Skip to main content
ZooKeys logoLink to ZooKeys
. 2023 Dec 12;1186:123–137. doi: 10.3897/zookeys.1186.112657

Description of the first stygobiotic species of the atyid shrimp genus Sinodina (Decapoda, Caridea, Atyidae) from Yunnan Province, China

Xuankong Jiang 1, Jiajun Zhou 2,3, Jianguo Wang 4,5, Wenlong Chen 4,5,, Huiming Chen 1,
PMCID: PMC10836366  PMID: 38312856

Abstract

Sinodina Liang & Cai, 1999, a genus of atyid shrimp, is endemic to China and distributed only in the Yunnan-Guizhou Plateau. We describe here the thirteen species of Sinodina, and the first cave-dweller of the genus, Sinodinaashimasp. nov., collected from a limestone cave in Shilin County, Yunnan Province. This species can be distinguished from its congeners by the completely degraded pigment and eyes, the extremely long rostrum, the rostral formula and the absence of sexual dimorphism of the third and fourth pereiopods. A phylogenetic analysis based on four genes (COI, 16S, 18S, H3) shows that the new species strongly clustered with the type species of this genus, Sinodinagregoriana (Kemp, 1923), supporting the generic status of this new species.

Key words: Diversity, morphology, new species, phylogeny, stygobiont, taxonomy

Introduction

The genus Sinodina Liang & Cai, 1999 belongs to the order Decapoda and the family Atyidae. It was established by Liang and Cai (1999) on the type species Caridinagregoriana Kemp, 1923. In the paper, the authors also transferred Caridinayui Liang & Yan, 1985, Caridinaacutipoda Liang, 1989 and Caridinabispinosa Liang & Yan, 1990 (in Liang 1990) to Sinodina, and published three new species, Sinodinadianica Liang & Cai, 1999, S.wangtai Liang & Cai, 1999 and S.lijiang Liang & Cai, 1999. Chen and Liang (2002) described a new species Sinodinayongshengica Chen & Liang, 2002 from Yongsheng, Yunnan, China. Liang (2002) based on the specimens from Jiangchuan, Yunnan, described Sinodinaangulata Liang, 2002. Liang (2004) reviewed the genus and placed Caridinaleptopropoda Liang, 1990, Caridinaheterodactyla Liang & Yan, 1985 and Caridinabanna Cai & Dai, 1999 into Sinodina. Ultimately, a total of 12 species have been recorded (Liang 2004; De Grave and Fransen 2011), making it the third largest genus of Atyidae in the Chinese fauna, after Caridina and Neocaridina. All of these species are endemic to a narrow range and only distributed in Yunnan Province, southwest China, except Sinodinagregoriana (Kemp, 1923), which has a relatively larger distribution range, not only in some lakes in Yunnan but also in Caohai Lake, Guizhou Province (Liang 2004).

The morphology of Sinodina is similar to that of the genera Caridina and Neocaridina, and they share the same branchial formula. Sinodina can be identified by the simple and lamellar podobranch of the second maxilliped and the obvious sexual dimorphism, that is, the male possesses more spines and distinctive dilation on the propodus of the third and fourth pereiopod (Liang and Cai 1999). According to Liang (2004), both the simple podobranch and the dilated pereiopod with a large number of spines of the male are plesiomorphic. Thus, Sinodina probably is a more basal group than Caridina and Neocaridina.

There are numerous caves in the karst areas of south China, which provided refuge for organisms in this area during the Neogene when the climate and habitat had been changing, especially after the Oligocene-Miocene boundary (Li et al. 2022). Many species have adapted to the cave environment and have undergone morphological changes, such as degeneration of eye and body coloration and elongation of the limbs. Some of them have completely adapted to the subterranean surroundings and live exclusively in the cave, becoming stygobionts/troglobionts. Cave shrimp is an interesting group among the stygofauna of this region. At present, four genera (Caridina, Mancicaris, Neocaridina and Typhlocaridina) and 27 species of Atyidae have been discovered and described from Chinese caves, distributed in Guangxi (12 species), Guizhou (8 species), Yunnan (3 species), Hunan (3 species) and Hubei (1 species) provinces (Cai and Ng 2018; Xu et al. 2020; Feng et al. 2021; Guo et al. 2022), and the number has continued to increase.

