Baicalein attenuates rotenone-induced SH-SY5Y cell apoptosis through binding to SUR1 and activating ATP-sensitive potassium channels

Abstract

Dopaminergic neurons in the substantia nigra (SN) expressing SUR1/Kir6.2 type ATP-sensitive potassium channels (K-ATP) are more vulnerable to rotenone or metabolic stress, which may be an important reason for the selective degeneration of neurons in Parkinson’s disease (PD). Baicalein has shown neuroprotective effects in PD animal models. In this study, we investigated the effect of baicalein on K-ATP channels and the underlying mechanisms in rotenone-induced apoptosis of SH-SY5Y cells. K-ATP currents were recorded from SH-SY5Y cells using whole-cell voltage-clamp recording. Drugs dissolved in the external solution at the final concentration were directly pipetted onto the cells. We showed that rotenone and baicalein opened K-ATP channels and increased the current amplitudes with EC₅₀ values of 0.438 μM and 6.159 μM, respectively. K-ATP channel blockers glibenclamide (50 μM) or 5-hydroxydecanoate (5-HD, 250 μM) attenuated the protective effects of baicalein in reducing reactive oxygen species (ROS) content and increasing mitochondrial membrane potential and ATP levels in rotenone-injured SH-SY5Y cells, suggesting that baicalein protected against the apoptosis of SH-SY5Y cells by regulating the effect of rotenone on opening K-ATP channels. Administration of baicalein (150, 300 mg·kg⁻¹·d⁻¹, i.g.) significantly inhibited rotenone-induced overexpression of SUR1 in SN and striatum of rats. We conducted surface plasmon resonance assay and molecular docking, and found that baicalein had a higher affinity with SUR1 protein (K_D = 10.39 μM) than glibenclamide (K_D = 24.32 μM), thus reducing the sensitivity of K-ATP channels to rotenone. Knockdown of SUR1 subunit reduced rotenone-induced apoptosis and damage of SH-SY5Y cells, confirming that SUR1 was an important target for slowing dopaminergic neuronal degeneration in PD. Taken together, we demonstrate for the first time that baicalein attenuates rotenone-induced SH-SY5Y cell apoptosis through binding to SUR1 and activating K-ATP channels.

Introduction

Parkinson’s disease (PD) is a fatal neurodegenerative illness in elderly population, which is characterized by classical motor symptoms such as resting tremor, muscular rigidity, bradykinesia, and postural reflex disorders [1]. From 1990 to 2015, millions of people around the world were affected [2]. The main pathological feature of PD is the progressive loss of dopaminergic neurons in the substantia nigra (SN) [3]. It’s worth noting that the release of dopamine and the firing activity of neurons in SN are regulated by ion channels, and dysregulations of these channels lead to disruption of intracellular signaling cascades, changes in homeostasis and deficiencies in bioenergy [4]. Therefore, Parkinson disease is also called “ion channel disease” [5, 6].

ATP-sensitive potassium channel (K-ATP) is a heterooctamer formed by a 4:4 combination of inward-rectifier potassium channel (Kir6.x) and sulfonylurea receptor (SUR) subunits [7]. It has been studied that K-ATP channels in SN neurons are more sensitive to acute effects of rotenone, a commonly parkinsonian toxin, than that in nigral non-dopaminergic neurons or locus coeruleus (LC) neurons [8], and SUR1/Kir6.2 subtype of channels was particularly sensitive to it in SN [9]. It suggested that the channels play a central role in driving the high vulnerability of dopaminergic neurons to degenerate during PD. SUR1 subunits regulate channel sensitivity to ATP, adenosine, agonists, and blockers. Studies have shown elevated the mRNA level of SUR1 subunits as well as high burst firing in SN dopamine (DA) neurons in humans and mice with PD, which promoted excitotoxicity when metabolically challenged [10, 11]. Given the abnormal expression and the role of K-ATP channels in PD, it is critical to find a drug that modulates the channels to slow the progression of dopaminergic neuron degeneration.

