In vitro immune-enhancing effects of Platycodon grandiflorum combined with Salvia plebeian via MAPK and NF-κB signaling in RAW264.7 cells

A-yeong Jang; Minji Kim; Weerawan Rod-in; Yu Suk Nam; Tae Young Yoo; Woo Jung Park

doi:10.1371/journal.pone.0297512

. 2024 Feb 2;19(2):e0297512. doi: 10.1371/journal.pone.0297512

In vitro immune-enhancing effects of Platycodon grandiflorum combined with Salvia plebeian via MAPK and NF-κB signaling in RAW264.7 cells

A-yeong Jang ^1,^2,^#, Minji Kim ^1,^3,^#, Weerawan Rod-in ^1,^4,^#, Yu Suk Nam ⁵, Tae Young Yoo ⁶, Woo Jung Park ^1,^2,^*

Editor: Babatunde Olanrewaju Motayo⁷

PMCID: PMC10836713 PMID: 38306362

Abstract

The immune-enhancing activity of the combination of Platycodon grandiflorum and Salvia plebeian extracts (PGSP) was evaluated through macrophage activation using RAW264.7 cells. PGSP (250–1000 μg/mL) showed a higher release of NO in a dose-dependent manner. The results showed that PGSP could significantly stimulate the production of PGE₂, COX-2, TNF-α, IL-1β, and IL-6 in RAW264.7 cells and promote iNOS, COX-2, TNF-α, IL-1β, IL-4, and IL-6 mRNA expression. Western blot analysis demonstrated that the protein expression of iNOS and COX-2 and the phosphorylation of ERK, JNK, p38, and NF-κB p65 were greatly increased in PGSP-treated cells. PGSP also promoted the phagocytic activity of RAW264.7 cells. All these results indicated that PGSP might activate macrophages through MAPK and NF-κB signaling pathways. Taken together, PGSP may be considered to have immune-enhancing activity and might be used as a potential immune-enhancing agent.

Introduction

Immunostimulatory agents are used to enhance non-specific immune responses and regulate immunity to protect the body [1]. Numerous natural compounds have been shown to possess immunostimulant properties [1–3]. Several immunomodulators released by macrophages include nitric oxide (NO), prostaglandin E2 (PGE₂), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), IL-4, IL-6, IL-10, IL-12, monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor-α (TNF-α), which enhance immune responses [1, 3–6]. Furthermore, the activation of macrophages for the production of immunomodulators was also reported to be mainly promoted by nuclear factor-қB (NF-қB) and mitogen-activated protein kinase (MAPK) signals [1–3, 5].

The balloon flower, Platycodon grandiflorum (Jacq.) A. DC., belonging to the Campanulaceae family, is found in China, Korea, Japan, Russia, and Siberia [7]. It has been recognized as a functional source and traditional oriental medicine [8, 9]. According to reports on phytochemical studies, P. grandiflorum contains triterpenoid saponins (platycodin D, platycoside E, platyconic acid A, and deapioplatycoside E), phenolic acids, minerals, volatile oils, polyacetylene, flavonoids, and polysaccharides that are health-promoting [7]. Pharmacological studies showed that P. grandiflorum had anti-hypercholesterolemic [10], anti-cancer [9, 11], anti-proliferative [12], anti-obesity [10], anti-atherosclerotic [13], antioxidant [8, 9, 14], immunomodulatory [15], anti-inflammatory [14, 16], immuno-enhancing [17, 18], and anti-microbial [19] properties in in vitro and in vivo models. Polysaccharides from P. grandiflorum and fermented P. grandiflorum extract, which was made with Saccharomyces cerevisiae, showed immunomodulatory effects in immune cells [15, 18]. Recently, a mixed extract of P. grandiflorum, Apium graveolens, and Camellia sinensis exhibited anti‑obesity effects in an in vivo system [20]. Kang et al. [21] reported that a mixture of Astragalus membranaceus, Schisandra chinensis, and P. grandiflorum inhibited NO production by RAW264.7 cells.

Salvia plebeia R. Brown. belonging to the Lamiaceae family, is used as a medicinal plant in China, Korea, Japan, Afghanistan, India, Iran, and Australia [22, 23]. In Korea, S. plebeian has been used to treat the common cold, flu, and cough [22, 24]. S. plebeia contains chemical compounds that include flavonoids, lignans, phenolic compounds, terpenoids, sesquiterpenoids, diterpenoids, monoterpenoids, triterpenes, and volatile oils [22, 25–27], which showed biological activity, such as anti-tumor, antioxidant, hepatoprotective, antimicrobial, antiviral, and anti-inflammatory effects [24, 27–29]. S. plebeian can also stimulate the immune system by increasing phagocytic activity and NO, TNF-α, and IL-1β production in RAW264.7 cells, as well as promoting natural killer (NK) cell activity and IL-12 production in splenocytes [30]. In addition, a mixture of S. plebeia and Korean red ginseng exhibited anti-asthmatic and synergistic anti-inflammatory effects in airways [31–33].

Although individual immunostimulatory effects have been demonstrated, the mixture of P. grandiflorum and S. plebeia has not been previously studied, and the effects of the combination of these plants remain unclear. A number of studies demonstrated that the combination of plant materials enhanced immunity both in vivo and in vitro, showing a more powerful bioactive effect than single plant species alone [16, 34–37]. Therefore, the objective of this study was to determine if the effects on immune function are enhanced by treating murine macrophages with a mixture of P. grandiflorum and S. plebeian (PGSP).

Materials and methods

Preparation of PGSP

A mixture of PGSP was supplied after manufacturing by FD FARM Co.,Ltd. (Incheon, Korea). Briefly, dried P. grandiflorum and S. plebeian at a ratio of 1:1 (v/v) were mixed and extracted by adding distilled water at 100°C ± 5 for 6–8 h. The water extract was concentrated using a vacuum concentrator until the solid content reached a brix of 50 ± 5.0 to obtain PGSP extract. PGSP was stored at -4°C and used in this study. The ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) to identify and quantify platycodin D and platycoside E in PSGP were presented in Supplemental Material. The UPLC-MS/MS analysis indicated that the PGSP contained 4 saponins, including platycoside D1 (1.11 ± 0.02 mg/g), platycoside D2 (1.73 ± 0.04 mg/g), platycoside E1 (2.40 ± 0.09 mg/g), and platycoside E2 (1.04 ± 0.09 mg/g).

Cell culture and treatment

Mouse macrophage cell lines were obtained from the Korean Cell Line Bank (Korean Cell Line Research Foundation, Seoul, Korea) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Welgene, Korea) and 1% penicillin/streptomycin (P/S, Welgene, Korea) in humidified incubators containing 5% CO₂. Various concentrations of PGSP were diluted in RPMI-1640 medium without phenol red, supplemented with 1% FBS and 1% P/S. Concentrations of 250, 500, 750, and 1000 μg/mL of PGSP were added to the cells for 24 h. Lipopolysaccharide (LPS, 1 μg/mL) was used as the positive control. After incubation, the immunological effects were assessed in subsequent experiments.

Cell viability analysis

The EZ-Cytox Cell Viability Assay Kit (Daeil Labservice, Seoul, Korea) was used to determine cell viability. RAW264.7 cells (1 × 10⁶ cells/mL) were cultured with samples (250–1000 μg/mL) and incubated for 24 h. The supernatants were removed, and 100 μL of a water-soluble tetrazolium salt (WST) solution was added to each well. The PGSP-treated cells were incubated at 37°C for 1 h. The absorbance was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA).

Determination of NO production

Griess reagent (Sigma-Aldrich, St. Louis, MO, USA) was used for the detection of NO production in macrophages. The cells (1 × 10⁶ cells/mL) were treated with PGSP for 24 h before the culture supernatants (100 μL) was transferred into each well of a 96-well plate. An equal volume (100 μL) of Griess reagent (0.1% N-1-napthylethylenediamine dihydrochloride in distilled water and 1% sulfanilamide in 5% phosphoric acid) was added to and incubated for 10 min at room temperature. Finally, the absorbance at 540 nm was measured using a microplate reader.

Determination of PGE₂, COX-2, IL-1β, IL-6, and TNF-α production

Cells (1 × 10⁶ cells/mL) were treated with PGSP and subsequently cultured for 24 h. After treatment, the supernatants were collected and stored at -20°C until analysis. PGE₂ levels were measured using a PGE₂ ELISA kit (Enzo Life Sciences, Farmingdale, NY, USA), and IL-1β, IL-6, TNF-α, and COX-2 concentrations were determined using ELISA kits specific for each cytokine (Abcam, Cambridge, UK), according to the manufacturer’s instructions. The PGE₂, COX-2, IL-1β, IL-6, and TNF-α production were analyzed with each standard curve.

Real-time qPCR analysis

Tri reagent^® (Molecular Research Center, Inc., Cincinnati, OH, USA) was used to extract total RNA from LPS- and PGSP-treated and untreated RAW264.7 cells at a density of 1 × 10⁶ cells/mL, according to the manufacturer’s protocol. cDNA was synthesized using 1000 ng of RNA in the following steps: 25°C for 10 min, 37°C for 120 min, and 85°C for 5 min, using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). To quantify the mRNA levels of gene expression, real-time qPCR analysis was performed using TB Green^® Premix Ex Taq™ II (Takara Bio Inc., Shiga, Japan) that mixed a final concentration of 0.4 μM of a specific primer pairs, 1 × ROX Reference Dye, and 5 ng of cDNA templates, and then carried out on a QuantStudio™ 3 FlexReal-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The reaction steps were as follows: 95°C for 30 s, 40 cycles of 95°C for 5 s, and 60°C for 34 s. Then, 95°C for 30 s, 60°C for 1 min, and 95°C for 15 s were added at the end of the cycles. All reactions was carried out in triplicate. The relative expression of the target genes was calculated and normalized to that of β-actin as an internal control. A list sequences of mouse primers are provided in Table 1.