We surveyed Xiangshuiqing Cave in Shilin County, Yunnan Province twice in April and June 2023 and collected a total of 14 atyid shrimp specimens with strong cave morphological features. They were identified as a new species of Sinodina through morphological observations and molecular analysis. This species is the first stygobiont in the genus and the fourth cave atyid species in Yunnan Province, after three Caridina species, Caridinafeixiana Cai & Liang, 1999, Caridinaalu Cai & Ng, 2018 and Caridinaaff.heterodactyla Liang & Yan, 1985 (Cai and Ng 2018).

Materials and methods

Specimen collecting and preservation

Specimens were collected by cage nets from a limestone cave in Shilin, Yunnan, southern China. Live animals were observed and photographed with a Sony A7R4A camera with a Sony FE 90 mm macro lens. Most of the specimens were preserved in 75% ethanol for morphological studies, and the remainder were preserved in absolute ethanol and stored at –40 °C for molecular research. All specimens are deposited at the Institute of Biology, Guizhou Academy of Sciences, Guiyang, China (IBGAS).

Morphological study

Specimens were examined, photographed and measured using a Leica M205A stereomicroscope equipped with a Leica DFC450 camera and LAS X software (v. 5.1, Leica, Germany). All images were edited with PHOTOSHOP CC 2019 software (v. 20.0.0, Adobe, USA).

The following abbreviations are used in the text: alt (altitude), cl (carapace length, measured from the postorbital margin to the posterior margin of the carapace), rl (rostral length, measured from the rostral tip to the postorbital margin) and tl (total length, measured from the rostral tip to the posterior margin of the telson). All measurements are in millimeters.

Molecular analyses

To verify the classification of the new species, a multi-genes phylogenetic analysis was conducted. Four specimens of Sinodinaashima sp. nov. were sampled. The ingroup of the matrix was composed of Sinodinagregoriana (Kemp, 1923), two cave-dweller species of Caridina, Caridinacavernicola Liang & Zhou, 1993 and CaridinasinanensisXu et al., 2020, two species of Neocaridina, Neocaridinapalmata (Shen, 1948) and Neocaridinahofendopoda (Shen, 1948), and Paracaridinaguizhouensis (Liang & Yan, 1986). Macrobrachiumnipponense (De Haan, 1849) of Palaemonidae was selected as the outgroup. Detailed geographical information and sequence metadata are listed in Table 1.

Table 1.

Details of the specimens used for the molecular analyses.

Taxon Voucher number Collection data GenBank number Reference
COI 16S 18S H3
Sinodinaashima sp. nov. GBZD-676 Xiaoliao Cave, Shilin, Yunnan, China, 4. VI. 2023, X.K. Jiang leg. OR537884 OR539523 This study
GBZD-677 OR536642 OR537885 OR539524 This study
GBZD-678 OR536643 OR537886 OR539525 This study
GBZD-679 OR536644 OR537887 OR539526 This study
Sinodinagregoriana GBZD-238 Yangwanqiao Reservoir, Weining, Guizhou, China, 17. X. 2020, X.K. Jiang & H.M. Chen leg. OR537881 OR539518 OR540202 This study
GBZD-239 OR539519 OR540203 This study
GBZD-240 OR539520 OR540204 This study
GBZD-241 OR537882 OR539521 OR540205 This study
Sinodina sp. ZMB DNA-651 Yunnan, China FN995388 von Rintelen et al. 2012
Caridinacavernicola Hechi, Guangxi. MZ753498 MZ753801 Guo et al. 2022
Caridinasinanensis Sinan, Guizhou, 25. I. 2019 MT433963 MT434874 Xu et al. 2020
Neocaridinapalmata GBZD-098 Lisong, Hezhou, Guangxi, China, 25. IV. 2021, X.K. Jiang leg. OR536639 OR539516 OR540200 This study
Neocaridinahofendopoda GBZD-141 Sijia River, Yacai, Sanjiang, Guangxi, China, 15. III. 2021, X.K. Jiang, H.M. Chen & J.C. Lv leg. OR536640 OR539517 OR540201 This study
Paracaridinaguizhouensis GBZD-562 Longquan, Maopo, Yuping, Guizhou, China, 29. IV. 2022, X.K. Jiang, H.M. Chen & L.P. Ye leg. OR536641 OR537883 OR539522 OR540206 This study
Macrobrachiumnipponense GBZD-001 Guangzhao Reservoir, Qinglong, Guizhou, China, 14. I. 2021, H.M. Chen leg. OR536638 OR537880 OR539515 OR540199 This study

Four loci, including two mitochondrial genes (cytochrome c oxidase subunit I and 16S rDNA) and two nuclear genes (18S rDNA and histone H3 gene) were used to conduct the analysis. Primer sequences are in Table 2. Except for that of Caridinacavernicola and Caridinasinanensis, all sequences of this matrix were obtained in this research.