Baicalein (5,6,7-trihydroxyflavone) is a bioactive flavonoid extracted from the root of Scutellaria baicalensis Georgi. Previous studies have shown that β form baicalein has favorable safety profile and pharmacokinetic properties [12], and it can cross the blood-brain barrier to central nervous system as its great lipophilicity [13, 14]. As a result, baicalein demonstrates antibacterial, antiviral, anticarcinogenic and anti-inflammatory activities [15]. Our recent researches have revealed that baicalein exhibited significant neuroprotection and significantly improved tremor, bradykinesia and depression in PD animals [16–21]. Some of the effects of baicalein, such as attenuating iron accumulation, inhibiting neuronal apoptosis and mitochondrial oxidative stress [22, 23], are closely related to K-ATP channels [6, 24]. Although there have been some reports [25], it is still unclear whether baicalein has a regulatory effect on K-ATP channels and its role in PD treatment. In the following sections, we used rotenone to set up model of PD in SH-SY5Y cells and investigated how baicalein inhibited neuronal apoptosis by regulating K-ATP channels.

Materials and methods

Drugs and reagents

Baicalein (98% purity, crystal β form) was prepared by the Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College. Rotenone, pinacidil, glibenclamide and 5-hydroxydecanoate (5-HD) were purchased from Sigma-Aldrich (St. Louism, Mo, USA).

Radio-Immunoprecipitation Assay (RIPA) lysis buffer and Bicinchoninic Acid (BCA) kit were purchased from Beyotime Biotechnology (Nantong, China). Antibodies, including Bcl-2, cleaved-Caspase3, cleaved-Caspase9 and cleaved-PARP, were purchased from Cell Signaling Technology (Beverly, MA, USA). Kir6.1, Kir6.2 and GAPDH were from Proteintech (Rosemont, IL, USA). SUR1 was from Thermo Fisher (Waltham, MA, USA). Goat anti-mouse/rabbit antibodies and enhanced chemiluminescence (ECL) Western blot kit were purchased from CW Biotech (Taizhou, China). Recombinant human SUR1 protein was purchased from Abbexa (Cambridge, MA, UK). The other reagents were commercially available and analytical grade. ABCC8-siRNA was purchased from Ribobio (Guangzhou, China). CCK-8 kit was purchased from Dojindo (Kumamoto, Japan). CellCouting-Lite^TM 2.0 kit and 2× Taq Pro Universal SYBR qPCR master mix were purchased from Vazyme Biotech (Nanjing, China). MonScript™ 5× RTIII all-in-one mix was purchased from Monad Biotech (Suzhou, China). Mitochondrial membrane potential (MMP) assay kit with JC-1 was from Beyotime Biotechnology (Shanghai, China).

SH-SY5Y cell culture and drug treatments

SH-SY5Y cells were cultivated in DMEM medium supplemented with 10% (v/v) heat-inactivated FBS and cultured at 37 °C in a humidified incubator with a 5% CO₂ atmosphere. When the cells reached at about 70% confluency, cells were preincubated for 0.5 h in DMEM containing 50 μM glibenclamide or 250 μM 5-HD before being exposed to 3 μM baicalein. After 2 h, rotenone at a final concentration of 0.3 μM was added to the media for 24 h.

Animals and grouping

Male SD rats, weighing 220 g, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. [Beijing, China; Animal certification number SCXK (Jing) 2016-0011]. At the beginning of the experiments, all animals were housed in an SPF environment with a regular 12 h light-dark cycle and allowed to have free access to water and food. The animal care and handling were performed in accordance with the principles of the NIH Guide for the Care and Use of Laboratory Animals. All protocols were approved by the Animal Ethics Committee of the Chinese Academy of Medical Science and Peking Union Medical College. The rats were randomly divided into four groups: the control group, model group, Bai-150 (mg/kg) group and Bai-300 (mg/kg) group [26]. Except for the control group, all of the groups received an intraperitoneal injection of 2.5 mg/kg rotenone q.d. for 6 weeks. Besides, the rats of Bai groups were administered 150 mg/kg or 300 mg/kg q.d. (i.g.) baicalein from the third to sixth week, and the control group received an equal volume of vehicle all the time.

siRNA transfection

The ABCC8-siRNA was transfected into SH-SY5Y cells to knockdown the expression of SUR1 subunit according to the recommended procedure. The sequence of si-ABCC8-RNA was shown in Table 1. Briefly, SH-SY5Y cells were seeded into 6-cm dishes and cultured for 24 h. Cells were transfected with 50 nM siRNA using Lipofectamine 3000 according to the manufacturer’s directions. Forty-eight hours later, the cells were re-seeded in 96-well plates or dishes, incubated with 0.3 μM rotenone for 24 h, and then used to detect various indicators.