Table 1. Primer sequences used in real-time qPCR.

Target genes	Accession numbers	Primer sequence (5΄ to 3΄)
Target genes	Accession numbers	Sense	Antisense
IL-1β	NM_008361.4	`GGGCCTCAAAGGAAAGAATC`	`TACCAGTTGGGGAACTCTGC`
IL-4	NM_021283.2	`ACAGGAGAAGGGACGCCAT`	`GAAGCCCTACAGACGAGCTCA`
IL-6	NM_031168.2	`AGTTGCCTTCTTGGGACTGA`	`CAGAATTGCCATTGCACAAC`
TNF-α	D84199.2	`ATGAGCACAGAAAGCATGATC`	`TACAGGCTTGTCACTCGAATT`
iNOS	BC062378.1	`TTCCAGAATCCCTGGACAAG`	`TGGTCAAACTCTTGGGGTTC`
COX-2	NM_011198.4	`AGAAGGAAATGGCTGCAGAA`	`GCTCGGCTTCCAGTATTGAG`
β-actin	NM_007393.5	`CCACAGCTGAGAGGGAAATC`	`AAGGAAGGCTGGAAAAGAGC`

Open in a new tab

Assay of macrophage phagocytosis

The PGSP-treated cells at a density of 2 × 10⁶ cells/mL were harvested and washed with ice-cold phosphate-buffered saline (PBS). After that, a solution of FITC-dextran (Sigma-Aldrich, USA) was added to PGSP-treated cells for 1 h at 37°C. The reaction was stopped by adding 1 mL of ice-cold PBS, and the cells were washed three times with 1% paraformaldehyde. Phagocytic uptake was analyzed using the CytoFLEX Flow Cytometer (Beckman Coulter, Inc., USA).

Analysis of western blotting

The PGSP-treated cells (2 × 10⁶ cells/mL) were extracted in 120 μL of lysis buffer containing radioimmunoprecipitation assay (RIPA) buffer, 0.5 mM ethylenediaminetetraacetic acid (EDTA), and an inhibitor cocktail (protease and phosphatase). The cell lysates were incubated at 4°C for 30 min and then centrifuged at 13,000 rpm for 20 min. The protein concentration in the supernatant was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, USA) and estimated using the standard curve, as directed by the manufacturer. Subsequently, equal volumes of proteins were resolved on sodium dodecyl sulfate-polyacrylamide gels and then transferred to polyvinylidene membranes. The membranes were blocked for 1 h in 5% skim milk in 1 × Tris-buffered saline containing 1% Tween-20 (1 × TBST). After incubation, the membranes were washed with 1 × TBST and incubated overnight with the primary antibody (1:2000). Then, the membranes were washed and incubated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit IgG (H+L) (1:2000). The protein bands were detected by Pierce^® ECL Plus Western Blotting Substrate and visualized with the ChemiDoc XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

Data analysis

The data were analyzed using SPSS version 23.0 software (SPSS, Inc., Chicago, IL, USA) and presented as the mean ± standard deviation (SD). Each value is the mean of three separate experiments (n = 3). The significance was analyzed using a one-way analysis of variance followed by Duncan’s new multiple range test. P-values of < 0.05 were considered statistically significant.

Results

Effect of PGSP on cell viability

As shown in Fig 1, the cell viability after treatment with PGSP concentrations of 250, 500, 750, and 1000μg/mL was 101.12 ± 1.35%, 98.07 ± 0.59%, 98.48 ± 0.71%, and 100.59 ± 0.77%, respectively, but statistically different from the RPMI controls (p < 0.05). Neither PGSP nor LPS were cytotoxic to RAW264.7 cells within the tested concentration range, suggesting that these doses of PGSP could be used in further experiments without causing cytotoxicity.

Effects of PGSP on the NO production

After 24 h of incubation with PGSP, the production of NO in RAW264.7 macrophages was measured. As shown in Fig 2A, PGSP showed a significant stimulatory effect on NO production in a dose-dependent manner, which was 81.19 ± 1.30% at the highest concentration (1000 μg/mL). The amount of NO produced by PGSP was comparable to that of the positive control, LPS (1 μg/mL), indicating that it exerted strong stimulant activity.

Effects of PGSP on the production of PGE₂, COX-2, IL-1β, IL-6, and TNF-α

Cells treated with PGSP (250–1000 μg/mL) or LPS (1 μg/mL) secreted more PGE₂, COX-2, IL-1β, IL-6, and TNF-α than cells treated with RPMI (Fig 2B–2F). The amounts of cytokines secreted from PGSP-treated cells were lower than those from LPS-treated cells (the positive control). The production of PGE₂, COX-2, IL-1β, IL-6, and TNF-α was also increased by 88.05 ± 0.64%, 73.17 ± 4.06%, 77.30 ± 0.79%, 100.65 ± 0.52%, and 89.51 ± 1.50%, respectively, at 1000 μg/mL of PGSP.

Effects of PGSP on the cytokine expression

Real-time qPCR analysis showed that PGSP increased the mRNA levels of IL-1β, IL-4, IL-6, and TNF-α in RAW264.7 macrophages (Fig 3). Furthermore, the immune-stimulatory mRNA levels of cytokines, such as IL-1β, IL-4, IL-6, and TNF-α, were higher in macrophage cells treated with PGSP compared to RPMI-treated cells.

Effect of PGSP on iNOS and COX-2 mRNA and protein expression

Real-time qPCR and western blot analyses were performed on RAW264.7 macrophages to examine whether the induction of immunomodulators like NO and PGE₂ occurred due to mRNA and protein expression of iNOS and COX-2. As shown in Fig 4A and 4B, the mRNA expression levels of iNOS and COX-2 were significantly enhanced in a concentration-dependent manner after treatment of the cells with PGSP for 24 h. PGSP concentration-dependently induced the expression of iNOS and COX-2 protein (Fig 4C). Additionally, PGSP induced iNOS and COX-2 expression at a lower level than that in LPS-treated cells but stronger than that in RPMI-treated cells. Therefore, PGSP may regulate pro-inflammatory mediators, such as iNOS and COX-2.

Fig 4 — The mRNA expression of *iNOS* (A) and *COX-2* (B) was determined by real-time qPCR. (C) The protein expression of iNOS and COX-2 was determined by western blotting. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.

Effects of PGSP on phagocytic activity

A fluorescein isothiocyanate (FITC)–dextran uptake assay was performed to measure the effects of PGSP or LPS on macrophage phagocytosis. As shown in Fig 5, the results revealed that LPS could increase macrophage phagocytic activity by 68.77 ± 0.07%, which was displayed by higher FITC-fluorescence intensity than the untreated control group. Flow cytometry revealed that the percentage of phagocytosis increased to 41.02 ± 2.27%, 54.69 ± 2.70%, 62.72 ± 2.90%, and 69.22 ± 1.59% in cells treated with 250, 500, 750, and 1000 μg/mL, respectively.

Fig 5 — The cellular uptake of FITC-dextran was determined by flow cytometry. (A) Flow data for the uptake by FITC-dextran of macrophages from one of three independent experiments. (B) The proportion of phagocytic macrophage activity. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.

Effects of PGSP on NF-κB and MAPK activation

To investigate the molecular mechanisms underlying the immune-enhancing effects of PGSP, the phosphorylation of NF-κB subunit p65, JNK, ERK, and p-38 MAPK was evaluated in RAW264.7 cells by western blotting, and the results are shown in Fig 6. A dose-dependent increase in NF-κB and MAPK activation was observed by treatment with PGSP compared to RPMI. PGSP induced NF-κB-p65, ERK1/2, p38, and JNK phosphorylation, indicating NF-κB and MAPK activation. LPS also strongly increased NF-κB and MAPK expression levels (Fig 6).

Fig 6 — Phosphorylation levels of ERK, JNK, and p38 MAPKs were determined by western blotting. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.

Discussion

Previous pharmacological studies on P. grandiflorum mainly examined its immune-enhancing effects in vitro and in vivo [15, 18]. P. grandiflorum extracts primarily contained platycodin D and exhibited immuno-enhancing effects both in vitro and in vivo [16, 17, 38]. Treatment of RAW264.7 cells with the combination of fermented P. grandiflorum and soybean extract or vitamin C showed immune responses greater than treatment with fermented P. grandiflorum alone [16]. S. plebeian extracts were also used in these studies to modulate immunity in the forced swimming exercise-induced model [30]. S. plebeian extracts contained higher quantities of flavonoids, such as luteolin, luteoloside, nepetin, nepitrin, hispidulin, homoplantagenin, and eupatorine [39], which have anti-inflammatory effects. These flavonoid compounds displayed immunomodulatory effects in various cells [40]. However, the action of P. grandiflorum mixed with S. plebeian has not been reported. In this study, we investigated the immunostimulatory effects of a mixture of P. grandiflorum and S. plebeia (PGSP) in a macrophage cell line and the mechanism through which PGSP enhanced inflammatory responses.