Table 2.

Primers used for PCR and sequencing.

Genes Primer Sequence (from 5’ to 3’) Reference
COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
16S 16sA ACTTGATATATAATTAAAGGGCCG Wowor et al. 2009
16sB CTGGCGCCGGTCTGAACTCAAATC
18S 18s ai CCTGAGAAACGGCTACCACATC DeSalle et al. 1992
18s bi GAGTCTCGTTCGTTATCGGA
H3 H3 AF ATGGCTCGTACCAAGCAGAC(AGC)GC Colgan et al. 1998
H3 AR ATATCCTTRGGCATRARTGTGAC

Raw sequences were edited and assembled using SEQMAN PRO software (Lasergene v. 7.1; DNA Star, Inc., Madison, Wis., USA). Protein-coding gene sequences (COI and H3) were aligned based on amino acid translation using CLUSTALW in MEGA 7.0 (Kumar et al. 2016). The more variable sequences (16S and 18S) were aligned using the online version of MAFFT v. 7.0 (Katoh and Standley 2013) under the algorithm, Q–INS–i. All other settings were left as default. After manual trimming, the resulting sequences were concatenated using MESQUITE v. 3.6 (Maddison and Maddison 2015).

PARTITIONFINDER 2 (Lanfear et al. 2016) was used to determine the optimum partitioning scheme and the best-fitting model for each partition, using the corrected Akaike Information Criterion (AICc). We input the partition file that contained six partitions, in which the protein-coding genes (COI and H3) was divided into codon positions for each fragment.

Maximum likelihood (ML) and Bayesian inference (BI) analyses were conducted to infer the phylogeny. ML was performed in RAXML v. 8.2.0 (Stamatakis 2014) under a GTRGAMMA model, and the six partitioning schemes, using 1000 rapid bootstrap replicates and a random seed value set to 12345. BI was implemented in MRBAYES v. 3.2.5 (Ronquist et al. 2012) following the parameters obtained from PARTITIONFINDER and with two simultaneous Monte Carlo Markov (MCMC) runs for 1 million generations, and tree samples were output every 1000 generations with a burn-in of 25%. Trees were visualized and edited with FIGTREE v. 1.44 (Rambaut 2016).

In addition, the pairwise p-distances between COI and 16S genes of all specimens of Sinodinaashima sp. nov. and Sinodinagregoriana were calculated with MEGA 7.0. One 16S sequence of Sinodina sp. derived from Genbank (Table 1) was also calculated for their interspecific distances.

Results

Taxonomy

. Sinodina ashima sp. nov.

DD90F4FB-F4A0-51F4-ABCA-6C41FE1F3718

https://zoobank.org/B4D759DE-18AD-4F4E-A47D-16DE20D99B13

Figs 1 , 2 , 3 , 4 , 5

Figure 1.

Figure 1.

Live specimens of Sinodinaashima sp. nov.

Figure 2.

Figure 2.

Cephalothorax of Sinodinaashima sp. nov., lateral view, showing the variation of the rostrum A female paratype, tl 23.5 mm B holotype C male paratype, tl 27.5 mm D female paratype, tl 40 mm. Scale bars: 2.5 mm.

Figure 3.

Figure 3.

Holotype of Sinodinaashima sp. nov. A cephalothorax and cephalic appendages, lateral view B mandible C antennule D antenna E maxillula F maxilla G first maxilliped H second maxilliped. Scale bars: 2.5 mm (A); 0.25 mm (B, E); 0.75 mm (C, D); 0.5 mm (F–H).

Figure 4.

Figure 4.

Holotype of Sinodinaashima sp. nov. A third maxilliped B first pereiopod C second pereiopod D third pereiopod E fifth pereiopod F first pleopod G appendix masculina and appendix interna of second pleopod H telson. Scale bars: 0.75 mm (A, C, F); 0.5 mm (B, H); 1 mm (D, E); 0.25 mm (G).

Figure 5.

Figure 5.

Dactylus of third pereiopod A holotype B female paratype. Scale bars: 0.25 mm.