Table 1.

siRNA gene sequence.

Gene name	Target sequences (5′-3′)
siRNA-1	GTGGTCTACTATCACAACA
siRNA-2	CCATCCTTGAGTTCGATAA
siRNA-3	GCCTTACCTACGCCCTAAT

Automated patch clamp electrophysiology

Cells were patch clamped in the whole cell voltage or current clamp configuration, using a fully automated patch clamp workstation (Patchliner, Nanion Technologies, Germany) equipped with an HEKA EPC 10 amplifier (HEKA). The external recording solution contained (mM): NaCl 140; KCl 4; CaCl2 2; MgCl2 1; HEPES 10; glucose 5, pH 7.4. The internal recording solution contained (mM): KCl 50; KF 60; NaCl 10; EGTA 20; HEPES 10, pH 7.2. The PatchControl software (Nanion technologies) applied a suction protocol to automatically capture a cell at room temperature (24 ± 2 °C), and to obtain a G-Ohm seal. Eventually, a whole cell configuration was obtained. Cells were depolarized from a holding potential of –70 to +50 mV for 240 ms to open K-ATP channels, and the current was recorded by the Patchmaster software and all signals were collected at a sample rate of 10 kHz, sweep interval of 20 s, and filtered at 3 Hz (built in Bessel filter). Differently, the resting membrane potential of the cells was detected in the current clamping mode. The compounds, dissolved at the appropriate final concentration in the external solution, were directly pipetted onto the chip and the percentage of the current or membrane potential after compound application was used to evaluate the effect of each concentration.

Intracellular reactive oxygen species (ROS) measurement

Level of intracellular ROS was measured by H2DCFDA fluorescence. SH-SY5Y cells were seeded in 6-well plates and cultured as described previously. After being harvested and washed, cells were incubated with 2 μM H2DCFDA dissolved in DMEM at 37 °C for 30 min in the dark and washed with PBS for three times. Flow cytometry (BD Accuri C6) was performed to measure the ROS level and the data were analyzed by Flow Jo-V10 software.

Measurement of SH-SY5Y mitochondrial membrane potential

SH-SY5Y mitochondrial membrane potential (MMP, ΔΨm) was assessed with the fluorescent 5,5’,6,6’-tetrachloro-1,1’,3,3’-tetraethylbenzimidazolocarbocyanine iodide (JC-1). SH-SY5Y cells were incubated with 10 μg/L of JC-1 for 20 min at 37 °C and washed three times with PBS. MMP of the cells was photographed under a fluorescence microscope (Nikon, Eclipse, Ti-U) and the intensity was qualified with a SpectraMax M5 plate reader (monomers: 490 nm-excitation and 530 nm-emission, aggregates: 525 nm-excitation and 590 nm-emission).

Detection of intracellular ATP levels

SH-SY5Y cells were seeded in 96-well plates and cultured as described previously. After drug incubation, the plate was removed from the incubator and placed at RT for 30 min and added with 100 μL CellCouting-LiteTM 2.0 in each well. The cells were thoroughly lysed for 2–5 min, placed at RT for 10 min, and intracellular ATP level could be measured by multimode plate reader (EnSpire, PerkinElmer, US).

Determination of cell viability

CCK-8 Kit was used to assess cell viability at the end of drug treatment. The culture media was replaced by new media with CCK-8. After 2 h of incubation at 37 °C, the absorbance in each well was measured at 490 nm using a SpectraMax M5 plate reader (Molecular Devices).

Apoptosis assay

The rate of apoptosis in SH-SY5Y cells was determined using a PI/Annexin V-FITC kit. After 24 h of 0.3 mM rotenone treatment, cells were harvested, washed with phosphate-buffered saline (PBS), and then stained for 15 min at RT with propidium iodide (PI) and Annexin V-FITC. Flow cytometry was performed by a BD Accuri C6 (San Diego, CA, USA) to detect and qualify the apoptosis rate, which was then analyzed by Flow Jo-V10 Software (Tristar, CA, USA).