Macrophages are known to be involved in multiple biological functions, such as inflammation control and immune enhancement, by releasing pro-inflammatory cytokines and inflammatory factors [41, 42]. The phagocytic activity of macrophages is a key indicator of macrophage activation in non-specific immune responses [43]. The results of this study indicated that PGSP significantly improved macrophage phagocytosis, consistent with previously reported results [43–46]. The results showed that PGSP activated macrophages to improve immunity.

The signal transduction molecules NO and PGE₂ play important roles in inflammation. Fermented P. grandiflorum extract enhanced NO production at the highest concentration (500 μg/mL), but the effect was only slightly statistically significant compared to the control group [15]. In this study, PGSP significantly stimulated NO production at a dose range of 250–1000 μg/mL. Similarly, mixtures of Sasa quelpaertensis Nakai and Ficus erecta var. sieboldin effectively stimulated NO production by RAW264.7 cells in a dose range of 10–1000 μg/mL [37]. The inflammatory response involves the enzymes iNOS and COX-2, which regulate the production of NO and PGE₂. The results of this study showed that PGSP increased NO and PGE₂ secretion and upregulated iNOS and COX-2 expression. PGSP also enhanced immunity by upregulating iNOS and COX-2 protein expression in macrophage cells. Ko et al. (2012) [1] investigated the immunomodulatory effects of Abelmoschus esculentus extracts on RAW2647 cells by regulating the production of TNF-α, IL-1β, IL-6, NO, and PGE₂, as well as the expression of iNOS and COX-2 [1]. The combination of Panax ginseng and Scrophularia buergeriana increased phagocytosis, cytokine, and NO production and enhanced iNOS expression via NF-κB activation in RAW264.7 cells and immune responses in splenocytes [46].

Cytokines are important mediators involved in modulating immune and inflammatory responses [42]. A variety of cytokines, including TNF-α, IL-1β, and IL-6, are potent immunomodulators in activated macrophages [47, 48]. According to our findings, PGSP increased serum IL-1β, IL-6, and TNF-α levels. PGSP also increased the mRNA expression levels of cytokines, such as IL-1β, IL-4, IL-6, and TNF-α, in RAW264.7 macrophages. Many studies showed that plant extracts enhanced immunity by upregulating enzymes (iNOS and COX-2) and cytokines (TNF-α, IL-1β, IL-6, IL-10, and IL-12) in macrophages [2, 44, 47]. Thus, our results suggested that PGSP improved immune function by increasing immunostimulatory cytokines, as previous reports showed.

Macrophage activation is associated with the generation of immunomodulators through MAPK and NF-κB pathways [1, 2]. P. grandiflorum polysaccharides were shown to activate MAPK and AP-1 in macrophages [49]. Our study also demonstrated that PGSP could dose-dependently induce the activation of signaling molecules, such as NF-κB and MAPKs, in RAW264.7 cells, indicating that these molecules regulated a variety of cellular functions, including cell survival, proliferation, and apoptosis [50]. These results suggested that PGSP strongly enhanced macrophage cellular immunity by stimulating the phosphorylation of ERK, JNK, p38 MAPK, and NF-κB p65. Althaea rosea extracts were found to exhibit immunomodulatory activity by increasing NO, cytokines, and mediator secretion by activating NF-κB and MAPK proteins in macrophages [48]. Therefore, the present results suggest that PGSP enhanced immune responses by stimulating macrophages through NF-κB and MAPK signaling.

Conclusion

PGSP showed strong immunoenhancing activity in macrophages by increasing the secretion of NO, PGE₂, cytokines, mediators, and phagocytosis, as well as increasing the expression of immune-related genes and the activation of NF-κB and MAPK signaling pathways. Thus, PGSP could act as a potent immunomodulator derived from P. grandiflorum and S. plebeian and could also be developed as a functional food or supplementary diet ingredient for health.

Supporting information

S1 Fig. Original western blot gel image data.

(PDF)

Click here for additional data file.^{(4.2MB, pdf)}

S1 File. Supplementary materials and methods.

(PDF)

