperative consortium (+/+) for GIPA production with the arginine‐producer strain C. glutamicum ARG2 and the arginine‐auxotrophic formamide utiliser strain of P. putida Thea1 ΔargH FORM (Figures 5D and S6D, Table 5) were tested. As a nitrogen source, 68 mM formamide was added. To help kickstart growth, 1% ammonium sulphate (0.34 mM) and 0.04 mM arginine were added to the medium. Also, potassium phosphate buffer was added. P. putida Thea1 FORM produced 4.52 ± 0.23 g L⁻¹ GIPA in monoculture. The consortium with C. glutamicum ATCC13032 produced less GIPA (0.25 ± 0.02 g L⁻¹) (Figure 5C). In the cooperative consortium, 2.80 ± 0.44 g L⁻¹ GIPA was produced, while the monoculture of P. putida Thea1 ΔargH FORM produced 0.29 ± 0.03 g L⁻¹ GIPA (Figure 5D).

TABLE 5.

Growth and production data for gipa production in consortium without interaction (0/0), with arginine‐ (+/0) or ammonium dependency (0/+) or in cooperative consortium with arginine‐ and ammonium‐dependency (+/+) with 100 mM potassium phosphate buffer.

	Biomass [g L−1]	μ [h−1]	Glutamate [g L−1]	Arginine [g L−1]	gipa [g L−1]	YP/X [g g−1]	YP/S [g g−1]
No interaction (0/0)
P. putida Thea1	1.7 ± 0.1	0.15 ± 0.00	0.12 ± 0.01	n.d.	2.22 ± 0.23	1.3	0.11
C. glutamicum ATCC13032	6.1 ± 0.2	0.35 ± 0.01	n d.	n.d.	n.d.
P. putida Thea1 + C. glutamicum ATCC13032	2.6 ± 0.2	0.20 ± 0.00	n.d.	n.d.	1.47 ± 0.13	0.6	0.08
Arginine dependency (+/0)
P. putida Thea1 ΔargH	0.1 ± 0.0	0.01 ± 0.00	n.d.	n.d.	2.33 ± 0.49	23.0	0.39
C. glutamicum ARG2	3.4 ± 0.1	0.24 ± 0.01	n.d.	n.d.	n.d.
P. putida Thea1 ΔargH + C. glutamicum ARG2	2.5 ± 0.1	0.17 ± 0.00	0.10 ± 0.02	n.d.	2.33 ± 0.24	0.9	0.12
Ammonium dependency (0/+)
P. putida Thea1 FORM	2.0 ± 0.1	0.08 ± 0.01	n.d.	n.d.	4.52 ± 0.23	2.3	0.23
C. glutamicum ATCC13032	0.2 ± 0.1	0.09 ± 0.01	n.d.	n.d.	n.d.
P. putida Thea1 FORM + C. glutamicum ATCC13032	6.3 ± 0.3	0.34 ± 0.01	n.d.	n.d.	0.25 ± 0.02	0.03	0.01
Mutual dependency (+/+)
P. putida Thea1 ΔargH FORM	0.1 ± 0.1	0.00 ± 0.00	n.d.	n.d.	0.29 ± 0.03	3	0.11
C. glutamicum ARG2	0.1 ± 0.1	0.06 ± 0.01	n.d.	n.d.	n.d.
P. putida Thea1 ΔargH FORM + C. glutamicum ARG2	2.9 ± 0.4	0.16 ± 0.02	n.d.	n.d.	2.80 ± 0.44	1.0	0.14

FIGURE 5.

Production of GIPA by various P. putida and C. glutamicum strains grown as monocultures or as various consortia. Concentration of gipa (purple), glutamate (blue) and arginine (yellow) in mono‐ and co‐cultures of P. putida Thea1 and C. glutamicum ATCC13032 without interdependency (0/0) (A), P. putida Thea1 ΔargH and C. glutamicum ARG2 with arginine‐dependency (+/0) (B), P. putida Thea1 FORM and C. glutamicum ATCC13032 with ammonium‐dependency (0/+) (C) and P. putida Thea1 ΔargH FORM and C. glutamicum ARG2 with arginine‐ and ammonium‐dependency (+/+) (D) with 100 mM potassium phosphate buffer.

For all production samples, carbohydrates, especially glucose, gluconate and ketogluconate, were measured and the yield Y_P/S was calculated based on the utilised glucose. In all measurements, gluconate and ketogluconate concentrations were below 0.02 g l ⁻¹. The production of GIPA in the different consortia follows the same trend as the production of theanine. The application of different dependencies and the usage of formamide as alternative nitrogen source is already discussed for theanine production. The use of buffer showed a production benefit, and the pH value was neutral at the end of production. The control of pH value is crucial for the structure and function of proteins and for the production of ATP since it relies on the electrochemical potential of the cell. Therefore, it is important to maintain a neutral pH in the cell. By consumption of glucose the pH dropped in E. coli and P. putida cultures (Sánchez‐Clemente et al., 2018). This can be prevented by addition of buffer components in the medium. In the original composition of CgXII medium, MOPS buffer is used for maintaining pH value at pH 7 (Eggeling & Bott, 2005). In M12 minimal medium, there is no dedicated buffer component (Mückschel et al., 2012). In this study, we showed that growth and production benefit from a stable, neutral pH maintained with potassium phosphate buffer.