Protein detection by Western blotting

Cells were washed, harvested, and lysed with RIPA lysis buffer at 4 °C for 30 min to extract total protein. Protein concentration was then determined by the BCA method. Using 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, equivalent amounts of protein were separated and transferred to a PVDF (polyvinylidene fluoride) membrane. The membranes were blocked in 5% fat-free milk for 2 h at RT, incubated with different antibodies overnight at 4 °C, followed by 2 h incubation with goat anti-mouse or anti-rabbit HRP-conjugated secondary antibody. Immunoreactive bands were performed using an ECL Western blot kit.

Surface plasmon resonance assay

For surface plasmon resonance (SPR) assay, a Biacore X100 system (GE Healthcare Life Sciences, Marlborough, MA, USA) was used to detect the interaction between SUR1 and baicalein or glibenclamide. Briefly, SUR1 protein was immobilized on an active CM5 chip (GE Healthcare Life Sciences). Different concentrations of baicalein and glibenclamide were dissolved in the running buffer, passed over the chip at a specific flow rate, and the K_D value was measured from the affinity curve generated.

Immunofluorescence staining

Based on the method of Liu et al. [22], after 4-week baicalein (150 mg/kg or 300 mg/kg) treatment, the animals with rotenone (2.5 mg/kg) injection were anesthetized and perfused intracardially with 4% paraformaldehyde solution (PFA). Brain sections of SN and striatum (Str) were permeabilized with 0.3% Triton X-100 and blocked by serum before incubation with anti-SUR1 primary antibody (1:100) overnight at 4 °C, exposed to appropriate fluorescent probe-conjugated secondary antibody at 25 °C for 2 h. The sections were stained with 4', 6-diamidino-2-phenylindole (DAPI) for 10 min to make nuclei stained. The slides were scanned by Pannoramic DESK, P-MIDI, P250 (3DHISTECH Ltd., Hungary), and quantitated by densitometry using Image-Pro Plus 6.0.

RNA extraction and gene expression assay by qRT-PCR

To identify the mRNA expression of subunits of K-ATP channels on SH-SY5Y cells, total RNA was extracted with TRIzol regent as detailed by previous research [27]. After RNA quantification, cDNA was synthesized using MonScript™ 5× RTIII all-in-one mix according to instructions of the manufacturer. Quantitative real- time RT-PCR (qRT-PCR) was performed using 2× Taq Pro Universal SYBR qPCR master mix. The primers were listed in Table 2 and β-actin was used as internal control.

Table 2.

Specific primer pairs.

Primer name	Primer sequence (5′-3′)
ABCC8	F: TCACACCGCTGTTCCTGCT
	R: AGAAGGAGCGAGGACTTGCC
KCNJ8	F: CTGGCTGCTCTTCGCTATC
	R: AGAATCAAAACCGTGATGGC
KCNJ11	F: CCAAGAAAGGCAACTGCAACG
	R: ATGCTTGCTGAAGATGAGGGT
β-Actin	F: CACGATGGAGGGGCCGGACTCATC
	R: TAAAGACCTCTATGCCAACACAGT

Statistical analysis

The quantitative experimental data were calculated as means ± standard deviation (SEM), representative of at least three independent experiments. Statistical significance was determined using one-way ANOVA. P < 0.05 was considered statistically significant.

Results

Rotenone and baicalein open K-ATP channels in different types

After a stable whole-cell recording mode was formed, the original external solution was replaced with different concentrations of compounds (dissolved with fresh external solution), at intervals of 1 min each time. As illustrated in Fig. 1, K-ATP channel currents (I_K-ATP) were enhanced and inhibited in a concentration dependent manner by its agonist pinacidil (Fig. 1b, c) and blocker glibenclamide (Fig. 1d, e), respectively, but were not altered by external solution (Fig. 1a). It suggested that the detected I_K-ATP is relatively specific and stable. Notably, rotenone evoked the K-ATP channels and increased current amplitudes with an EC₅₀ of 0.438 μM (Fig. 1f, g). Similarly, baicalein also directly activated the channels but with an EC₅₀ of 6.159 μM (Fig. 1h, i). As shown in Fig. 1j, 10 μM baicalein made the outflow of potassium ions in SH-SY5Y, resulting in decreased membrane potential and hyperpolarization of the cell membrane, which further confirmed the activation of K-ATP channels by baicalein. Here, we demonstrate for the first time that K-ATP channels on SH-SY5Y cells are more responsive to rotenone than to baicalein.