Click here for additional data file.^{(209.9KB, pdf)}

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was supported by a research program grant funded by NAAAMYUUU FNC Co., Ltd. and FD Farm Co., Ltd. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Ko MN, Hyun SB, Ahn KJ, Hyun C-G. Immunomodulatory effects of Abelmoschus esculentus water extract through MAPK and NF-κB signaling in RAW264.7 cells. Biotechnol Notes. 2022; 3:38–44. 10.1016/j.biotno.2022.05.002. [DOI] [Google Scholar]
2.Chen Q, Qi C, Peng G, Liu Y, Zhang X, Meng Z. Immune-enhancing effects of a polysaccharide PRG1-1 from Russula griseocarnosa on RAW264.7 macrophage cells via the MAPK and NF-kB signalling pathways. Food Agr Immunol. 2018; 29(1):833–844. 10.1080/09540105.2018.1461198. [DOI] [Google Scholar]
3.Eo HJ, Shin H, Song JH, Park GH. Immuno-enhancing effects of fruit of Actinidia polygama in macrophages. Food Agric Immunol. 2021; 32(1):754–765. 10.1080/09540105.2021.1982868. [DOI] [Google Scholar]
4.Hong SH, Ku JM, In Kim H, Ahn C-W, Park S-H, Seo HS, et al. The immune-enhancing activity of Cervus nippon mantchuricus extract (NGE) in RAW264.7 macrophage cells and immunosuppressed mice. Food Res Int. 2017; 99:623–629. doi: 10.1016/j.foodres.2017.06.053 [DOI] [PubMed] [Google Scholar]
5.Li Y, Meng T, Hao N, Tao H, Zou S, Li M, et al. Immune regulation mechanism of Astragaloside IV on RAW264.7 cells through activating the NF-κB/MAPK signaling pathway. Int Immunopharmacol. 2017; 49:38–49. doi: 10.1016/j.intimp.2017.05.017 [DOI] [PubMed] [Google Scholar]
6.Geum NG, Eo HJ, Kim HJ, Park GH, Son HJ, Jeong JB. Immune-enhancing activity of Hydrangea macrophylla subsp. serrata leaves through TLR4/ROS-dependent activation of JNK and NF-κB in RAW264.7 cells and immunosuppressed mice. J Funct Foods. 2020; 73:104139. 10.1016/j.jff.2020.104139. [DOI] [Google Scholar]
7.Zhang S, Chai X, Hou G, Zhao F, Meng Q. Platycodon grandiflorum (Jacq.) A. DC.: A review of phytochemistry, pharmacology, toxicology and traditional use. Phytomedicine. 2022; 106:154422. doi: 10.1016/j.phymed.2022.154422 [DOI] [PubMed] [Google Scholar]
8.Jeong C-H, Choi GN, Kim JH, Kwak JH, Kim DO, Kim YJ, et al. Antioxidant activities from the aerial parts of Platycodon grandiflorum. Food Chem. 2010; 118(2):278–282. 10.1016/j.foodchem.2009.04.134. [DOI] [Google Scholar]
9.Lee J-Y, Hwang W-I, Lim S-T. Antioxidant and anticancer activities of organic extracts from Platycodon grandiflorum A. De Candolle roots. J Ethnopharmacol. 2004; 93(2):409–415. doi: 10.1016/j.jep.2004.04.017 [DOI] [PubMed] [Google Scholar]
10.Zhao HL, Harding SV, Marinangeli CPF, Kim YS, Jones PJH. Hypocholesterolemic and anti-obesity effects of saponins from Platycodon grandiflorum in hamsters fed atherogenic diets. J Food Sci. 2008; 73(8):H195–H200. doi: 10.1111/j.1750-3841.2008.00915.x [DOI] [PubMed] [Google Scholar]
11.Yim NH, Hwang YH, Liang C, Ma JY. A platycoside-rich fraction from the root of Platycodon grandiflorum enhances cell death in A549 human lung carcinoma cells via mainly AMPK/mTOR/AKT signal-mediated autophagy induction. J Ethnopharmacol. 2016; 194:1060–1068. doi: 10.1016/j.jep.2016.10.078 [DOI] [PubMed] [Google Scholar]
12.Choi YH, Yoo DS, Cha M-R, Choi CW, Kim YS, Choi S-U, et al. Antiproliferative effects of saponins from the roots of Platycodon grandiflorum on cultured human tumor cells. J Nat Prod. 2010; 73(11):1863–1867. doi: 10.1021/np100496p [DOI] [PubMed] [Google Scholar]
13.Wu J, Yang G, Zhu W, Wen W, Zhang F, Yuan J, et al. Anti-atherosclerotic activity of platycodin D derived from roots of Platycodon grandiflorum in human endothelial cells. Biol Pharm Bull. 2012; 35(8):1216–1221. doi: 10.1248/bpb.b-y110129 [DOI] [PubMed] [Google Scholar]
14.Kim TY, Yoon E, Lee D, Imm J-Y. Antioxidant and anti-inflammatory activities of Platycodon grandiflorum seeds extract. CyTA ‐ J Food. 2020; 18(1):435–444. 10.1080/19476337.2020.1770336. [DOI] [Google Scholar]
15.Park E-J, Lee H-J. Immunomodulatory effects of fermented Platycodon grandiflorum extract through NF-κB signaling in RAW264.7 cells. Nutr Res Pract. 2020; 14(5):453–462. 10.4162/nrp.2020.14.5.453. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Song HW, Lee S, Han EH, Yu HJ, Lim MK. Screening for substances with synergistic anti-inflammatory effects in combination with fermented Platycodon grandiflorum extracts in LPS-stimulated RAW264. 7 cells. J Korean Soc Food Sci Nutr. 2019; 48(2):282–289. [Google Scholar]
17.Noh E-M, Kim J-M, Lee HY, Song H-K, Joung SO, Yang HJ, et al. Immuno-enhancement effects of Platycodon grandiflorum extracts in splenocytes and a cyclophosphamide-induced immunosuppressed rat model. BMC Complement Altern Med. 2019; 19(1):322. doi: 10.1186/s12906-019-2724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Zhao X, Wang Y, Yan P, Cheng G, Wang C, Geng N, et al. Effects of polysaccharides from Platycodon grandiflorum on immunity-enhancing activity in vitro. Molecules. 2017; 22(11):1918. doi: 10.3390/molecules22111918 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Asraful Islam SM, Math RK, Kim JM, Yun MG, Cho JJ, Kim EJ, et al. Effect of plant age on endophytic bacterial diversity of Balloon flower (Platycodon grandiflorum) root and their antimicrobial activities. Curr Microbiol. 2010; 61(4):346–356. doi: 10.1007/s00284-010-9618-1 [DOI] [PubMed] [Google Scholar]
20.Cho BO, Choi J, Kang HJ, Che DN, Shin JY, Kim JS, et al. Anti‑obesity effects of a mixed extract containing Platycodon grandiflorum, Apium graveolens and green tea in high‑fat‑diet‑induced obese mice. Exp Ther Med. 2020; 19(4):2783–2791. doi: 10.3892/etm.2020.8493 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Kang C-H, Kwak DY, So J-S. Inhibition of nitric oxide production and hyaluronidase activities from the combined extracts of Platycodon grandiflorum, Astragalus membranaceus, and Schisandra chinensis. J Korean Soc Food Sci Nutr. 2013; 42(6):844–850. 10.3746/jkfn.2013.42.6.844. [DOI] [Google Scholar]
22.Liang Y-y, Wan X-h, Niu F-j, Xie S-m, Guo H, Yang Y-y, et al. Salvia plebeia R. Br.: an overview about its traditional uses, chemical constituents, pharmacology and modern applications. Biomed Pharmacother. 2020; 121:109589. doi: 10.1016/j.biopha.2019.109589 [DOI] [PubMed] [Google Scholar]
23.Jung H-J, Song YS, Lim C-J, Park E-H. Anti-inflammatory, anti-angiogenic and anti-nociceptive activities of an ethanol extract of Salvia plebeia R. Brown. J Ethnopharmacol. 2009; 126(2):355–360. doi: 10.1016/j.jep.2009.08.031 [DOI] [PubMed] [Google Scholar]
24.Bang S, Quy Ha TK, Lee C, Li W, Oh W-K, Shim SH. Antiviral activities of compounds from aerial parts of Salvia plebeia R. Br. J Ethnopharmacol. 2016; 192:398–405. doi: 10.1016/j.jep.2016.09.030 [DOI] [PubMed] [Google Scholar]
25.Jin X-f, Lu Y-h, Wei D-z, Wang Z-t. Chemical fingerprint and quantitative analysis of Salvia plebeia R.Br. by high-performance liquid chromatography. J Pharm Biomed Anal. 2008; 48(1):100–104. doi: 10.1016/j.jpba.2008.05.027 [DOI] [PubMed] [Google Scholar]
26.Xu J, Wang M, Sun X, Ren Q, Cao X, Li S, et al. Bioactive terpenoids from Salvia plebeia: Structures, NO inhibitory activities, and interactions with iNOS. J Nat Prod. 2016; 79(11):2924–2932. doi: 10.1021/acs.jnatprod.6b00733 [DOI] [PubMed] [Google Scholar]
27.Zou Y-H, Zhao L, Xu Y-K, Bao J-M, Liu X, Zhang J-S, et al. Anti-inflammatory sesquiterpenoids from the traditional Chinese medicine Salvia plebeia: Regulates pro-inflammatory mediators through inhibition of NF-κB and Erk1/2 signaling pathways in LPS-induced RAW264.7 cells. J Ethnopharmacol. 2018; 210:95–106. doi: 10.1016/j.jep.2017.08.034 [DOI] [PubMed] [Google Scholar]
28.Qu X-J, Xia X, Wang Y-S, Song M-J, Liu L-L, Xie Y-Y, et al. Protective effects of Salvia plebeia compound homoplantaginin on hepatocyte injury. Food Chem Toxicol. 2009; 47(7):1710–1715. doi: 10.1016/j.fct.2009.04.032 [DOI] [PubMed] [Google Scholar]
29.Weng XC, Wang W. Antioxidant activity of compounds isolated from Salvia plebeia. Food Chem. 2000; 71(4):489–493. 10.1016/S0308-8146(00)00191-6. [DOI] [Google Scholar]
30.Shin J, Kim O-k, Kim S, Bae D, Lee J, Park J, et al. Immunomodulatory effect of a Salvia plebeia R. aqueous extract in forced swimming exercise-induced mice. Nutrients. 2020; 12(8):2260. doi: 10.3390/nu12082260 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Seo HW, Suh JH, Kyung J-S, Jang KH, So S-H. Subacute oral toxicity and bacterial mutagenicity study of a mixture of Korean red ginseng (Panax ginseng C.A. Meyer) and Salvia plebeia R. Br. extracts. Toxicol Res. 2019; 35(3):215–224. Epub 2019/07/15. doi: 10.5487/TR.2019.35.3.215 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Shin HJ, Gwak HM, Lee MY, Kyung JS, Jang KH, Han CK, et al. Enhancement of respiratory protective and therapeutic effect of Salvia plebeia R. Br. extracts in combination with Korean red ginseng. Korean J Medicinal Crop Sci. 2019; 27(3):218–231. 10.7783/KJMCS.2019.27.3.218. [DOI] [Google Scholar]
33.Lee Y-s, Yang W-K, Yee S-M, Kim S-M, Park Y-C, Shin HJ, et al. KGC3P attenuate ovalbumin-induced airway inflammation through downregulation of p-PTEN in asthmatic mice. Phytomedicine. 2019; 62:152942. doi: 10.1016/j.phymed.2019.152942 [DOI] [PubMed] [Google Scholar]
34.You J, Chang Y, Zhao D, Zhuang J, Zhuang W. A mixture of functional complex extracts from Lycium barbarum and grape seed enhances immunity synergistically in vitro and in vivo. J Food Sci. 2019; 84(6):1577–1585. doi: 10.1111/1750-3841.14611 [DOI] [PubMed] [Google Scholar]
35.Vetvicka V, Vetvickova J. Immune enhancing effects of WB365, a novel combination of Ashwagandha (Withania somnifera) and Maitake (Grifola frondosa) extracts. N Am J Med Sci. 2011; 3(7):320–324. doi: 10.4297/najms.2011.3320 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Vetvicka V, Vetvickova J. Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts. Ann Transl Med. 2014; 2(2):14. doi: 10.3978/j.issn.2305-5839.2014.01.05 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Kwon H-Y, Choi S-I, Han X, Men X, Jang G-W, Choi Y-E, et al. Enhancement of immune activities of mixtures with Sasa quelpaertensis Nakai and Ficus erecta var. sieboldii. Foods. 2020; 9(7):868. doi: 10.3390/foods9070868 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Zhou Y, Zhou M, Mao S. Adjuvant effects of platycodin D on immune responses to infectious bronchitis vaccine in chickens. J Poult Sci. 2020; 57(2):160–167. doi: 10.2141/jpsa.0180089 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Akram M, Syed Ahmed S, Kim K-A, Lee Jong S, Chang S-Y, Kim Chul Y, et al. Heme oxygenase 1-mediated novel anti-inflammatory activities of Salvia plebeia and its active components. J Ethnopharmacol. 2015; 174:322–330. doi: 10.1016/j.jep.2015.08.028 [DOI] [PubMed] [Google Scholar]
40.Han L, Fu Q, Deng C, Luo L, Xiang T, Zhao H. Immunomodulatory potential of flavonoids for the treatment of autoimmune diseases and tumour. Scand J Immunol. 2022; 95(1):e13106. 10.1111/sji.13106. [DOI] [Google Scholar]
41.Liu QM, Xu SS, Li L, Pan TM, Shi CL, Liu H, et al. In vitro and in vivo immunomodulatory activity of sulfated polysaccharide from Porphyra haitanensis. Carbohydr Polym. 2017; 165:189–196. Epub 2017/04/02. doi: 10.1016/j.carbpol.2017.02.032 [DOI] [PubMed] [Google Scholar]
42.Fujiwara N, Kobayashi K. Macrophages in Inflammation. Curr Drug Targets Inflamm Allergy. 2005; 4(3):281–286. doi: 10.2174/1568010054022024 [DOI] [PubMed] [Google Scholar]
43.Ji C, Zhang Z, Chen J, Song D, Liu B, Li J, et al. Immune-enhancing effects of a novel glucan from purple sweet potato Ipomoea batatas (L.) Lam on RAW264.7 macrophage cells via TLR2- and TLR4-mediated pathways. J Agric Food Chem. 2021; 69(32):9313–9325. doi: 10.1021/acs.jafc.1c03850 [DOI] [PubMed] [Google Scholar]
44.He C, Lin HY, Wang CC, Zhang M, Lin YY, Huang FY, et al. Exopolysaccharide from Paecilomyces lilacinus modulates macrophage activities through the TLR4/NF‑κB/MAPK pathway. Mol Med Rep. 2019; 20(6):4943–4952. doi: 10.3892/mmr.2019.10746 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Ren Z, Qin T, Qiu F, Song Y, Lin D, Ma Y, et al. Immunomodulatory effects of hydroxyethylated Hericium erinaceus polysaccharide on macrophages RAW264.7. Int J Biol Macromol. 2017; 105(Pt 1):879–885. Epub 2017/07/22. doi: 10.1016/j.ijbiomac.2017.07.104 [DOI] [PubMed] [Google Scholar]
46.Yu Q, Nie SP, Li WJ, Zheng WY, Yin PF, Gong DM, et al. Macrophage immunomodulatory activity of a purified polysaccharide isolated from Ganoderma atrum. Phytother Res. 2013; 27(2):186–191. Epub 2012/04/19. doi: 10.1002/ptr.4698 [DOI] [PubMed] [Google Scholar]
47.Kim S, Lee CH, Yeo J, Hwang KW, Park S. Immunostimulatory activity of stem bark of Kalopanax pictus in RAW264.7 macrophage. J Herb Med. 2022; 32:100504. 10.1016/j.hermed.2021.100504. [DOI] [Google Scholar]
48.Kim Y-S, Kim E-K, Nawarathna WP, Dong X, Shin W-B, Park J-S, et al. Immune-stimulatory effects of Althaea rosea flower extracts through the MAPK signaling pathway in RAW264.7 cells. Molecules. 2017; 22(5):679. doi: 10.3390/molecules22050679 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Yoon YD, Kang JS, Han SB, Park S-K, Lee HS, Kang JS, et al. Activation of mitogen-activated protein kinases and AP-1 by polysaccharide isolated from the radix of Platycodon grandiflorum in RAW 264.7 cells. Int Immunopharmacol. 2004; 4(12):1477–1487. doi: 10.1016/j.intimp.2004.06.012 [DOI] [PubMed] [Google Scholar]
50.Seo JY, Lee CW, Choi DJ, Lee J, Lee JY, Park YI. Ginseng marc-derived low-molecular weight oligosaccharide inhibits the growth of skin melanoma cells via activation of RAW264.7 cells. Int Immunopharmacol. 2015; 29(2):344–353. Epub 2015/11/10. doi: 10.1016/j.intimp.2015.10.031 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0297512.r001