Type material.

Holotype: male (rl 5.1 mm, cl 5.8 mm, tl 26.7 mm), China, Yunnan Province, Kunming City, Shilin County, Xiangshuiqing Cave, 24°45′27.53″N, 103°19′54.88″E, alt. 1790 m, 4. VI. 2023, Jiang X.K. leg. Paratypes. 2 males (rl 5.0–5.9 mm, cl 6.0–6.6 mm, tl 27.5–29.5 mm) and 8 females (rl 4.6–6.5 mm, cl 5.4–6.6 mm, tl 23.5–28.7 mm), collected with holotype; 3 females (rl 5.7–9.0 mm, cl 6.7–8.2 mm, tl 28.9–40.0 mm), same locality, III. 2023, Zhou J.J. leg.

Diagnosis.

Body color and eyes strongly degenerated. Rostrum extremely elongated and upturned, obviously beyond end of scaphocerite, rostral formula: 7–11 + 14–15/8–14. Male propodus of third and fourth pereiopod normal without dilation. Dactylus of third pereiopod with 4–6 spinules. Telson with 6–7 pairs of dorsal spines.

Description.

Body slender (Fig. 1). Rostrum long, slightly to strongly upturned (Fig. 2), reaching obviously beyond end of scaphocerite, 0.85–1.1 times of cl, armed dorsally with 22–26 (holotype 23) teeth, including 7–11 (holotype 8) situated posterior to orbital margin, ventrally with 8–14 (holotype 11) teeth, rostral formula: 7–11 + 14–15/8–14 (Figs 13A).

Eyes small, highly reduced, without ocular peduncle, only centre of cornea slightly pigmented (Figs 13A).

Carapace smooth, glabrous, antennal spine acute, pterygostomian margin subrectangular, pterygostomian spine absent (Figs 13A).

Antennule (Fig. 3C) peduncle three-segmented, c. 0.6 times as long as carapace. Basal segment about 1.5 times as long as second and 2.0 times as long as third. All segments with submarginal setae. Stylocerite almost reaching end of basal segment. Anterolateral angle reaching one third of 2nd segment. Flagella long and simple.

Antennal (Fig. 3D) peduncle about 0.4 length of scaphocerite. Scaphocerite about 3.0 times as long as wide, outer margin straight, asetose, ending in a strong sub-apical spine, inner and anterior margins with long plumose setae.

Mandible incisor process with six irregular and blunt teeth. Molar process truncated (Fig. 3B).

Maxillula (Fig. 3E) lower lacinia broadly rounded, with several rows of plumose setae. Upper lacinia elongate, with numerous small teeth and short setae on inner margin. Palp digitiform, slightly expanded distally, with few long setae.

Maxilla (Fig. 3F) with palp slender and slightly curved. Upper endites subdivided. Scaphognathite tapering posteriorly with some long, curved setae.

First maxilliped (Fig. 3G) epipod small. Palp rounded, with several terminal plumose setae. Exopod flagellum distinct, well developed and with plumose marginal setae. Caridean lobe narrow, with dense plumose marginal setae.

Second maxilliped (Fig. 3H) slender. Ultimate and penultimate segments of endopod fused. Inner margin of ultimate, penultimate and basal segments with long straight setae. Exopod long and slender, with several plumose setae distally. Podobranch simple.

Third maxilliped (Fig. 4A) endopod three-segmented, basal segment about 7 times as long as broad, second segment about 10 times as long as broad and 0.95 times as long as basal segment, distal segment as long as second segment, ending in small claw-like apical spine surrounded by simple setae, preceded by 7 spines along distal third of posterior margin, a clump of long and simple setae proximally. Exopod reaching beyond end of basal segment of endopod, with long plumose setae distally.

First pereiopod (Fig. 4B) stout, chela about 1.8 times as long as wide, 0.9 times length of carpus, movable finger about 2.8 times as long as wide, and 1.2 times length of palm, fingertips rounded, with numerous long setae. Carpus excavated anterodorsally, 2.3 times as long as wide and as long as merus. Merus slightly narrower than carpus. Ischium about 0.5 length of merus and about 2 times as long as basis.

Second pereiopod (Fig. 4C) slender and longer than first pereiopod. Chela 2.2 times as long as wide, 0.72 times length of carpus. Movable finger 3.5 times as long as wide and 1.5 times as long as palm, setal brushes well developed. Carpus 5.2 times as long as wide, distal part normal, about 0.7 times length of merus.