Fig. 1. Rotenone and baicalein activated K-ATP channels in vitro.

a The effect of external solution on I_K-ATP (n = 5–8). b, c Representative traces and maximal current amplitude of I_K-ATP activated by pinacidil (0–100 μM) (n = 3–4). d, e Representative traces and maximal current amplitude of I_K-ATP inhibited by glibenclamide (0–100 μM) (n = 3–6). f, g Example traces and concentration response curve of I_K-ATP obtained using 0.03, 0.1, 0.3, 1 and 3 μM rotenone on SH-SY5Y cells (n = 5). h, i Example traces and concentration response curve of I_K-ATP obtained using 0.3, 1, 3, 10, 30 and 100 μM baicalein on SH-SY5Y cells (n = 6–10). j Representative trace and membrane potential induced by 10 μM baicalein (n = 5). Data are presented as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001 vs control group.

K-ATP channels blockers abolished the effect of baicalein on preventing rotenone-induced MMP loss, ROS production, and ATP consumption in SH-SY5Y cells

To further investigate the effect of rotenone and baicalein on the activation of K-ATP channels, the changes in ROS generation, MMP and ATP level were measured. ROS can initiate apoptosis by inducing the loss of MMP [28], as revealed by the experimental results, rotenone increased the content of intracellular ROS, the ratio of JC-1 monomer/JC-1 aggregate and markedly reduced ATP level to 72.8% of control. On the contrary, pretreatment with baicalein (3 μM) successfully suppressed rotenone-induced ROS production (Fig. 2a, c), increased MMP (Fig. 2b, d) and ATP level (Fig. 2e). Moreover, all the protective effect of baicalein was blocked by glibenclamide (50 μM) and 5-HD (250 μM), these findings suggested that rotenone induced mitochondrial disruption by activating K-ATP channels, while baicalein has a protective effect via changing the opening of channels.

Fig. 2. K-ATP channels blockers abolished the effect of baicalein on preventing rotenone-induced mitochondrial disruption in SH-SY5Y cells.

a, c Representative images and quantitative analysis of reactive oxygen species content detected by using H2DCFDA staining. b, d Representative images of quantitative analysis mitochondrial membrane potential detected by using JC-1 staining. e The amount of ATP in SH-SY5Y cells. Data are presented as mean ± SEM (n = 3–4). *P < 0.05, **P < 0.01, ***P < 0.001 vs another group.

K-ATP channels blockers abolished the anti-apoptotic effect of baicalein in SH-SY5Y cells

As shown in Fig. 3a–c, 0.3 μM baicalein had no cytotoxicity, but improved the survival rate of SH-SY5Y cells injured by 0.3 μM rotenone. However, 50 μM glibenclamide or 250 μM 5-HD significantly inhibited the protection, which had no effect when treated alone. Besides, exposed to rotenone for 24 h, the cell apoptosis rate greatly increased (P < 0.001), but baicalein reduced it, which was absolutely abolished by K-ATP channel blockers glibenclamide and 5-HD (Fig. 3d, e). The results of Western blot further confirmed that baicalein significantly upregulated the expression of anti-apoptotic protein Bcl-2 while it downregulated the expression of pro-apoptotic proteins cleaved-Caspase3, cleaved-Caspase9 and cleaved-PARP, and these effects were also inhibited by glibenclamide and 5-HD (Fig. 3f–j). These findings revealed that baicalein can reverse rotenone-induced apoptosis via activating K-ATP channels to increase neurocyte viability.

Fig. 3. Baicalein inhibits rotenone-induced SH-SY5Y viability damage and apoptosis.

a The viability of SH-SY5Y cells incubated with 0, 0.1, 0.3, 1, 3, 10 and 30 μM baicalein for 24 h. b The protective effect of baicalein on SH-SY5Y cells injured by 0.3 μM rotenone. c The protective effect of baicalein was inhibited by 50 μM glibenclamide or 250 μM 5-HD. d, e Representative images and quantitative analysis of apoptosis detected by PI/Annexin V-FITC double staining. f–j Representative images and quantitative analysis of Bcl-2, c-Cas3, c-Cas9 and c-PARP expression detected by Western blot. Data are presented as mean ± SEM (n = 3–4). ^*P < 0.05, ^**P < 0.01, ^***P < 0.001 vs another group.