Decision Letter 0

Babatunde Olanrewaju Motayo

17 Nov 2023

PONE-D-23-29766In vitro immune-enhancing effects of Platycodon grandiflorumcombined with Salvia plebeian via MAPK and NF-κB signaling in RAW264.7 cellsPLOS ONE

Dear Dr. Park,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Dec 30 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Babatunde Olanrewaju Motayo, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Did you know that depositing data in a repository is associated with up to a 25% citation advantage (https://doi.org/10.1371/journal.pone.0230416)? If you’ve not already done so, consider depositing your raw data in a repository to ensure your work is read, appreciated and cited by the largest possible audience. You’ll also earn an Accessible Data icon on your published paper if you deposit your data in any participating repository (https://plos.org/open-science/open-data/#accessible-data).

3. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:

-https://doi.org/10.1016/j.jff.2020.104139

4. In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.

5. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

6. Thank you for stating the following financial disclosure:

NO - Include this sentence at the end of your statement: The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

At this time, please address the following queries:

a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

c) If any authors received a salary from any of your funders, please state which authors and which funders.

d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

7. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

8. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: GENERAL REVIEW

A very beautiful work. But more explanation is required under the methodology. A precise description of the experimentations will be more beneficial to readers. Results should also be presented in areas that they were expressed in figures in the way they were described under methodology (mean ± SD).

SPECIFIC REVIEWS

Line 43: all enhance – all, before enhance

Line 96 – A good description of the laboratory procedure till how the cell culture supernatants were harvested should be described.

Lines 97 – 101 : Cell viability analysis

A step-by-step-description of how this was carried out will be more beneficial to the readers. For instance, “Water-soluble tetrazolium salt (WST) solution was added to each well and incubated for 1 h”. – Which well was it added to? What did the well contain? All the steps should be well described.

Lines 102 – 106 : Determination of NO Production

The description of the methodology is not explicit enough. It will be beneficial if the laboratory analysis is well summarized. What is the volume of Greiss reagent added to what volume culture supernatants before incubation and measurement?

Line 109 – Should have come as the last lines under the “Cell culture” [line 87] heading. (See my comment on line 96 above).

Line 110-112: Please describe briefly the principle of the ELISA and describe briefly the step-by-step analytical method employed in carrying out the technique. It can be generalized for all the ELISA assays.

Line 123 – Please state in your Real-time qPCR analysis, where the primers were sourced from?

Line 132 – What is RIPA buffer? Please write in full, the bracket the abbreviation

Line 133 – EDTA, as in 132.

Lines 134 – 136: briefly describe how you measured the protein. Not just to write that they were measured

Lines 146-147 – “The significance was analyzed using one-way analysis of variance” – this is not a correct statement. Analysis of variance is used when testing more than 2 parametric variables, but this is not the right way to express it. Please correct.

Lines 151 – 152: Your n=3, and express=ion of the results were in box plot. Therefore, you should express your figurative reports in XXX ± XX, (mean ± SD) and not just in percentage.

Lines 178 – 179 – Express your results in mean ± SD as explained above

Lines 183 – 184 – Express in figures like above.

Lines 206 – 212 – You need to express your results generally in mean ± SD as you express in your methodology, and as the figures show.

Reviewer #2: The authors investigated the immune enhancing effects of PGSP via MAPK and NF-KB signaling in RAW264.7 cells. They related the genetic expression (mRNA) and protein levels of inflammatory markers (COX-2, TNF-alpha, IL-1B, IL-6, iNOS, etc) as basis for immune enhancing effects. They also attempted to describe the mechanisms of stimulation as being through phosphorylation of ERK,JNK,p38 and NF-kBp65.

However, there are major concerns to the method use in this study.

1. The LPS control is at a concentration of 1ug/ml while the PGSP extracts are at 250-1000ug/ml. The results show that at 250ug, the levels of inflammatory markers (iNOS and COx2) on WB is almost nil (see figure 4c). PGSP extracts do not seem to stimulate inflammatory markers at low doses. Comparing their data with a control at a low dose is not a very good basis for comparison. The authors did not also show the levels of cytotoxicty due to this high dose extract except cell counts for cell viability. There are inflammatory markers of cell death and apoptosis (eg PD1). It would be good to show the levels of such markers in the study.

2. The authors claim that there are synergistic effects due to the two combined extracts. However, they fail to show data for levels of inflammatory markers for each of the extracts.

Minor Concerns

1. Why was the extract diluted in 1% FBS and P/S and not in plain medium?

2.The authors need to state the concentration of the cells used for RNA extraction, Western blot as well as Macrophage phagocytosis assay.

3. The authors did not state clearly how the mRNA expression analysis was done. They seem to use Actin as control but they did not say how many biological and technical replicates were done and how they analysed for mRNA expression.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr. Kazeem S. Akinwande

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Feb 2;19(2):e0297512. doi: 10.1371/journal.pone.0297512.r002

Author response to Decision Letter 0

15 Dec 2023

Response to Reviewer 1 Comments

GENERAL REVIEW

- It was corrected.

- Thanks.

SPECIFIC REVIEWS

Line 43: all enhance – all, before enhance

- It was corrected.

- Thanks.

Line 96 – A good description of the laboratory procedure till how the cell culture supernatants were harvested should be described.

- It was corrected.

- Thanks.

Lines 97 – 101 : Cell viability analysis

- It was corrected.

- Thanks.

Lines 102 – 106 : Determination of NO Production

- It was corrected.

- Thanks.

Line 109 – Should have come as the last lines under the “Cell culture” [line 87] heading. (See my comment on line 96 above).

- It was corrected.

- Thanks.

Line 123 – Please state in your Real-time qPCR analysis, where the primers were sourced from?

- All primers were based on mouse (Mus musculus) transcript sequence.

- Thank you.

Line 132 – What is RIPA buffer? Please write in full, the bracket the abbreviation

- It was corrected.

- Thanks.

Line 133 – EDTA, as in 132.

- It was corrected.

- Thanks.

Lines 134 – 136: briefly describe how you measured the protein. Not just to write that they were measured

- It was corrected.

- Thanks.

- It was corrected.

- Thanks.

Lines 151 – 152: Your n=3, and expression of the results were in box plot.

Therefore, you should express your figurative reports in XXX ± XX, (mean ± SD) and not just in percentage.

- It was corrected.

- Thanks.

Lines 178 – 179 – Express your results in mean ± SD as explained above

- It was corrected.

- Thanks.

Lines 183 – 184 – Express in figures like above.

- It was corrected.

- Thanks.

Lines 206 – 212 – You need to express your results generally in mean ± SD as you express in your methodology, and as the figures show.

- It was corrected.

- Thanks.

Response to Reviewer 2 Comments

- LPS has been used as a positive control to stimulate the macrophage cells, and this concentration has been used for immune response research.

- Many previous researches like the followings have shown to use this concentration even though the concentration between the control group and samples is different.

References

• Zhou, Y., Qian, C., Yang, D., Tang, C., Xu, X., Liu, E. H., ... & Zhao, Z. (2021). Purification, structural characterization and immunomodulatory effects of polysaccharides from Amomum villosum Lour. on RAW 264.7 macrophages. Molecules, 26(9), 2672.