Further optimisation strategies

Cooperation between the partners of a mutualistic consortium for the production of a valuable product such as theanine may be fine‐tuned genetically. Instead of overexpressing the genes required for the biosynthesis of the valuable compound, their expression may be controlled by the physiological state of the cell in order to maximise production. This concept is often used for production in monocultures by expression of the biosynthesis genes from inducible promoters. In so‐called autoinduction media, a carbon source mixture of glucose and an inducing sugar (e.g. lactose for promoter P_lac or arabinose for promoter P_BAD) is used. Since E. coli preferentially grows with glucose, induction occurs later during growth upon glucose depletion (Studier, 2014). In the consortia described here, ammonium and formamide were used as nitrogen sources. Recently, nitrogen deprivation‐inducible promoters were used for dynamic growth‐decoupled gene expression or CRISPRi‐mediated gene knockdown in C. glutamicum for the production of the growth‐inhibitory sugar alcohol xylitol from xylose and were shown to be superior to standard overexpression (Schwardmann, Wu, et al., 2023). The use of arginine auxotrophy and overproduction in the consortia described here may also be developed further by using arginine‐dependent gene expression, for example based on the promoter P_arg and the transcriptional repressor ArgR from C. glutamicum (Yim et al., 2011). Fine‐tuning of consortium composition needs to be performed depending on the desired product to optimise the production and/or utilising of substrates. An equal distribution of partners is not desirable in every production consortium (Zhang et al., 2018). This is especially the case when one partner is needed to provide secreted enzymes, for example amylase, or small amounts of a nutrient, for example, lysine or arginine (Sgobba et al., 2018). Different ratios of each partner lead to different substrate utilisation and transport, secretion and uptake of intermediates (Bittihn et al., 2018; Zhang et al., 2018), like arginine and ammonium used in the here designed consortia.

Providing an additional carbon source that is only accessible to one partner of the consortium may also be used for fine‐tuning (Pan et al., 2023). Since alternative carbon sources are generally interesting in order to prevent competition with human and animal nutrition or to decrease the cost of the process, a number of bacteria, including P. putida and C. glutamicum, have been engineered for the utilisation of non‐native carbon sources (Wendisch et al., 2016). Also, complex and less refined substrates can be used (Ben Said & Or, 2017; Thuan et al., 2022). As examples of consortia utilising carbon sources other than glucose, a consortium of E. coli and Pichia pastoris produced the valuable alkaloid stylopine from glycerol (Urui et al., 2021) and a synthetic consortium of E. coli and C. glutamicum was used to produce lysine from sucrose and starch (Sgobba et al., 2018). While the provision of an additional carbon source may help to skew the composition of the consortium, this may negatively or positively affect product formation by the consortium as well. As shown for the P. putida monoculture production process (Benninghaus et al., 2021), the combined use of xylose and glycerol improved theanine production as compared to glucose‐based production. Sarcosine production by C. glutamicum was better with xylose than with glucose (Mindt et al., 2019). Besides being valuable to fine‐tune the composition of mutualistic consortia, synthetic microbial consortia may be key for better utilisation of the individual compounds present in complex substrate mixtures by individual partners of a consortium. These can be used, for example by C. glutamicum in rice straw hydrolysate (Sasikumar et al., 2021) or corn stover hydrolysate (Wen & Bao, 2019). Instead of producing a monoculture of a strain able to co‐utilise glucose, arabinose and xylose, three different strains that could use only one of these carbon sources were inoculated in various ratios and produced riboflavin (Pérez‐García et al., 2021). However, this process was dynamic, with concentrations of substrates and population sizes changing over time since the three strains were not mutually dependent. Thus, this concept may be further developed by using mutualistic instead of commensal consortia.

CONCLUSION

This study reports on the first binary microbial consortia between the industrially relevant microorganisms P. putida and C. glutamicum. Based on the complementation of arginine‐auxotrophy and on formamidase‐based utilisation of formamide as a rare xenobiotic source of nitrogen, consortia with no interaction (0/0), commensal relationships (+/0 and 0/+) and mutualistic cross‐feeding (+/+) were designed and tested, and a stable composition was achieved. As proof‐of‐concept, these synthetic consortia were applied to produce two γ‐glutamylated amines; the food and beverage additive theanine and the related GIPA. Future work on optimising the substrate and precursor supply, the replacement of refined glucose for alternative feedstocks and a deepened understanding of co‐culture dynamics may enable more sustainable, even further improved application of these consortia on larger scales.

AUTHOR CONTRIBUTIONS

Leonie Benninghaus: Conceptualization (equal); formal analysis (equal); investigation (equal); methodology (equal); writing – original draft (equal); writing – review and editing (equal). Lynn S. Schwardmann: Conceptualization (equal); investigation (equal); methodology (equal); writing – original draft (equal); writing – review and editing (equal). Tatjana Jilg: Conceptualization (equal); investigation (equal); writing – review and editing (equal). Volker F. Wendisch: Conceptualization (equal); formal analysis (equal); resources (equal); supervision (equal); writing – review and editing (equal).

FUNDING INFORMATION

No funding information provided.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflict of interest.

Supporting information

Data S1..

Benninghaus, L. , Schwardmann, L.S. , Jilg, T. & Wendisch, V.F. (2024) Establishment of synthetic microbial consortia with Corynebacterium glutamicum and Pseudomonas putida: Design, construction, and application to production of γ‐glutamylisopropylamide and l‐theanine. Microbial Biotechnology, 17, e14400. Available from: 10.1111/1751-7915.14400