Baicalein bound to SUR1 and reduced K-ATP channels response sensitivity to rotenone

Long-term energy stress may raise the opening rate and opening sensitivity of K-ATP channels, which may be the reason of rotenone-induced apoptosis. Although baicalein activated K-ATP channels, pretreatment with 3 μM baicalein for 2 h significantly alleviated rotenone-induced maximal current amplitude of I_K-ATP on SH-SY5Y cells (Fig. 4a, b, e). However, rotenone preincubation increased the EC₅₀ of baicalein activating K-ATP channels and significantly upregulated the current amplitudes at baseline, indicating that rotenone had partially opened the channels (Fig. 4c–e). In addition, surface plasmon resonance assay revealed that baicalein was tightly bound to SUR1 with a K_D of 10.39 μM (Fig. 4f, g), which was about one half of the K_D of the positive drug glibenclamide (24.32 μM) (Fig. 4h, i). Molecular docking also confirmed that baicalein embedded in the active binding pocket of SUR1 subunit, which is also the side of standard ligand (glibenclamide (DB01016)) bound to K-ATP channel (PDB:6BAA) [29]. Baicalein, with a CDOCKER energy of −45.54 kJ/mol, mainly through four hydrogen bonds to MET429, ARG1246, ARG1300, and TRP430 (Fig. 4j), while the CDOCKER energy of gliabenclamide was −38.355 kJ/mol (Fig. 4k). These results suggested that baicalein reduced the sensitivity of K-ATP channels to rotenone through binding to SUR1 subunit.

Fig. 4. Baicalein bound to SUR1 and reduced K-ATP channels response sensitivity to rotenone.

a Example traces of I_K-ATP obtained using 0.03, 0.1, 0.3, 1 and 3 μM rotenone on SH-SY5Y cells preincubated with 3 μM baicalein for 2 h (n = 4–5). b Concentration response curve of rotenone-induced I_K-ATP on SH-SY5Y cells with or without preincubation of baicalein. c Example traces of I_K-ATP obtained using 0, 0.3, 1, 3, 10, 30 and 100 μM baicalein on SH-SY5Y cells preincubated with 0.3 μM rotenone for 2 h. d Concentration response curve of baicalein-induced I_K-ATP on SH-SY5Y cells with or without preincubation of rotenone (n = 4–7). e 3 μM baicalein preincubation down-regulated the I_K-ATP amplitude at baseline, while 0.3 μM rotenone preincubation up-regulated the basic I_K-ATP (n = 6–8). f–i Surface plasmon response of SUR1 recorded in the presence of different concentrations of baicalein and glibenclamide. j, k The molecular docking interactions of SUR1 protein with the compounds baicalein and glibenclamide. Data are presented as mean ± SEM. *P < 0.05, **P < 0.01 vs other group.

Baicalein downregulated the overexpression of SUR1 induced by rotenone

Early studies established that the mRNA levels of SUR1 subunit in the remaining SN DA neurons from human PD midbrains were elevated [10]. Our previous research has suggested that baicalein significantly increased the time of rats staying on the rotarod and retention time on the inclined plane, as well as the number of TH-positive cells in SN [22]. Here, we determined that baicalein significantly reduced the expression of SUR1 in SN and Str of rotenone-treated rats (Fig. 5a–d). In vitro, according to the statistical analysis of protein bands and RT-PCR results, the content of SUR1 in SH-SY5Y cells was consistent with the results determined in rats, and K-ATP channels inhibitors glibenclamide and 5-HD totally blocked the effect of baicalein on reducing SUR1 expression in protein level (Fig. 5e). Besides, the other two subunits, Kir6.1 and Kir6.2 showed no significant changes except for the mRNA level of Kir6.2 (Fig. 5g–j). Collectively, our data demonstrated that baicalein decreased the sensitivity of K-ATP channels response to rotenone by also reducing the expression of SUR1 subunit.