• Lin, S., Li, H. Y., Yuan, Q., Nie, X. R., Zhou, J., Wei, S. Y., ... & Wu, D. T. (2020). Structural characterization, antioxidant activity, and immunomodulatory activity of non-starch polysaccharides from Chuanminshen violaceum collected from different regions. International Journal of Biological Macromolecules, 143, 902-912.

• Tran, T. H. M., Mi, X. J., Huh, J. E., Mitra, P. A., & Kim, Y. J. (2023). Cirsium japonicum var. maackii fermented with Pediococcus pentosaceus induces immunostimulatory activity in RAW 264.7 cells, splenocytes and CTX-immunosuppressed mice. Journal of Functional Foods, 102, 105449.

• Jiang, S., Yin, H., Qi, X., Song, W., Shi, W., Mou, J., & Yang, J. (2021). Immunomodulatory effects of fucosylated chondroitin sulfate from Stichopus chloronotus on RAW 264.7 cells. Carbohydrate Polymers, 251, 117088.

- In addition, the results were corrected by comparing the significant differences within all treatments even though the signal is not strong and other previous reports have shown like our data.

References

• Lee, J., Kim, S., & Kang, C. H. (2022). Immunostimulatory activity of lactic acid bacteria cell-free supernatants through the activation of NF-κB and MAPK signaling pathways in RAW 264.7 cells. Microorganisms, 10(11), 2247.

• Jung, J. I., Lee, H. S., Kim, S. M., Kim, S., Lim, J., Woo, M., & Kim, E. J. (2022). Immunostimulatory activity of hydrolyzed and fermented Platycodon grandiflorum extract occurs via the MAPK and NF-κB signaling pathway in RAW 264.7 cells. Nutrition Research and Practice, 16(6), 685-699.

• Kim, J. S., Lee, E. B., Choi, J. H., Jung, J., Jeong, U. Y., Bae, U. J., ... & Lee, S. H. (2023). Antioxidant and immune stimulating effects of Allium cepa skin in the raw 264.7 cells and in the C57BL/6 mouse immunosuppressed by cyclophosphamide. Antioxidants, 12(4), 892.

• Gao, X., Qi, J., Ho, C. T., Li, B., Mu, J., Zhang, Y., ... & Xie, Y. (2020). Structural characterization and immunomodulatory activity of a water-soluble polysaccharide from Ganoderma leucocontextum fruiting bodies. Carbohydrate polymers, 249, 116874.

• Cho, H. Y., Lee, J. E., Lee, J. H., Ahn, D. U., & Paik, H. D. (2023). The immune-enhancing activity of egg white ovalbumin hydrolysate prepared with papain via MAPK signaling pathway in RAW 264.7 macrophages. Journal of Functional Foods, 103, 105487.

- Thanks.

The authors did not also show the levels of cytotoxicity due to this high dose extract except cell counts for cell viability. There are inflammatory markers of cell death and apoptosis (eg PD1). It would be good to show the levels of such markers in the study.

- Thank you very much for your valuable comment and suggestion.

- In this current study, the purpose of the experiment was focused on testing the percentage of cell viability and finding the concentration of the extract that does not cause cell death and is effective in increasing immunity.

- Additionally, previous many references such as the followings have shown the cytotoxicity similar to ours.

References

• Eo, H. J., Shin, H., Song, J. H., & Park, G. H. (2021). Immuno-enhancing effects of fruit of Actinidia polygama in macrophages. Food and Agricultural Immunology, 32(1), 754-765.

• Dong, Z., Zhang, M., Li, H., Zhan, Q., Lai, F., & Wu, H. (2020). Structural characterization and immunomodulatory activity of a novel polysaccharide from Pueraria lobata (Willd.) Ohwi root. International journal of biological macromolecules, 154, 1556-1564.

• He, P., Pan, L., Wu, H., Zhang, L., Zhang, Y., Zhang, Y., ... & Zhang, M. (2022). Isolation, identification, and immunomodulatory mechanism of peptides from Lepidium meyenii (Maca) protein hydrolysate. Journal of Agricultural and Food Chemistry, 70(14), 4328-4341.

• Park, C., HwangBo, H., Lee, H., Kim, G. Y., Cha, H. J., Choi, S. H., ... & Choi, Y. H. (2020). The immunostimulatory effect of indole-6-carboxaldehyde isolated from Sargassum thunbergii (Mertens) Kuntze in RAW 264.7 macrophages. Animal Cells and Systems, 24(4), 233-241.

2. The authors claim that there are synergistic effects due to the two combined extracts. However, they fail to show data for levels of inflammatory markers for each of the extracts.

- In our study, the effect of Platycodon grandiflorum alone on NO production at the concentrations of 250-1000 μg/ml for pre-experiments (data not shown in the manuscript) were measured.

- Compared with LPS (100%), the treatment of P. grandiflorum alone has slightly increased NO production to be 8.05-8.96% (A), while the mixture of P. grandiflorum and S. plebeian (PGSP) showed NO production to be 11.27-81.19% (B), that data showed in manuscript. Therefore, the results indicated that the PGSP were high efficiency more than P. grandiflorum alone.

- In addition, many previous studies reported that the immune-enhancement activity of only mixture of various plants have been shown and do not perform the experiments separately with individual substances.

- Thanks.

References

• Choi, M. (2022). Immunity-enhancing effect of extracts extracted from leaves of Rubia hexaphylla, Cymbopogon citratus, and Dioscorea japonica for sustainable healthy life. Sustainability 2022, 14, 2804.

• Han, N. R., Kim, K. C., Kim, J. S., Ko, S. G., Park, H. J., & Moon, P. D. (2022). The immune-enhancing effects of a mixture of Astragalus membranaceus (Fisch.) Bunge, Angelica gigas Nakai, and Trichosanthes Kirilowii (Maxim.) or its active constituent nodakenin. Journal of Ethnopharmacology, 285, 114893.

• Kim, M. C., Lee, G. H., Kim, S. J., Chung, W. S., Kim, S. S., Ko, S. G., & Um, J. Y. (2012). Immune-enhancing effect of Danggwibohyeoltang, an extract from Astragali Radix and Angelicae gigantis Radix, in vitro and in vivo. Immunopharmacology and Immunotoxicology, 34(1), 66-73.

• Park, Y. M., Lee, H. Y., Shin, D. Y., Kim, D. S., Yoo, J. J., Yang, H. J., ... & Bae, J. S. (2022). Immune-Enhancing Effects of Co-treatment With Kalopanax pictus Nakai Bark and Nelumbo nucifera Gaertner Leaf Extract in a Cyclophosphamide-Induced Immunosuppressed Rat Model. Frontiers in Nutrition, 9.

• Shin, H. J., Gwak, H. M., Lee, M. Y., Kyung, J. S., Jang, K. H., Han, C. K., ... & Kim, S. H. (2019). Enhancement of respiratory protective and therapeutic effect of Salvia plebeia R. Br. extracts in combination with Korean red ginseng. Korean Journal of Medicinal Crop Science, 27(3), 218-231.

Minor Concerns

1. Why was the extract diluted in 1% FBS and P/S and not in plain medium?

- The reaction of NO production after adding Griess reagent causes to form a pink-red azo dye, and the pink color is the result of nitic accumulation. It is not led by the color of the RPMI (normally red). Also, as you know, phenol red has own pink color. It can inhibit the identification of NO production in case phenol red is included.

- Therefore, the extract was diluted in RPMI-1640 medium without phenol red, 1% FBS, or P/S, which did not have color.

- Thanks.

2. The authors need to state the concentration of the cells used for RNA extraction, Western blot as well as Macrophage phagocytosis assay.

- It was corrected.

- Thanks.

- It was corrected.

- Thanks.

Attachment

Submitted filename: Response to Reviewer 2 Comment_WJP.docx

Click here for additional data file.^{(169.7KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0297512.r003

Decision Letter 1

Babatunde Olanrewaju Motayo

8 Jan 2024

In vitro immune-enhancing effects of Platycodon grandiflorum combined with Salvia plebeian via MAPK and NF-κB signaling in RAW264.7 cells

PONE-D-23-29766R1

Dear Dr. Park,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Babatunde Olanrewaju Motayo, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: Lines 106 – 109: Please state the exact volume of the supernatants and the WST solution that were added to each well

Lines 125 – 127: A brief general description of the ELISA procedure as requested in the first review was not effected?

Line 159: Please replace “amount” with ‘quantity’ or ‘volume’

Reviewer #2: None. The Authors have addressed the initial comments raised satisfactorily. They also ensured to reflect this in their manuscript

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr. Kazeem S. Akinwande

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0297512.r004

Acceptance letter

Babatunde Olanrewaju Motayo

24 Jan 2024

PONE-D-23-29766R1

PLOS ONE

Dear Dr. Park,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Babatunde Olanrewaju Motayo

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Original western blot gel image data.

(PDF)

Click here for additional data file.^{(4.2MB, pdf)}

S1 File. Supplementary materials and methods.