Third pereiopod (Fig. 4D) slender. Dactylus 2.8 times as long as wide (Fig. 5A) (female 2.4, Fig. 5B), ending in prominent claw-like spine surrounded by simple setae and 4–6 spines. Propodus 5.5 times as long as dactylus, bearing about 20 thin spinules evenly and loosely distributed on ventral margin, 13.5 times as long as wide. Carpus 0.71 times length of propodus. Merus 1.8 times length of carpus, with about 3–4 strong spines on the posterior margin. Ischium with a spine on the posterior margin.

Fifth pereiopod (Fig. 4E) dactylus 3.6 times as long as wide, ending in prominent claw-like spine surrounded by simple setae, inner margin with about 30 and comb-like spines. Propodus 5.7 times length of dactylus, bearing about 15 spinules in two rows on ventral margin, 19.4 times as long as wide. Carpus 0.51 times length of propodus. Merus 1.5 times length of carpus, with about 3 strong spines on the posterior margin. Ischium about 0.3 times length of merus and 2.1 times length of basis.

First pleopod (Fig. 4F) endopod tongue-like, about 2.0 times as long as wide, 0.4 times length of exopod, both inner and outer margin with spine setae, appendix interna well developed, arising from distal 1/5 of endopod, overreaching end of endopod, with cincinuli distally. Exopod 5.3 times as long as wide.

Second pleopod endopod slender. Appendix masculina (Fig. 4G) strong, about 3/5 length of endopod, bearing about 25 long, spine-like setae distally as well as on distal part of inner margin. Appendix interna of endopod reaching 1/2 of appendix masculina, with cincinuli distally (Fig. 4G).

Telson (Fig. 4H) about 0.5 times the postorbital carapace length and as long as sixth abdominal somite, tapering posteriorly and ending in a small median projection, dorsal surface with about 6–7 pairs of submarginal spines. Posterior margin with a pair of outermost spines and 5 pairs of intermediate spines that are slightly shorter than the lateral pair. Exopod of uropod longer and wider than endopod, both with plumose marginal setae. Diaeresis bearing 8–11 (holotype 11) spines.

Eggs 0.85–0.91 × 1.20–1.27 in diameter.

Color strongly degenerated, translucent to flavescent (Fig. 1).

Etymology.

The specific name is in honor of Ashima, who is a famous female character of the local legend spreading among the Yi nationality and is a symbol of love and bravery.

Distribution.

Yunnan Province (Xiangshuiqing Cave), China.

Habitat.

Subterranean river in a karst cave.

Molecular analyses results

The phylogenetic matrix included 14 terminals with 2262 nucleotides (COI: 647 bp; 16S: 453 bp; 18S: 867 bp; H3: 295 bp). The best-fitting evolutionary model for the first codon of COI, 18S and the first and second codons of H3 was TRNEF+I+G. The best model for the second codon of COI was HKY+G. TRNEF+I was the optimal model for the third codon of COI. HKY+I+G and TVM+G suited the 16S and the third codon of H3 respectively.

The only difference between the topologies derived from the ML and BI analyses was the position of Paracaridinaguizhouensis. It was either sister to Sinodina spp. (ML) (Fig. 6) or clustered with the clade of Sinodina spp. and Neocaridina spp. (BI). Two pairs of sister species received strong support. One clade showed that the new species, Sinodinaashima sp. nov., was clustered with Sinodinagregoriana (bootstrap value and posterior probability = 95% and 0.91). Another branch contained the two Neocaridina spp. (bootstrap value and posterior probability = 99% and 1).

Figure 6.

Figure 6.

ML tree based on the concatenated dataset (COI + 16S + 18S + H3). Numbers at nodes are maximum likelihood percent bootstrap values (left) and Bayesian posterior probabilities (right).

The COI sequences were successfully obtained from three specimens of Sinodinaashima sp. nov., but failed in all specimens of Sinodinagregoriana. The intraspecific p-distances of COI of the new species were 0% and 1.85%. Nevertheless, the 16S sequences of all specimens of Sinodina spp., but two ones of Sinodinagregoriana, have been obtained. No intraspecific variation in 16S of Sinodinaashima sp. nov. was detected, and the intraspecific p-distance of Sinodinagregoriana was 0.45%. The interspecific p-distances between Sinodinaashima sp. nov. and Sinodinagregoriana were 4.55% and 4.32%, between Sinodinaashima sp. nov. and Sinodina sp. were 2.05% and 2.27%, and between Sinodinagregoriana and Sinodina sp. was 4.09%.