Fig. 5. Baicalein downregulated the overexpression of SUR1 induced by rotenone.

a–d Representative images and quantitative analysis of SUR1 expression in substantia nigra and striatum detected by immunofluorescence staining. e, g, i Representative images and quantitative analysis of SUR1, Kir6.1 and Kir6.2 expression detected by Western blot. f, h, j The relative mRNA levels of ABCC8, KCNJ8, and KCNJ11 detected by qRT-PCR. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 vs another group.

SUR1-knockdown weakened rotenone-induced K-ATP channel currents and reversed the survival and apoptosis of SH-SY5Y cells

Compared with other subunits, SUR1 serves as the K-ATP channel regulator. Although several studies have also shown the opening effect of rotenone on K-ATP channels in PC12 cells [30], RVLM (rostral ventrolateral medulla) [31] and SNc dopaminergic neurons [32], there is no direct evidence for the role of SUR1 in K-ATP channels response to rotenone. In the study, we found that K-ATP channels lost its responsiveness to rotenone after knocking down the SUR1 subunit (Fig. 6d, e), which increased cell survival (Fig. 6a-c). Moreover, SUR1 knockdown increased intracellular ATP concentration and MMP of SH-SY5Y cells injured by rotenone (Fig. 6h, j), reversed the expression of Bcl-2 and cleaved-Caspase3 (Fig. 6k, l), ultimately inhibited non-viable apoptosis, but had no effect on viable apoptosis (Fig. 6f, g, i). These findings indicated that the SUR1 is the key regulator mediating rotenone’s opening on K-ATP channels.

Fig. 6. SUR1 knockdown reversed the survival and apoptosis of SH-SY5Y cells by weakening I_K-ATP.

a Results from qRT-PCR showed the mRNA level of ABCC8 was decreased by siRNA-1, siRNA-2 and siRNA-3. b Results of Western blot showed that the protein expression of SUR1 was decreased by siRNA-2 and siRNA-3. c Results of CCK-8 showed that silencing SUR1 reversed rotenone-damaged survival of SH-SY5Y cells. d Concentration response curve of rotenone-induced I_K-ATP on SH-SY5Y cells with or without SUR1 knockdown (n = 5–10). e Representative traces of rotenone-induced I_K-ATP on si-SUR1-SH-SY5Y cells. f, g, i Flow cytometry showed the knockdown of SUR1 reduced the non-viable but not viable apoptosis of SH-SY5Y cell damaged by rotenone. h The amount of ATP in SH-SY5Y cells. j Representative images of MMP. k, l Representative images and quantitative analysis of Bcl-2 and c-Cas3 expression. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001 vs another group.

Discussion

Rotenone is a lipophilic complex I in mitochondria’s respiratory chain. It can easily cross the blood-brain barrier and enter dopaminergic neurons to induce oxidative stress injury and cell apoptosis, resulting in PD-like behavioral changes and pathological features in animals, which is very similar to clinical PD. In recent years, multiple studies have made new discoveries that rotenone is a K-ATP channel opener [8, 30–32], paradoxically, another evidence has also shown that K-ATP channel openers (KCOs) such as pinacidil and diazoxide exert significant neuroprotection in several models of PD [33, 34]. So how to explain the double-edged sword of KCOs in the pathological process of PD?

K-ATP channels, which link cell metabolism to its membrane potential, are widely distributed in the brain. Under physiological conditions, channels are mostly closed [35], but along with the enhancement of neuronal electrical activity, the channels are opened, causing hyperpolarization of neuron membranes and reduce cell excitability [36]. Therefore, blocking the channels completely would make the cells or organelles lose the ability to evoke stability in biological systems in distinct clinical settings, which trigger hormone secretion, neurotransmitter release and/or internal signaling [37]. However, prolonged over-opening can lead to more severe oxidative stress, in particular, the K-ATP channels of dopamine neurons are more sensitive to rotenone [8]. In the present study, we provided direct electrophysiological evidence that both rotenone and baicalein activated K-ATP channels in different types. In other word, the channels had a lower sensitivity to baicalein than rotenone. In addition, baicalein pretreatment significantly down-regulated rotenone-induced I_K-ATP, while rotenone preincubation increased the basal current but inhibited the activation efficiency of baicalein on K-ATP channel. It further confirmed that treatment of baicalein had potential to reduce the burst firing of neurons by activating channels but avoid oxidative stress caused by prolonged opening of the channels.