(PDF)

Click here for additional data file.^{(209.9KB, pdf)}

Attachment

Submitted filename: Response to Reviewer 2 Comment_WJP.docx

Click here for additional data file.^{(169.7KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0297512.ref001] 1.Ko MN, Hyun SB, Ahn KJ, Hyun C-G. Immunomodulatory effects of Abelmoschus esculentus water extract through MAPK and NF-κB signaling in RAW264.7 cells. Biotechnol Notes. 2022; 3:38–44. 10.1016/j.biotno.2022.05.002. [DOI] [Google Scholar]

[pone.0297512.ref002] 2.Chen Q, Qi C, Peng G, Liu Y, Zhang X, Meng Z. Immune-enhancing effects of a polysaccharide PRG1-1 from Russula griseocarnosa on RAW264.7 macrophage cells via the MAPK and NF-kB signalling pathways. Food Agr Immunol. 2018; 29(1):833–844. 10.1080/09540105.2018.1461198. [DOI] [Google Scholar]

[pone.0297512.ref003] 3.Eo HJ, Shin H, Song JH, Park GH. Immuno-enhancing effects of fruit of Actinidia polygama in macrophages. Food Agric Immunol. 2021; 32(1):754–765. 10.1080/09540105.2021.1982868. [DOI] [Google Scholar]

[pone.0297512.ref004] 4.Hong SH, Ku JM, In Kim H, Ahn C-W, Park S-H, Seo HS, et al. The immune-enhancing activity of Cervus nippon mantchuricus extract (NGE) in RAW264.7 macrophage cells and immunosuppressed mice. Food Res Int. 2017; 99:623–629. doi: 10.1016/j.foodres.2017.06.053 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref005] 5.Li Y, Meng T, Hao N, Tao H, Zou S, Li M, et al. Immune regulation mechanism of Astragaloside IV on RAW264.7 cells through activating the NF-κB/MAPK signaling pathway. Int Immunopharmacol. 2017; 49:38–49. doi: 10.1016/j.intimp.2017.05.017 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref006] 6.Geum NG, Eo HJ, Kim HJ, Park GH, Son HJ, Jeong JB. Immune-enhancing activity of Hydrangea macrophylla subsp. serrata leaves through TLR4/ROS-dependent activation of JNK and NF-κB in RAW264.7 cells and immunosuppressed mice. J Funct Foods. 2020; 73:104139. 10.1016/j.jff.2020.104139. [DOI] [Google Scholar]

[pone.0297512.ref007] 7.Zhang S, Chai X, Hou G, Zhao F, Meng Q. Platycodon grandiflorum (Jacq.) A. DC.: A review of phytochemistry, pharmacology, toxicology and traditional use. Phytomedicine. 2022; 106:154422. doi: 10.1016/j.phymed.2022.154422 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref008] 8.Jeong C-H, Choi GN, Kim JH, Kwak JH, Kim DO, Kim YJ, et al. Antioxidant activities from the aerial parts of Platycodon grandiflorum. Food Chem. 2010; 118(2):278–282. 10.1016/j.foodchem.2009.04.134. [DOI] [Google Scholar]

[pone.0297512.ref009] 9.Lee J-Y, Hwang W-I, Lim S-T. Antioxidant and anticancer activities of organic extracts from Platycodon grandiflorum A. De Candolle roots. J Ethnopharmacol. 2004; 93(2):409–415. doi: 10.1016/j.jep.2004.04.017 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref010] 10.Zhao HL, Harding SV, Marinangeli CPF, Kim YS, Jones PJH. Hypocholesterolemic and anti-obesity effects of saponins from Platycodon grandiflorum in hamsters fed atherogenic diets. J Food Sci. 2008; 73(8):H195–H200. doi: 10.1111/j.1750-3841.2008.00915.x [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref011] 11.Yim NH, Hwang YH, Liang C, Ma JY. A platycoside-rich fraction from the root of Platycodon grandiflorum enhances cell death in A549 human lung carcinoma cells via mainly AMPK/mTOR/AKT signal-mediated autophagy induction. J Ethnopharmacol. 2016; 194:1060–1068. doi: 10.1016/j.jep.2016.10.078 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref012] 12.Choi YH, Yoo DS, Cha M-R, Choi CW, Kim YS, Choi S-U, et al. Antiproliferative effects of saponins from the roots of Platycodon grandiflorum on cultured human tumor cells. J Nat Prod. 2010; 73(11):1863–1867. doi: 10.1021/np100496p [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref013] 13.Wu J, Yang G, Zhu W, Wen W, Zhang F, Yuan J, et al. Anti-atherosclerotic activity of platycodin D derived from roots of Platycodon grandiflorum in human endothelial cells. Biol Pharm Bull. 2012; 35(8):1216–1221. doi: 10.1248/bpb.b-y110129 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref014] 14.Kim TY, Yoon E, Lee D, Imm J-Y. Antioxidant and anti-inflammatory activities of Platycodon grandiflorum seeds extract. CyTA ‐ J Food. 2020; 18(1):435–444. 10.1080/19476337.2020.1770336. [DOI] [Google Scholar]

[pone.0297512.ref015] 15.Park E-J, Lee H-J. Immunomodulatory effects of fermented Platycodon grandiflorum extract through NF-κB signaling in RAW264.7 cells. Nutr Res Pract. 2020; 14(5):453–462. 10.4162/nrp.2020.14.5.453. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref016] 16.Song HW, Lee S, Han EH, Yu HJ, Lim MK. Screening for substances with synergistic anti-inflammatory effects in combination with fermented Platycodon grandiflorum extracts in LPS-stimulated RAW264. 7 cells. J Korean Soc Food Sci Nutr. 2019; 48(2):282–289. [Google Scholar]

[pone.0297512.ref017] 17.Noh E-M, Kim J-M, Lee HY, Song H-K, Joung SO, Yang HJ, et al. Immuno-enhancement effects of Platycodon grandiflorum extracts in splenocytes and a cyclophosphamide-induced immunosuppressed rat model. BMC Complement Altern Med. 2019; 19(1):322. doi: 10.1186/s12906-019-2724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref018] 18.Zhao X, Wang Y, Yan P, Cheng G, Wang C, Geng N, et al. Effects of polysaccharides from Platycodon grandiflorum on immunity-enhancing activity in vitro. Molecules. 2017; 22(11):1918. doi: 10.3390/molecules22111918 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref019] 19.Asraful Islam SM, Math RK, Kim JM, Yun MG, Cho JJ, Kim EJ, et al. Effect of plant age on endophytic bacterial diversity of Balloon flower (Platycodon grandiflorum) root and their antimicrobial activities. Curr Microbiol. 2010; 61(4):346–356. doi: 10.1007/s00284-010-9618-1 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref020] 20.Cho BO, Choi J, Kang HJ, Che DN, Shin JY, Kim JS, et al. Anti‑obesity effects of a mixed extract containing Platycodon grandiflorum, Apium graveolens and green tea in high‑fat‑diet‑induced obese mice. Exp Ther Med. 2020; 19(4):2783–2791. doi: 10.3892/etm.2020.8493 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref021] 21.Kang C-H, Kwak DY, So J-S. Inhibition of nitric oxide production and hyaluronidase activities from the combined extracts of Platycodon grandiflorum, Astragalus membranaceus, and Schisandra chinensis. J Korean Soc Food Sci Nutr. 2013; 42(6):844–850. 10.3746/jkfn.2013.42.6.844. [DOI] [Google Scholar]

[pone.0297512.ref022] 22.Liang Y-y, Wan X-h, Niu F-j, Xie S-m, Guo H, Yang Y-y, et al. Salvia plebeia R. Br.: an overview about its traditional uses, chemical constituents, pharmacology and modern applications. Biomed Pharmacother. 2020; 121:109589. doi: 10.1016/j.biopha.2019.109589 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref023] 23.Jung H-J, Song YS, Lim C-J, Park E-H. Anti-inflammatory, anti-angiogenic and anti-nociceptive activities of an ethanol extract of Salvia plebeia R. Brown. J Ethnopharmacol. 2009; 126(2):355–360. doi: 10.1016/j.jep.2009.08.031 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref024] 24.Bang S, Quy Ha TK, Lee C, Li W, Oh W-K, Shim SH. Antiviral activities of compounds from aerial parts of Salvia plebeia R. Br. J Ethnopharmacol. 2016; 192:398–405. doi: 10.1016/j.jep.2016.09.030 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref025] 25.Jin X-f, Lu Y-h, Wei D-z, Wang Z-t. Chemical fingerprint and quantitative analysis of Salvia plebeia R.Br. by high-performance liquid chromatography. J Pharm Biomed Anal. 2008; 48(1):100–104. doi: 10.1016/j.jpba.2008.05.027 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref026] 26.Xu J, Wang M, Sun X, Ren Q, Cao X, Li S, et al. Bioactive terpenoids from Salvia plebeia: Structures, NO inhibitory activities, and interactions with iNOS. J Nat Prod. 2016; 79(11):2924–2932. doi: 10.1021/acs.jnatprod.6b00733 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref027] 27.Zou Y-H, Zhao L, Xu Y-K, Bao J-M, Liu X, Zhang J-S, et al. Anti-inflammatory sesquiterpenoids from the traditional Chinese medicine Salvia plebeia: Regulates pro-inflammatory mediators through inhibition of NF-κB and Erk1/2 signaling pathways in LPS-induced RAW264.7 cells. J Ethnopharmacol. 2018; 210:95–106. doi: 10.1016/j.jep.2017.08.034 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref028] 28.Qu X-J, Xia X, Wang Y-S, Song M-J, Liu L-L, Xie Y-Y, et al. Protective effects of Salvia plebeia compound homoplantaginin on hepatocyte injury. Food Chem Toxicol. 2009; 47(7):1710–1715. doi: 10.1016/j.fct.2009.04.032 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref029] 29.Weng XC, Wang W. Antioxidant activity of compounds isolated from Salvia plebeia. Food Chem. 2000; 71(4):489–493. 10.1016/S0308-8146(00)00191-6. [DOI] [Google Scholar]