Discussion

Some morphological characteristics of Sinodina seem to be plesiomorphic. Its simple lamellar podobranch is the same as that of Caridina during the metamorphosis from the zoea to the first post-larval stage, without further development (Liang 2004). The distention and spininess on the distal ventral margin of the propodus of the male third and fourth pereiopod also appear in the basal genus Paratya whose pereiopods still possess exopods (Liang and Cai 1999; Liang 2004). Therefore, Sinodina is considered to be a relatively basal genus. In a previous phylogeny, Sinodina was detected as a sister group to all sampled taxa from China and Japan by three genes, including 16S, 18S and H3 (von Rintelen et al. 2012). However, our preliminary molecular analysis with low support values for the higher-level phylogenetic relationships does not reflect this relationship. To better clarify the taxonomic status and phylogenetic position of this genus, future studies should include more taxa and additional molecular data.

The new species with the simple and lamellar podobranch and its distribution is certainly a member of the genus Sinodina. This result is also supported by the phylogenetic analysis, in which Sinodinaashima sp. nov. is firmly clustered with the type species Sinodinagregoriana. As the first cave-dweller described in the genus, it can be easily distinguished from other species by its degraded body color and eyes. Besides, Sinodinaashima sp. nov. is similar to S.heterodactyla (Liang & Yan, 1985) and S.banna (Cai & Dai, 1999). They all show nearly no sexual dimorphism on the third and fourth pereiopod. The new species differs from the two species not only in the stygomorphic traits, but also in the extremely elongated and upturned rostrum, obviously beyond the end of scaphocerite (vs. S.heterodactyla reaching the end of scaphocerite and S.banna only reaching the end of the first segment of the antennular peduncle); the rostrum with 8–14 teeth ventrally (vs. 5–9 in S.heterodactyla and no ventral tooth in S.banna); the dactylus of male third pereiopod with 4–6 spines (vs. 7 in S.heterodactyla and 8–10 in S.banna); the body length 23–40 mm (vs. 23–32 mm in S.heterodactyla and 14–17 mm in S.banna).

Cave organisms in the karst region of south China have a long evolutionary history and high diversity (Li et al. 2022). In the past two decades, the knowledge of the subterranean fauna of China has rapidly increased, making this region a newly emerged world-class diversity hotspot (Deharveng and Bedos 2018). Our research adds a new generic-level taxon to the stygofauna of China. The first subterranean shrimp species from China was described in 1981, Typhlocaridinalanceifrons Liang & Yan, 1981, and 13 species have been published in the last century. Entering the 21st century, there has been a significant increase in the rate of the discovery of subterranean atyids, with 15 species reported, 11 of which have been published in the last five years. It is believed that as the investigation goes further, more new species and new high-level taxa will be discovered.

Supplementary Material

XML Treatment for Sinodina ashima

Acknowledgements

We thank Mr Lei Chunyun (Yunnan Academy of Fishery Science, China) and Dr Liu Yewei (Guangxi University, China) for assistance during fieldwork. The comments by Dr Valentin de Mazancourt and Dr Luis Ernesto Bezerra helped to improve this paper.

Citation

Jiang X, Zhou J, Wang J, Chen W, Chen H (2023) Description of the first stygobiotic species of the atyid shrimp genus Sinodina (Decapoda, Caridea, Atyidae) from Yunnan Province, China. ZooKeys 1186: 123–137. https://doi.org/10.3897/zookeys.1186.112657

Funding Statement

This research is supported by grants from the National Science and Technology Basic Research Program of China (2019FY101900), the National Natural Science Foundation of China (32100365), the Talents Platform Construction Program of Guizhou Province (2017571903) and the Doctoral Foundation of Guizhou Academy of Sciences (R[2021]1).

Contributor Information

Wenlong Chen, Email: 48708209@qq.com.

Huiming Chen, Email: mei0601@126.com.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This research is supported by grants from the National Science and Technology Basic Research Program of China (2019FY101900), the National Natural Science Foundation of China (32100365), the Talents Platform Construction Program of Guizhou Province (2017571903), the Doctoral Foundation of Guizhou Academy of Sciences (R[2021]1) and the Forestry Reform and Development Fund of Guizhou Province (2021-01).