Previous studies have reported that rotenone-induced PD models generally showed an increase in ROS level and a decrease in ATP content, which were also factors inducing K-ATP channel opening [33, 38]. Therefore, in this pathological environment, rotenone is more likely to open K-ATP channels on SN DA neurons. However, baicalein, as a natural flavonoid compound, can reduce intracellular oxidative stress [39]. What is more noteworthy is K-ATP channel blockers partially eliminated the effects of baicalein in clearing ROS, reversing ATP consumption and mitochondrial membrane potential, indicating that baicalein improved intracellular environment by regulating K-ATP channels and ultimately reduced cell apoptosis. These results suggested that baicalein may have potential to reverse the damage of neurons in the brain and improve the symptoms of patients with PD by activating K-ATP channels.

As mentioned above, functional K-ATP channel is composed of two very different subunits, SUR1/Kir6.1 subtype is particularly susceptible to rotenone, and the mRNA level of SUR1 subunit in PD patients is much higher than normal patients [7, 10, 33]. Similarly, in both rotenone-induced SD rats and SH-SY5Y cells, we detected upregulated SUR1, which may cause higher K-ATP channel currents. Interestingly, baicalein not only significantly reversed SUR1 expression, but also tightly bound to the SUR1 subunit, which might be the reasons why baicalein decreased the channel response to rotenone. This suggested that the regulation of SUR1 may be an important way to change the sensitivity of K-ATP channels [40]. As further confirmation, our study showed that K-ATP channels without SUR1 subunit almost lost its response to rotenone, and the corresponding result was the recovery of vitality and the reduction of non-viable apoptosis.

In addition, we also found that after rotenone injury, other subunits of K-ATP channels in SH-SY5Y cells, including Kir6.1 and Kir6.2, did not have significant difference at protein level, although the mRNA KCNJ11 level of Kir6.2 transcription decreased. However, other studies also said that deletion of Kir6.2 dramatically alleviated PD-like motor dysfunction of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) by suppressing the excessive iron accumulation [41]. Astrocytic Kir6.1 KO mice also showed more dopaminergic neuron loss and more astrocyte reactivity in SN compacta [42, 43]. These findings indicated that in other brain cells, subunits other than SUR1 of K-ATP channels also play an important role in the occurrence and development of PD, which is what we need to continue to pay attention to in future studies.

K-ATP channel is a double-edged sword in PD, and current studies mainly attributed this contradiction to the selective activation of the channels, including differences in channels subtypes and distribution. For example, dopaminergic neurons expressing the SUR2B subunits are more sensitive to damage [9], and neurons in SN are more easily to degenerate than those in VTA [44]. As shown in Fig. 7, we explain the pathogenesis of PD for the first time in terms of the opening degree of K-ATP channels in this study. The high opening of K-ATP channels can cause hyperpolarization of dopaminergic neurons and complete loss of their normal electrophysiological activity [10]. On the contrary, baicalein slightly opens channels to counteract excessive neuronal firing, followed by baicalein binding to SUR1 subunit and reducing its expression to reduce the sensitivity of K-ATP channels to rotenone, and further protects neurons against rotenone-induced cytotoxicity via inhibiting ROS overproduction and subsequently ameliorating mitochondrial function. Furthermore, the present study provides important preliminary evidence suggesting that the SUR1 subunit of K-ATP channels would be a novel potential target for baicalein in the treatment of PD.

Fig. 7. Diagram showing the proposed mechanisms of baicalein against Parkinson’s disease via regulating K-ATP channels.

After rotenone treatment, K-ATP channels are over opened, leading to mitochondrial dysfunction and neuronal apoptosis in Parkinson’s disease. Baicalein binds to SUR1 subunit and inhibits the expression of SUR1, reducing the sensitivity of K-ATP channels to rotenone. In addition, baicalein mildly activates the channels in response to neuronal excitatory toxicity, which is absent from inhibitors.

Author contributions

DWK performed most of the experiments, analyzed the data and wrote the draft. LDD and RZL assisted in animal experiments. TYY and SBW carried out the Western blotting. YHW and YL provided baicalein (98% purity, crystal β form). LHF and GHD designed the project and revised the draft.

Competing interests

The authors declare no competing interests.