[pone.0297512.ref030] 30.Shin J, Kim O-k, Kim S, Bae D, Lee J, Park J, et al. Immunomodulatory effect of a Salvia plebeia R. aqueous extract in forced swimming exercise-induced mice. Nutrients. 2020; 12(8):2260. doi: 10.3390/nu12082260 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref031] 31.Seo HW, Suh JH, Kyung J-S, Jang KH, So S-H. Subacute oral toxicity and bacterial mutagenicity study of a mixture of Korean red ginseng (Panax ginseng C.A. Meyer) and Salvia plebeia R. Br. extracts. Toxicol Res. 2019; 35(3):215–224. Epub 2019/07/15. doi: 10.5487/TR.2019.35.3.215 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref032] 32.Shin HJ, Gwak HM, Lee MY, Kyung JS, Jang KH, Han CK, et al. Enhancement of respiratory protective and therapeutic effect of Salvia plebeia R. Br. extracts in combination with Korean red ginseng. Korean J Medicinal Crop Sci. 2019; 27(3):218–231. 10.7783/KJMCS.2019.27.3.218. [DOI] [Google Scholar]

[pone.0297512.ref033] 33.Lee Y-s, Yang W-K, Yee S-M, Kim S-M, Park Y-C, Shin HJ, et al. KGC3P attenuate ovalbumin-induced airway inflammation through downregulation of p-PTEN in asthmatic mice. Phytomedicine. 2019; 62:152942. doi: 10.1016/j.phymed.2019.152942 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref034] 34.You J, Chang Y, Zhao D, Zhuang J, Zhuang W. A mixture of functional complex extracts from Lycium barbarum and grape seed enhances immunity synergistically in vitro and in vivo. J Food Sci. 2019; 84(6):1577–1585. doi: 10.1111/1750-3841.14611 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref035] 35.Vetvicka V, Vetvickova J. Immune enhancing effects of WB365, a novel combination of Ashwagandha (Withania somnifera) and Maitake (Grifola frondosa) extracts. N Am J Med Sci. 2011; 3(7):320–324. doi: 10.4297/najms.2011.3320 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref036] 36.Vetvicka V, Vetvickova J. Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts. Ann Transl Med. 2014; 2(2):14. doi: 10.3978/j.issn.2305-5839.2014.01.05 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref037] 37.Kwon H-Y, Choi S-I, Han X, Men X, Jang G-W, Choi Y-E, et al. Enhancement of immune activities of mixtures with Sasa quelpaertensis Nakai and Ficus erecta var. sieboldii. Foods. 2020; 9(7):868. doi: 10.3390/foods9070868 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref038] 38.Zhou Y, Zhou M, Mao S. Adjuvant effects of platycodin D on immune responses to infectious bronchitis vaccine in chickens. J Poult Sci. 2020; 57(2):160–167. doi: 10.2141/jpsa.0180089 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref039] 39.Akram M, Syed Ahmed S, Kim K-A, Lee Jong S, Chang S-Y, Kim Chul Y, et al. Heme oxygenase 1-mediated novel anti-inflammatory activities of Salvia plebeia and its active components. J Ethnopharmacol. 2015; 174:322–330. doi: 10.1016/j.jep.2015.08.028 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref040] 40.Han L, Fu Q, Deng C, Luo L, Xiang T, Zhao H. Immunomodulatory potential of flavonoids for the treatment of autoimmune diseases and tumour. Scand J Immunol. 2022; 95(1):e13106. 10.1111/sji.13106. [DOI] [Google Scholar]

[pone.0297512.ref041] 41.Liu QM, Xu SS, Li L, Pan TM, Shi CL, Liu H, et al. In vitro and in vivo immunomodulatory activity of sulfated polysaccharide from Porphyra haitanensis. Carbohydr Polym. 2017; 165:189–196. Epub 2017/04/02. doi: 10.1016/j.carbpol.2017.02.032 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref042] 42.Fujiwara N, Kobayashi K. Macrophages in Inflammation. Curr Drug Targets Inflamm Allergy. 2005; 4(3):281–286. doi: 10.2174/1568010054022024 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref043] 43.Ji C, Zhang Z, Chen J, Song D, Liu B, Li J, et al. Immune-enhancing effects of a novel glucan from purple sweet potato Ipomoea batatas (L.) Lam on RAW264.7 macrophage cells via TLR2- and TLR4-mediated pathways. J Agric Food Chem. 2021; 69(32):9313–9325. doi: 10.1021/acs.jafc.1c03850 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref044] 44.He C, Lin HY, Wang CC, Zhang M, Lin YY, Huang FY, et al. Exopolysaccharide from Paecilomyces lilacinus modulates macrophage activities through the TLR4/NF‑κB/MAPK pathway. Mol Med Rep. 2019; 20(6):4943–4952. doi: 10.3892/mmr.2019.10746 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref045] 45.Ren Z, Qin T, Qiu F, Song Y, Lin D, Ma Y, et al. Immunomodulatory effects of hydroxyethylated Hericium erinaceus polysaccharide on macrophages RAW264.7. Int J Biol Macromol. 2017; 105(Pt 1):879–885. Epub 2017/07/22. doi: 10.1016/j.ijbiomac.2017.07.104 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref046] 46.Yu Q, Nie SP, Li WJ, Zheng WY, Yin PF, Gong DM, et al. Macrophage immunomodulatory activity of a purified polysaccharide isolated from Ganoderma atrum. Phytother Res. 2013; 27(2):186–191. Epub 2012/04/19. doi: 10.1002/ptr.4698 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref047] 47.Kim S, Lee CH, Yeo J, Hwang KW, Park S. Immunostimulatory activity of stem bark of Kalopanax pictus in RAW264.7 macrophage. J Herb Med. 2022; 32:100504. 10.1016/j.hermed.2021.100504. [DOI] [Google Scholar]

[pone.0297512.ref048] 48.Kim Y-S, Kim E-K, Nawarathna WP, Dong X, Shin W-B, Park J-S, et al. Immune-stimulatory effects of Althaea rosea flower extracts through the MAPK signaling pathway in RAW264.7 cells. Molecules. 2017; 22(5):679. doi: 10.3390/molecules22050679 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0297512.ref049] 49.Yoon YD, Kang JS, Han SB, Park S-K, Lee HS, Kang JS, et al. Activation of mitogen-activated protein kinases and AP-1 by polysaccharide isolated from the radix of Platycodon grandiflorum in RAW 264.7 cells. Int Immunopharmacol. 2004; 4(12):1477–1487. doi: 10.1016/j.intimp.2004.06.012 [DOI] [PubMed] [Google Scholar]

[pone.0297512.ref050] 50.Seo JY, Lee CW, Choi DJ, Lee J, Lee JY, Park YI. Ginseng marc-derived low-molecular weight oligosaccharide inhibits the growth of skin melanoma cells via activation of RAW264.7 cells. Int Immunopharmacol. 2015; 29(2):344–353. Epub 2015/11/10. doi: 10.1016/j.intimp.2015.10.031 [DOI] [PubMed] [Google Scholar]

PERMALINK

In vitro immune-enhancing effects of Platycodon grandiflorum combined with Salvia plebeian via MAPK and NF-κB signaling in RAW264.7 cells

A-yeong Jang

Minji Kim

Weerawan Rod-in

Yu Suk Nam

Tae Young Yoo

Woo Jung Park

Roles

Abstract

Introduction

Materials and methods

Preparation of PGSP

Cell culture and treatment

Cell viability analysis

Determination of NO production

Determination of PGE2, COX-2, IL-1β, IL-6, and TNF-α production

Real-time qPCR analysis

Table 1. Primer sequences used in real-time qPCR.

Assay of macrophage phagocytosis

Analysis of western blotting

Data analysis

Results

Effect of PGSP on cell viability

Fig 1. Effect of PGSP on the viability of RAW264.7 macrophages.

Effects of PGSP on the NO production

Fig 2. Effect of PGSP on inflammatory mediator production in RAW264.7 macrophages.

Effects of PGSP on the production of PGE2, COX-2, IL-1β, IL-6, and TNF-α

Effects of PGSP on the cytokine expression

Fig 3. Effect of PGSP on cytokine expression in RAW264.7 macrophages.

Effect of PGSP on iNOS and COX-2 mRNA and protein expression

Fig 4. Effect of PGSP on cytokine expression in RAW264.7 macrophages.

Effects of PGSP on phagocytic activity

Fig 5. Effect of PGSP on the phagocytic ability of macrophages.

Effects of PGSP on NF-κB and MAPK activation

Fig 6. Effects of PGSP on NF-κB and MAPK activation in RAW264.7 macrophages.

Discussion

Conclusion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Babatunde Olanrewaju Motayo

Roles

Author response to Decision Letter 0

Decision Letter 1

Babatunde Olanrewaju Motayo

Roles

Acceptance letter

Babatunde Olanrewaju Motayo

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Determination of PGE₂, COX-2, IL-1β, IL-6, and TNF-α production

Effects of PGSP on the production of PGE₂, COX-2, IL-1β, IL-6, and TNF-α