Author contributions

Formal analysis: XJ. Investigation: JZ, XJ. Methodology: HC. Resources: WC. Writing - original draft: XJ. Writing - review and editing: JW, JZ, WC, HC.

Author ORCIDs

Xuankong Jiang https://orcid.org/0000-0003-3506-5894

Jiajun Zhou https://orcid.org/0000-0003-1038-1540

Jianguo Wang https://orcid.org/0009-0000-4675-4615

Wenlong Chen https://orcid.org/0009-0002-1170-3847

Huiming Chen https://orcid.org/0000-0002-2449-3036

Data availability

All of the data that support the findings of this study are available in the main text.

References

  1. Cai YX, Dai AY. (1999) Freshwater shrimps (Crustacea: Decapoda: Caridea) from the Xishuangbanna region of Yunnan Province, southern China. Hydrobiologia 400: 211–241. 10.1023/A:1003717109973 [DOI] [Google Scholar]
  2. Cai YX, Liang XQ. (1999) Descriptions of three new species of freshwater shrimps (Crustacea: Decapoda: Atyidae) from Yunnan, Southern China. The Raffles Bulletin of Zoology 47(1): 73–80. [Google Scholar]
  3. Cai YX, Ng PKL. (2018) Freshwater shrimps from karst caves of southern China, with descriptions of seven new species and the identity of Typhlocaridinalinyunensis Li and Luo, 2001 (Crustacea: Decapoda: Caridea). Zoological Studies (Taipei, Taiwan) 57(27): 1–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen GX, Liang XQ. (2002) A new species of Sinodina from Yunnan, China. Zoological Research 23(3): 239–241. [Google Scholar]
  5. Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR. (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46(5): 419–437. 10.1071/ZO98048 [DOI] [Google Scholar]
  6. De Grave S, Fransen CHJM. (2011) Carideorum Catalogus: The recent species of the Dendrobranchiate, Procarididean and Caridean Shrimps (Crustacea: Decapoda). Zoologische Mededelingen (Leiden) 85: 195–588. [Google Scholar]
  7. De Haan W. (1833–1850) Crustacea. In: von Siebold PF (Ed. ) Fauna Japonica sive descriptio animalium, quae in itenere per Japoniam, jussu et auspiciis superiorum, qui summum in India Batava imperium tenent, suscepto, annis 1823–1830 collegit, notis, observationibus et admumbrationibus illustravit. Lugduni-Batavorum, 243 pp. [I–xxxi, plates A–J, L–Q, 1–55] [Google Scholar]
  8. Deharveng L, Bedos A. (2018) Diversity of terrestrial invertebrates in subterranean habitats. In: Moldovan OT, Kováč L, Halse S. (Eds) Cave Ecology.Springer Press, Cham, 107–172. 10.1007/978-3-319-98852-8_7 [DOI]
  9. DeSalle R, Gatesy J, Wheeler W, Grimaldi D. (1992) DNA sequences from a fossil termite in Oligo-Miocene amber and their phylogenetic implications. Science 257(5078): 1933–1936. 10.1126/science.1411508 [DOI] [PubMed] [Google Scholar]
  10. Feng S, Chen QH, Guo ZL. (2021) Integrative taxonomy uncovers a new stygobiotic Caridina species (Decapoda, Caridea, Atyidae) from Guizhou Province, China. ZooKeys 1028: 29–47. 10.3897/zookeys.1028.63822 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit i from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3(5): 294–299. [PubMed] [Google Scholar]
  12. Guo GC, Chen QH, Chen WJ, Cai CH, Guo ZL. (2022) Caridinastellata, a new species of atyid shrimp (Decapoda, Caridea, Atyidae) with the male description of Caridinacavernicola Liang & Zhou, 1993 from Guangxi, China. ZooKeys 1104: 177–201. 10.3897/zookeys.1104.81836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kemp S. (1923) Zoological results of the Percy Sladen Trust Expedition to Yunnan under the leadership of Professor J. W. Gregory, F.R.S. (1922) 40 Decapod Crustacea. Journal and proceedings of the Asiatic Society of Bengal 19(9): 437–441 [figs. 1–2].
  15. Kumar S, Stecher G, Tamura K. (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. (2016) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34(3): 772–773. 10.1093/molbev/msw260 [DOI] [PubMed] [Google Scholar]
  17. Li XQ, Xiang XG, Jabbour F, Hagen O, Ortiz RDC, Soltis PS, Soltis DE, Wang W. (2022) Biotic colonization of subtropical East Asian caves through time. Proceedings of the National Academy of Sciences of the United States of America 119(34): e2207199119. 10.1073/pnas.2207199119 [DOI] [PMC free article] [PubMed]
  18. Liang XQ. (1989) A new species of Caridina from Lugu Lake, China. Acta Zootaxonomica Sinica 14(3): 282–284. [Google Scholar]
  19. Liang XQ. (1990) On Caridinagregoriana Kemp and allied species. Oceanologia et Limnologia Sinica 21(3): 218–224. [Google Scholar]
  20. Liang XQ. (2002) On three new species of Atyid shrimps (Decapoda, Caridea) from China. Studia Marina Sinica 44: 118–123. [Google Scholar]
  21. Liang XQ. (2004) Fauna Sinica. Invertebrata: Crustacea: Decapoda: Atyidae. Science Press, Beijing, 375 pp. [In Chinese with English abstract] [Google Scholar]
  22. Liang XQ, Cai YX. (1999) Sinodina, a new genus of freshwater shrimps (Crustacea: Decapoda: Atyidae) from southern China, with descriptions of three new species. The Raffles Bulletin of Zoology 47: 577–590. [Google Scholar]
  23. Liang XQ, Yan SL. (1981) A new genus and two new species of freshwater prawns (CrustaceaDecapoda) from Guangxi, China. Acta Zootaxonomica Sinica 6(1): 31–35. [In Chinese with English abstract] [Google Scholar]
  24. Liang XQ, Yan SL. (1985) Study on Caridina (Decapoda, Caridea) from Yunnan, China. Oceanologia et Limnologia Sinica 16(2): 164–174. [Google Scholar]
  25. Liang XQ, Yan SL. (1986) Study on Caridina (Decapod, Caridea) from Guizhou province, China. Oceanologia et Limnologia Sinica (Suppl.), 179–206.
  26. Liang XQ, Zhou J. (1993) Study on new atyid shrimps (Decapoda, Caridea) from Guangxi, China. Acta Hydrobiologica Sinica 17(3): 231–239. [In Chinese with English abstract] [Google Scholar]
  27. Maddison WP, Maddison DR. (2015) Mesquite: a modular system for evolutionary analysis. Version 3.04. http://mesquiteproject.org
  28. Rambaut A. (2016) Figtree. Version 1.4.3. http://tree.bio.ed.ac.uk/software/figtree/
  29. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard A, Huelsenbeck JP. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shen CJ. (1948) On three new species of Caridina (Crustacea Macrura) from south-west China. Contributions from the Institute of Zoology. National Academy of Peiping 4(3): 119–123. [Google Scholar]
  31. Stamatakis A. (2014) RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics (Oxford, England) 30(9): 1312–1313. 10.1093/bioinformatics/btu033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. von Rintelen K, Page TJ, Cai Y, Roe K, Stelbrink B, Kuhajda BR, Iliffe TM, Hughes J, von Rintelen T. (2012) Drawn to the dark side: A molecular phylogeny of freshwater shrimps (Crustacea: Decapoda: Caridea: Atyidae) reveals frequent cave invasions and challenges current taxonomic hypotheses. Molecular Phylogenetics and Evolution 63(1): 82–96. 10.1016/j.ympev.2011.12.015 [DOI] [PubMed] [Google Scholar]
  33. Wowor D, Muthu V, Meier R, Balke M, Cai Y, Ng PKL. (2009) Evolution of life history traits in Asian freshwater prawns of the genus Macrobrachium (Crustacea: Decapoda: Palaemonidae) based on multilocus molecular phylogenetic analysis. Molecular Phylogenetics and Evolution 52(2): 340–350. 10.1016/j.ympev.2009.01.002 [DOI] [PubMed] [Google Scholar]
  34. Xu DJ, Li DX, Zheng XZ, Guo ZL. (2020) Caridinasinanensis, a new species of stygobiotic atyid shrimp (Decapoda, Caridea, Atyidae) from a karst cave in the Guizhou Province, southwestern China. ZooKeys 1008: 17–35. 10.3897/zookeys.1008.54190 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Sinodina ashima

Data Availability Statement

All of the data that support the findings of this study are available in the main text.


Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES