Abstract
The immune-enhancing activity of the combination of Platycodon grandiflorum and Salvia plebeian extracts (PGSP) was evaluated through macrophage activation using RAW264.7 cells. PGSP (250–1000 μg/mL) showed a higher release of NO in a dose-dependent manner. The results showed that PGSP could significantly stimulate the production of PGE2, COX-2, TNF-α, IL-1β, and IL-6 in RAW264.7 cells and promote iNOS, COX-2, TNF-α, IL-1β, IL-4, and IL-6 mRNA expression. Western blot analysis demonstrated that the protein expression of iNOS and COX-2 and the phosphorylation of ERK, JNK, p38, and NF-κB p65 were greatly increased in PGSP-treated cells. PGSP also promoted the phagocytic activity of RAW264.7 cells. All these results indicated that PGSP might activate macrophages through MAPK and NF-κB signaling pathways. Taken together, PGSP may be considered to have immune-enhancing activity and might be used as a potential immune-enhancing agent.
Introduction
Immunostimulatory agents are used to enhance non-specific immune responses and regulate immunity to protect the body [1]. Numerous natural compounds have been shown to possess immunostimulant properties [1–3]. Several immunomodulators released by macrophages include nitric oxide (NO), prostaglandin E2 (PGE2), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), IL-4, IL-6, IL-10, IL-12, monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor-α (TNF-α), which enhance immune responses [1, 3–6]. Furthermore, the activation of macrophages for the production of immunomodulators was also reported to be mainly promoted by nuclear factor-қB (NF-қB) and mitogen-activated protein kinase (MAPK) signals [1–3, 5].
The balloon flower, Platycodon grandiflorum (Jacq.) A. DC., belonging to the Campanulaceae family, is found in China, Korea, Japan, Russia, and Siberia [7]. It has been recognized as a functional source and traditional oriental medicine [8, 9]. According to reports on phytochemical studies, P. grandiflorum contains triterpenoid saponins (platycodin D, platycoside E, platyconic acid A, and deapioplatycoside E), phenolic acids, minerals, volatile oils, polyacetylene, flavonoids, and polysaccharides that are health-promoting [7]. Pharmacological studies showed that P. grandiflorum had anti-hypercholesterolemic [10], anti-cancer [9, 11], anti-proliferative [12], anti-obesity [10], anti-atherosclerotic [13], antioxidant [8, 9, 14], immunomodulatory [15], anti-inflammatory [14, 16], immuno-enhancing [17, 18], and anti-microbial [19] properties in in vitro and in vivo models. Polysaccharides from P. grandiflorum and fermented P. grandiflorum extract, which was made with Saccharomyces cerevisiae, showed immunomodulatory effects in immune cells [15, 18]. Recently, a mixed extract of P. grandiflorum, Apium graveolens, and Camellia sinensis exhibited anti‑obesity effects in an in vivo system [20]. Kang et al. [21] reported that a mixture of Astragalus membranaceus, Schisandra chinensis, and P. grandiflorum inhibited NO production by RAW264.7 cells.
Salvia plebeia R. Brown. belonging to the Lamiaceae family, is used as a medicinal plant in China, Korea, Japan, Afghanistan, India, Iran, and Australia [22, 23]. In Korea, S. plebeian has been used to treat the common cold, flu, and cough [22, 24]. S. plebeia contains chemical compounds that include flavonoids, lignans, phenolic compounds, terpenoids, sesquiterpenoids, diterpenoids, monoterpenoids, triterpenes, and volatile oils [22, 25–27], which showed biological activity, such as anti-tumor, antioxidant, hepatoprotective, antimicrobial, antiviral, and anti-inflammatory effects [24, 27–29]. S. plebeian can also stimulate the immune system by increasing phagocytic activity and NO, TNF-α, and IL-1β production in RAW264.7 cells, as well as promoting natural killer (NK) cell activity and IL-12 production in splenocytes [30]. In addition, a mixture of S. plebeia and Korean red ginseng exhibited anti-asthmatic and synergistic anti-inflammatory effects in airways [31–33].
Although individual immunostimulatory effects have been demonstrated, the mixture of P. grandiflorum and S. plebeia has not been previously studied, and the effects of the combination of these plants remain unclear. A number of studies demonstrated that the combination of plant materials enhanced immunity both in vivo and in vitro, showing a more powerful bioactive effect than single plant species alone [16, 34–37]. Therefore, the objective of this study was to determine if the effects on immune function are enhanced by treating murine macrophages with a mixture of P. grandiflorum and S. plebeian (PGSP).
Materials and methods
Preparation of PGSP
A mixture of PGSP was supplied after manufacturing by FD FARM Co.,Ltd. (Incheon, Korea). Briefly, dried P. grandiflorum and S. plebeian at a ratio of 1:1 (v/v) were mixed and extracted by adding distilled water at 100°C ± 5 for 6–8 h. The water extract was concentrated using a vacuum concentrator until the solid content reached a brix of 50 ± 5.0 to obtain PGSP extract. PGSP was stored at -4°C and used in this study. The ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) to identify and quantify platycodin D and platycoside E in PSGP were presented in Supplemental Material. The UPLC-MS/MS analysis indicated that the PGSP contained 4 saponins, including platycoside D1 (1.11 ± 0.02 mg/g), platycoside D2 (1.73 ± 0.04 mg/g), platycoside E1 (2.40 ± 0.09 mg/g), and platycoside E2 (1.04 ± 0.09 mg/g).
Cell culture and treatment
Mouse macrophage cell lines were obtained from the Korean Cell Line Bank (Korean Cell Line Research Foundation, Seoul, Korea) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS, Welgene, Korea) and 1% penicillin/streptomycin (P/S, Welgene, Korea) in humidified incubators containing 5% CO2. Various concentrations of PGSP were diluted in RPMI-1640 medium without phenol red, supplemented with 1% FBS and 1% P/S. Concentrations of 250, 500, 750, and 1000 μg/mL of PGSP were added to the cells for 24 h. Lipopolysaccharide (LPS, 1 μg/mL) was used as the positive control. After incubation, the immunological effects were assessed in subsequent experiments.
Cell viability analysis
The EZ-Cytox Cell Viability Assay Kit (Daeil Labservice, Seoul, Korea) was used to determine cell viability. RAW264.7 cells (1 × 106 cells/mL) were cultured with samples (250–1000 μg/mL) and incubated for 24 h. The supernatants were removed, and 100 μL of a water-soluble tetrazolium salt (WST) solution was added to each well. The PGSP-treated cells were incubated at 37°C for 1 h. The absorbance was measured at 450 nm using a microplate reader (BioTek, Winooski, VT, USA).
Determination of NO production
Griess reagent (Sigma-Aldrich, St. Louis, MO, USA) was used for the detection of NO production in macrophages. The cells (1 × 106 cells/mL) were treated with PGSP for 24 h before the culture supernatants (100 μL) was transferred into each well of a 96-well plate. An equal volume (100 μL) of Griess reagent (0.1% N-1-napthylethylenediamine dihydrochloride in distilled water and 1% sulfanilamide in 5% phosphoric acid) was added to and incubated for 10 min at room temperature. Finally, the absorbance at 540 nm was measured using a microplate reader.
Determination of PGE2, COX-2, IL-1β, IL-6, and TNF-α production
Cells (1 × 106 cells/mL) were treated with PGSP and subsequently cultured for 24 h. After treatment, the supernatants were collected and stored at -20°C until analysis. PGE2 levels were measured using a PGE2 ELISA kit (Enzo Life Sciences, Farmingdale, NY, USA), and IL-1β, IL-6, TNF-α, and COX-2 concentrations were determined using ELISA kits specific for each cytokine (Abcam, Cambridge, UK), according to the manufacturer’s instructions. The PGE2, COX-2, IL-1β, IL-6, and TNF-α production were analyzed with each standard curve.
Real-time qPCR analysis
Tri reagent® (Molecular Research Center, Inc., Cincinnati, OH, USA) was used to extract total RNA from LPS- and PGSP-treated and untreated RAW264.7 cells at a density of 1 × 106 cells/mL, according to the manufacturer’s protocol. cDNA was synthesized using 1000 ng of RNA in the following steps: 25°C for 10 min, 37°C for 120 min, and 85°C for 5 min, using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). To quantify the mRNA levels of gene expression, real-time qPCR analysis was performed using TB Green® Premix Ex Taq™ II (Takara Bio Inc., Shiga, Japan) that mixed a final concentration of 0.4 μM of a specific primer pairs, 1 × ROX Reference Dye, and 5 ng of cDNA templates, and then carried out on a QuantStudio™ 3 FlexReal-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The reaction steps were as follows: 95°C for 30 s, 40 cycles of 95°C for 5 s, and 60°C for 34 s. Then, 95°C for 30 s, 60°C for 1 min, and 95°C for 15 s were added at the end of the cycles. All reactions was carried out in triplicate. The relative expression of the target genes was calculated and normalized to that of β-actin as an internal control. A list sequences of mouse primers are provided in Table 1.
Table 1. Primer sequences used in real-time qPCR.
| Target genes | Accession numbers | Primer sequence (5΄ to 3΄) | |
|---|---|---|---|
| Sense | Antisense | ||
| IL-1β | NM_008361.4 | GGGCCTCAAAGGAAAGAATC | TACCAGTTGGGGAACTCTGC |
| IL-4 | NM_021283.2 | ACAGGAGAAGGGACGCCAT | GAAGCCCTACAGACGAGCTCA |
| IL-6 | NM_031168.2 | AGTTGCCTTCTTGGGACTGA | CAGAATTGCCATTGCACAAC |
| TNF-α | D84199.2 | ATGAGCACAGAAAGCATGATC | TACAGGCTTGTCACTCGAATT |
| iNOS | BC062378.1 | TTCCAGAATCCCTGGACAAG | TGGTCAAACTCTTGGGGTTC |
| COX-2 | NM_011198.4 | AGAAGGAAATGGCTGCAGAA | GCTCGGCTTCCAGTATTGAG |
| β-actin | NM_007393.5 | CCACAGCTGAGAGGGAAATC | AAGGAAGGCTGGAAAAGAGC |
Assay of macrophage phagocytosis
The PGSP-treated cells at a density of 2 × 106 cells/mL were harvested and washed with ice-cold phosphate-buffered saline (PBS). After that, a solution of FITC-dextran (Sigma-Aldrich, USA) was added to PGSP-treated cells for 1 h at 37°C. The reaction was stopped by adding 1 mL of ice-cold PBS, and the cells were washed three times with 1% paraformaldehyde. Phagocytic uptake was analyzed using the CytoFLEX Flow Cytometer (Beckman Coulter, Inc., USA).
Analysis of western blotting
The PGSP-treated cells (2 × 106 cells/mL) were extracted in 120 μL of lysis buffer containing radioimmunoprecipitation assay (RIPA) buffer, 0.5 mM ethylenediaminetetraacetic acid (EDTA), and an inhibitor cocktail (protease and phosphatase). The cell lysates were incubated at 4°C for 30 min and then centrifuged at 13,000 rpm for 20 min. The protein concentration in the supernatant was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, USA) and estimated using the standard curve, as directed by the manufacturer. Subsequently, equal volumes of proteins were resolved on sodium dodecyl sulfate-polyacrylamide gels and then transferred to polyvinylidene membranes. The membranes were blocked for 1 h in 5% skim milk in 1 × Tris-buffered saline containing 1% Tween-20 (1 × TBST). After incubation, the membranes were washed with 1 × TBST and incubated overnight with the primary antibody (1:2000). Then, the membranes were washed and incubated for 1 h with horseradish peroxidase-conjugated goat anti-rabbit IgG (H+L) (1:2000). The protein bands were detected by Pierce® ECL Plus Western Blotting Substrate and visualized with the ChemiDoc XRS+ imaging system (Bio-Rad, Hercules, CA, USA).
Data analysis
The data were analyzed using SPSS version 23.0 software (SPSS, Inc., Chicago, IL, USA) and presented as the mean ± standard deviation (SD). Each value is the mean of three separate experiments (n = 3). The significance was analyzed using a one-way analysis of variance followed by Duncan’s new multiple range test. P-values of < 0.05 were considered statistically significant.
Results
Effect of PGSP on cell viability
As shown in Fig 1, the cell viability after treatment with PGSP concentrations of 250, 500, 750, and 1000μg/mL was 101.12 ± 1.35%, 98.07 ± 0.59%, 98.48 ± 0.71%, and 100.59 ± 0.77%, respectively, but statistically different from the RPMI controls (p < 0.05). Neither PGSP nor LPS were cytotoxic to RAW264.7 cells within the tested concentration range, suggesting that these doses of PGSP could be used in further experiments without causing cytotoxicity.
Fig 1. Effect of PGSP on the viability of RAW264.7 macrophages.
Cell viability was determined by the EZ-Cytox Cell Viability Assay Kit. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.
Effects of PGSP on the NO production
After 24 h of incubation with PGSP, the production of NO in RAW264.7 macrophages was measured. As shown in Fig 2A, PGSP showed a significant stimulatory effect on NO production in a dose-dependent manner, which was 81.19 ± 1.30% at the highest concentration (1000 μg/mL). The amount of NO produced by PGSP was comparable to that of the positive control, LPS (1 μg/mL), indicating that it exerted strong stimulant activity.
Fig 2. Effect of PGSP on inflammatory mediator production in RAW264.7 macrophages.
(A) NO concentration in the medium was measured using Griess reagent. (B–D) PGE2, COX-2, IL-1β, IL-6, and TNF-α production was determined using an ELISA kit. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.
Effects of PGSP on the production of PGE2, COX-2, IL-1β, IL-6, and TNF-α
Cells treated with PGSP (250–1000 μg/mL) or LPS (1 μg/mL) secreted more PGE2, COX-2, IL-1β, IL-6, and TNF-α than cells treated with RPMI (Fig 2B–2F). The amounts of cytokines secreted from PGSP-treated cells were lower than those from LPS-treated cells (the positive control). The production of PGE2, COX-2, IL-1β, IL-6, and TNF-α was also increased by 88.05 ± 0.64%, 73.17 ± 4.06%, 77.30 ± 0.79%, 100.65 ± 0.52%, and 89.51 ± 1.50%, respectively, at 1000 μg/mL of PGSP.
Effects of PGSP on the cytokine expression
Real-time qPCR analysis showed that PGSP increased the mRNA levels of IL-1β, IL-4, IL-6, and TNF-α in RAW264.7 macrophages (Fig 3). Furthermore, the immune-stimulatory mRNA levels of cytokines, such as IL-1β, IL-4, IL-6, and TNF-α, were higher in macrophage cells treated with PGSP compared to RPMI-treated cells.
Fig 3. Effect of PGSP on cytokine expression in RAW264.7 macrophages.
The mRNA expression of cytokines was determined by real-time qPCR. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.
Effect of PGSP on iNOS and COX-2 mRNA and protein expression
Real-time qPCR and western blot analyses were performed on RAW264.7 macrophages to examine whether the induction of immunomodulators like NO and PGE2 occurred due to mRNA and protein expression of iNOS and COX-2. As shown in Fig 4A and 4B, the mRNA expression levels of iNOS and COX-2 were significantly enhanced in a concentration-dependent manner after treatment of the cells with PGSP for 24 h. PGSP concentration-dependently induced the expression of iNOS and COX-2 protein (Fig 4C). Additionally, PGSP induced iNOS and COX-2 expression at a lower level than that in LPS-treated cells but stronger than that in RPMI-treated cells. Therefore, PGSP may regulate pro-inflammatory mediators, such as iNOS and COX-2.
Fig 4. Effect of PGSP on cytokine expression in RAW264.7 macrophages.
The mRNA expression of iNOS (A) and COX-2 (B) was determined by real-time qPCR. (C) The protein expression of iNOS and COX-2 was determined by western blotting. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.
Effects of PGSP on phagocytic activity
A fluorescein isothiocyanate (FITC)–dextran uptake assay was performed to measure the effects of PGSP or LPS on macrophage phagocytosis. As shown in Fig 5, the results revealed that LPS could increase macrophage phagocytic activity by 68.77 ± 0.07%, which was displayed by higher FITC-fluorescence intensity than the untreated control group. Flow cytometry revealed that the percentage of phagocytosis increased to 41.02 ± 2.27%, 54.69 ± 2.70%, 62.72 ± 2.90%, and 69.22 ± 1.59% in cells treated with 250, 500, 750, and 1000 μg/mL, respectively.
Fig 5. Effect of PGSP on the phagocytic ability of macrophages.
The cellular uptake of FITC-dextran was determined by flow cytometry. (A) Flow data for the uptake by FITC-dextran of macrophages from one of three independent experiments. (B) The proportion of phagocytic macrophage activity. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.
Effects of PGSP on NF-κB and MAPK activation
To investigate the molecular mechanisms underlying the immune-enhancing effects of PGSP, the phosphorylation of NF-κB subunit p65, JNK, ERK, and p-38 MAPK was evaluated in RAW264.7 cells by western blotting, and the results are shown in Fig 6. A dose-dependent increase in NF-κB and MAPK activation was observed by treatment with PGSP compared to RPMI. PGSP induced NF-κB-p65, ERK1/2, p38, and JNK phosphorylation, indicating NF-κB and MAPK activation. LPS also strongly increased NF-κB and MAPK expression levels (Fig 6).
Fig 6. Effects of PGSP on NF-κB and MAPK activation in RAW264.7 macrophages.
Phosphorylation levels of ERK, JNK, and p38 MAPKs were determined by western blotting. All values are presented as the mean ± SD of three independent experiments (n = 3). A different letter (p < 0.05) reveals statistically significant differences within treatments.
Discussion
Previous pharmacological studies on P. grandiflorum mainly examined its immune-enhancing effects in vitro and in vivo [15, 18]. P. grandiflorum extracts primarily contained platycodin D and exhibited immuno-enhancing effects both in vitro and in vivo [16, 17, 38]. Treatment of RAW264.7 cells with the combination of fermented P. grandiflorum and soybean extract or vitamin C showed immune responses greater than treatment with fermented P. grandiflorum alone [16]. S. plebeian extracts were also used in these studies to modulate immunity in the forced swimming exercise-induced model [30]. S. plebeian extracts contained higher quantities of flavonoids, such as luteolin, luteoloside, nepetin, nepitrin, hispidulin, homoplantagenin, and eupatorine [39], which have anti-inflammatory effects. These flavonoid compounds displayed immunomodulatory effects in various cells [40]. However, the action of P. grandiflorum mixed with S. plebeian has not been reported. In this study, we investigated the immunostimulatory effects of a mixture of P. grandiflorum and S. plebeia (PGSP) in a macrophage cell line and the mechanism through which PGSP enhanced inflammatory responses.
Macrophages are known to be involved in multiple biological functions, such as inflammation control and immune enhancement, by releasing pro-inflammatory cytokines and inflammatory factors [41, 42]. The phagocytic activity of macrophages is a key indicator of macrophage activation in non-specific immune responses [43]. The results of this study indicated that PGSP significantly improved macrophage phagocytosis, consistent with previously reported results [43–46]. The results showed that PGSP activated macrophages to improve immunity.
The signal transduction molecules NO and PGE2 play important roles in inflammation. Fermented P. grandiflorum extract enhanced NO production at the highest concentration (500 μg/mL), but the effect was only slightly statistically significant compared to the control group [15]. In this study, PGSP significantly stimulated NO production at a dose range of 250–1000 μg/mL. Similarly, mixtures of Sasa quelpaertensis Nakai and Ficus erecta var. sieboldin effectively stimulated NO production by RAW264.7 cells in a dose range of 10–1000 μg/mL [37]. The inflammatory response involves the enzymes iNOS and COX-2, which regulate the production of NO and PGE2. The results of this study showed that PGSP increased NO and PGE2 secretion and upregulated iNOS and COX-2 expression. PGSP also enhanced immunity by upregulating iNOS and COX-2 protein expression in macrophage cells. Ko et al. (2012) [1] investigated the immunomodulatory effects of Abelmoschus esculentus extracts on RAW2647 cells by regulating the production of TNF-α, IL-1β, IL-6, NO, and PGE2, as well as the expression of iNOS and COX-2 [1]. The combination of Panax ginseng and Scrophularia buergeriana increased phagocytosis, cytokine, and NO production and enhanced iNOS expression via NF-κB activation in RAW264.7 cells and immune responses in splenocytes [46].
Cytokines are important mediators involved in modulating immune and inflammatory responses [42]. A variety of cytokines, including TNF-α, IL-1β, and IL-6, are potent immunomodulators in activated macrophages [47, 48]. According to our findings, PGSP increased serum IL-1β, IL-6, and TNF-α levels. PGSP also increased the mRNA expression levels of cytokines, such as IL-1β, IL-4, IL-6, and TNF-α, in RAW264.7 macrophages. Many studies showed that plant extracts enhanced immunity by upregulating enzymes (iNOS and COX-2) and cytokines (TNF-α, IL-1β, IL-6, IL-10, and IL-12) in macrophages [2, 44, 47]. Thus, our results suggested that PGSP improved immune function by increasing immunostimulatory cytokines, as previous reports showed.
Macrophage activation is associated with the generation of immunomodulators through MAPK and NF-κB pathways [1, 2]. P. grandiflorum polysaccharides were shown to activate MAPK and AP-1 in macrophages [49]. Our study also demonstrated that PGSP could dose-dependently induce the activation of signaling molecules, such as NF-κB and MAPKs, in RAW264.7 cells, indicating that these molecules regulated a variety of cellular functions, including cell survival, proliferation, and apoptosis [50]. These results suggested that PGSP strongly enhanced macrophage cellular immunity by stimulating the phosphorylation of ERK, JNK, p38 MAPK, and NF-κB p65. Althaea rosea extracts were found to exhibit immunomodulatory activity by increasing NO, cytokines, and mediator secretion by activating NF-κB and MAPK proteins in macrophages [48]. Therefore, the present results suggest that PGSP enhanced immune responses by stimulating macrophages through NF-κB and MAPK signaling.
Conclusion
PGSP showed strong immunoenhancing activity in macrophages by increasing the secretion of NO, PGE2, cytokines, mediators, and phagocytosis, as well as increasing the expression of immune-related genes and the activation of NF-κB and MAPK signaling pathways. Thus, PGSP could act as a potent immunomodulator derived from P. grandiflorum and S. plebeian and could also be developed as a functional food or supplementary diet ingredient for health.
Supporting information
(PDF)
(PDF)
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
This study was supported by a research program grant funded by NAAAMYUUU FNC Co., Ltd. and FD Farm Co., Ltd. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Ko MN, Hyun SB, Ahn KJ, Hyun C-G. Immunomodulatory effects of Abelmoschus esculentus water extract through MAPK and NF-κB signaling in RAW264.7 cells. Biotechnol Notes. 2022; 3:38–44. 10.1016/j.biotno.2022.05.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Chen Q, Qi C, Peng G, Liu Y, Zhang X, Meng Z. Immune-enhancing effects of a polysaccharide PRG1-1 from Russula griseocarnosa on RAW264.7 macrophage cells via the MAPK and NF-kB signalling pathways. Food Agr Immunol. 2018; 29(1):833–844. 10.1080/09540105.2018.1461198. [DOI] [Google Scholar]
- 3.Eo HJ, Shin H, Song JH, Park GH. Immuno-enhancing effects of fruit of Actinidia polygama in macrophages. Food Agric Immunol. 2021; 32(1):754–765. 10.1080/09540105.2021.1982868. [DOI] [Google Scholar]
- 4.Hong SH, Ku JM, In Kim H, Ahn C-W, Park S-H, Seo HS, et al. The immune-enhancing activity of Cervus nippon mantchuricus extract (NGE) in RAW264.7 macrophage cells and immunosuppressed mice. Food Res Int. 2017; 99:623–629. doi: 10.1016/j.foodres.2017.06.053 [DOI] [PubMed] [Google Scholar]
- 5.Li Y, Meng T, Hao N, Tao H, Zou S, Li M, et al. Immune regulation mechanism of Astragaloside IV on RAW264.7 cells through activating the NF-κB/MAPK signaling pathway. Int Immunopharmacol. 2017; 49:38–49. doi: 10.1016/j.intimp.2017.05.017 [DOI] [PubMed] [Google Scholar]
- 6.Geum NG, Eo HJ, Kim HJ, Park GH, Son HJ, Jeong JB. Immune-enhancing activity of Hydrangea macrophylla subsp. serrata leaves through TLR4/ROS-dependent activation of JNK and NF-κB in RAW264.7 cells and immunosuppressed mice. J Funct Foods. 2020; 73:104139. 10.1016/j.jff.2020.104139. [DOI] [Google Scholar]
- 7.Zhang S, Chai X, Hou G, Zhao F, Meng Q. Platycodon grandiflorum (Jacq.) A. DC.: A review of phytochemistry, pharmacology, toxicology and traditional use. Phytomedicine. 2022; 106:154422. doi: 10.1016/j.phymed.2022.154422 [DOI] [PubMed] [Google Scholar]
- 8.Jeong C-H, Choi GN, Kim JH, Kwak JH, Kim DO, Kim YJ, et al. Antioxidant activities from the aerial parts of Platycodon grandiflorum. Food Chem. 2010; 118(2):278–282. 10.1016/j.foodchem.2009.04.134. [DOI] [Google Scholar]
- 9.Lee J-Y, Hwang W-I, Lim S-T. Antioxidant and anticancer activities of organic extracts from Platycodon grandiflorum A. De Candolle roots. J Ethnopharmacol. 2004; 93(2):409–415. doi: 10.1016/j.jep.2004.04.017 [DOI] [PubMed] [Google Scholar]
- 10.Zhao HL, Harding SV, Marinangeli CPF, Kim YS, Jones PJH. Hypocholesterolemic and anti-obesity effects of saponins from Platycodon grandiflorum in hamsters fed atherogenic diets. J Food Sci. 2008; 73(8):H195–H200. doi: 10.1111/j.1750-3841.2008.00915.x [DOI] [PubMed] [Google Scholar]
- 11.Yim NH, Hwang YH, Liang C, Ma JY. A platycoside-rich fraction from the root of Platycodon grandiflorum enhances cell death in A549 human lung carcinoma cells via mainly AMPK/mTOR/AKT signal-mediated autophagy induction. J Ethnopharmacol. 2016; 194:1060–1068. doi: 10.1016/j.jep.2016.10.078 [DOI] [PubMed] [Google Scholar]
- 12.Choi YH, Yoo DS, Cha M-R, Choi CW, Kim YS, Choi S-U, et al. Antiproliferative effects of saponins from the roots of Platycodon grandiflorum on cultured human tumor cells. J Nat Prod. 2010; 73(11):1863–1867. doi: 10.1021/np100496p [DOI] [PubMed] [Google Scholar]
- 13.Wu J, Yang G, Zhu W, Wen W, Zhang F, Yuan J, et al. Anti-atherosclerotic activity of platycodin D derived from roots of Platycodon grandiflorum in human endothelial cells. Biol Pharm Bull. 2012; 35(8):1216–1221. doi: 10.1248/bpb.b-y110129 [DOI] [PubMed] [Google Scholar]
- 14.Kim TY, Yoon E, Lee D, Imm J-Y. Antioxidant and anti-inflammatory activities of Platycodon grandiflorum seeds extract. CyTA ‐ J Food. 2020; 18(1):435–444. 10.1080/19476337.2020.1770336. [DOI] [Google Scholar]
- 15.Park E-J, Lee H-J. Immunomodulatory effects of fermented Platycodon grandiflorum extract through NF-κB signaling in RAW264.7 cells. Nutr Res Pract. 2020; 14(5):453–462. 10.4162/nrp.2020.14.5.453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Song HW, Lee S, Han EH, Yu HJ, Lim MK. Screening for substances with synergistic anti-inflammatory effects in combination with fermented Platycodon grandiflorum extracts in LPS-stimulated RAW264. 7 cells. J Korean Soc Food Sci Nutr. 2019; 48(2):282–289. [Google Scholar]
- 17.Noh E-M, Kim J-M, Lee HY, Song H-K, Joung SO, Yang HJ, et al. Immuno-enhancement effects of Platycodon grandiflorum extracts in splenocytes and a cyclophosphamide-induced immunosuppressed rat model. BMC Complement Altern Med. 2019; 19(1):322. doi: 10.1186/s12906-019-2724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhao X, Wang Y, Yan P, Cheng G, Wang C, Geng N, et al. Effects of polysaccharides from Platycodon grandiflorum on immunity-enhancing activity in vitro. Molecules. 2017; 22(11):1918. doi: 10.3390/molecules22111918 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Asraful Islam SM, Math RK, Kim JM, Yun MG, Cho JJ, Kim EJ, et al. Effect of plant age on endophytic bacterial diversity of Balloon flower (Platycodon grandiflorum) root and their antimicrobial activities. Curr Microbiol. 2010; 61(4):346–356. doi: 10.1007/s00284-010-9618-1 [DOI] [PubMed] [Google Scholar]
- 20.Cho BO, Choi J, Kang HJ, Che DN, Shin JY, Kim JS, et al. Anti‑obesity effects of a mixed extract containing Platycodon grandiflorum, Apium graveolens and green tea in high‑fat‑diet‑induced obese mice. Exp Ther Med. 2020; 19(4):2783–2791. doi: 10.3892/etm.2020.8493 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kang C-H, Kwak DY, So J-S. Inhibition of nitric oxide production and hyaluronidase activities from the combined extracts of Platycodon grandiflorum, Astragalus membranaceus, and Schisandra chinensis. J Korean Soc Food Sci Nutr. 2013; 42(6):844–850. 10.3746/jkfn.2013.42.6.844. [DOI] [Google Scholar]
- 22.Liang Y-y, Wan X-h, Niu F-j, Xie S-m, Guo H, Yang Y-y, et al. Salvia plebeia R. Br.: an overview about its traditional uses, chemical constituents, pharmacology and modern applications. Biomed Pharmacother. 2020; 121:109589. doi: 10.1016/j.biopha.2019.109589 [DOI] [PubMed] [Google Scholar]
- 23.Jung H-J, Song YS, Lim C-J, Park E-H. Anti-inflammatory, anti-angiogenic and anti-nociceptive activities of an ethanol extract of Salvia plebeia R. Brown. J Ethnopharmacol. 2009; 126(2):355–360. doi: 10.1016/j.jep.2009.08.031 [DOI] [PubMed] [Google Scholar]
- 24.Bang S, Quy Ha TK, Lee C, Li W, Oh W-K, Shim SH. Antiviral activities of compounds from aerial parts of Salvia plebeia R. Br. J Ethnopharmacol. 2016; 192:398–405. doi: 10.1016/j.jep.2016.09.030 [DOI] [PubMed] [Google Scholar]
- 25.Jin X-f, Lu Y-h, Wei D-z, Wang Z-t. Chemical fingerprint and quantitative analysis of Salvia plebeia R.Br. by high-performance liquid chromatography. J Pharm Biomed Anal. 2008; 48(1):100–104. doi: 10.1016/j.jpba.2008.05.027 [DOI] [PubMed] [Google Scholar]
- 26.Xu J, Wang M, Sun X, Ren Q, Cao X, Li S, et al. Bioactive terpenoids from Salvia plebeia: Structures, NO inhibitory activities, and interactions with iNOS. J Nat Prod. 2016; 79(11):2924–2932. doi: 10.1021/acs.jnatprod.6b00733 [DOI] [PubMed] [Google Scholar]
- 27.Zou Y-H, Zhao L, Xu Y-K, Bao J-M, Liu X, Zhang J-S, et al. Anti-inflammatory sesquiterpenoids from the traditional Chinese medicine Salvia plebeia: Regulates pro-inflammatory mediators through inhibition of NF-κB and Erk1/2 signaling pathways in LPS-induced RAW264.7 cells. J Ethnopharmacol. 2018; 210:95–106. doi: 10.1016/j.jep.2017.08.034 [DOI] [PubMed] [Google Scholar]
- 28.Qu X-J, Xia X, Wang Y-S, Song M-J, Liu L-L, Xie Y-Y, et al. Protective effects of Salvia plebeia compound homoplantaginin on hepatocyte injury. Food Chem Toxicol. 2009; 47(7):1710–1715. doi: 10.1016/j.fct.2009.04.032 [DOI] [PubMed] [Google Scholar]
- 29.Weng XC, Wang W. Antioxidant activity of compounds isolated from Salvia plebeia. Food Chem. 2000; 71(4):489–493. 10.1016/S0308-8146(00)00191-6. [DOI] [Google Scholar]
- 30.Shin J, Kim O-k, Kim S, Bae D, Lee J, Park J, et al. Immunomodulatory effect of a Salvia plebeia R. aqueous extract in forced swimming exercise-induced mice. Nutrients. 2020; 12(8):2260. doi: 10.3390/nu12082260 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Seo HW, Suh JH, Kyung J-S, Jang KH, So S-H. Subacute oral toxicity and bacterial mutagenicity study of a mixture of Korean red ginseng (Panax ginseng C.A. Meyer) and Salvia plebeia R. Br. extracts. Toxicol Res. 2019; 35(3):215–224. Epub 2019/07/15. doi: 10.5487/TR.2019.35.3.215 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Shin HJ, Gwak HM, Lee MY, Kyung JS, Jang KH, Han CK, et al. Enhancement of respiratory protective and therapeutic effect of Salvia plebeia R. Br. extracts in combination with Korean red ginseng. Korean J Medicinal Crop Sci. 2019; 27(3):218–231. 10.7783/KJMCS.2019.27.3.218. [DOI] [Google Scholar]
- 33.Lee Y-s, Yang W-K, Yee S-M, Kim S-M, Park Y-C, Shin HJ, et al. KGC3P attenuate ovalbumin-induced airway inflammation through downregulation of p-PTEN in asthmatic mice. Phytomedicine. 2019; 62:152942. doi: 10.1016/j.phymed.2019.152942 [DOI] [PubMed] [Google Scholar]
- 34.You J, Chang Y, Zhao D, Zhuang J, Zhuang W. A mixture of functional complex extracts from Lycium barbarum and grape seed enhances immunity synergistically in vitro and in vivo. J Food Sci. 2019; 84(6):1577–1585. doi: 10.1111/1750-3841.14611 [DOI] [PubMed] [Google Scholar]
- 35.Vetvicka V, Vetvickova J. Immune enhancing effects of WB365, a novel combination of Ashwagandha (Withania somnifera) and Maitake (Grifola frondosa) extracts. N Am J Med Sci. 2011; 3(7):320–324. doi: 10.4297/najms.2011.3320 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Vetvicka V, Vetvickova J. Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts. Ann Transl Med. 2014; 2(2):14. doi: 10.3978/j.issn.2305-5839.2014.01.05 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kwon H-Y, Choi S-I, Han X, Men X, Jang G-W, Choi Y-E, et al. Enhancement of immune activities of mixtures with Sasa quelpaertensis Nakai and Ficus erecta var. sieboldii. Foods. 2020; 9(7):868. doi: 10.3390/foods9070868 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Zhou Y, Zhou M, Mao S. Adjuvant effects of platycodin D on immune responses to infectious bronchitis vaccine in chickens. J Poult Sci. 2020; 57(2):160–167. doi: 10.2141/jpsa.0180089 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Akram M, Syed Ahmed S, Kim K-A, Lee Jong S, Chang S-Y, Kim Chul Y, et al. Heme oxygenase 1-mediated novel anti-inflammatory activities of Salvia plebeia and its active components. J Ethnopharmacol. 2015; 174:322–330. doi: 10.1016/j.jep.2015.08.028 [DOI] [PubMed] [Google Scholar]
- 40.Han L, Fu Q, Deng C, Luo L, Xiang T, Zhao H. Immunomodulatory potential of flavonoids for the treatment of autoimmune diseases and tumour. Scand J Immunol. 2022; 95(1):e13106. 10.1111/sji.13106. [DOI] [Google Scholar]
- 41.Liu QM, Xu SS, Li L, Pan TM, Shi CL, Liu H, et al. In vitro and in vivo immunomodulatory activity of sulfated polysaccharide from Porphyra haitanensis. Carbohydr Polym. 2017; 165:189–196. Epub 2017/04/02. doi: 10.1016/j.carbpol.2017.02.032 [DOI] [PubMed] [Google Scholar]
- 42.Fujiwara N, Kobayashi K. Macrophages in Inflammation. Curr Drug Targets Inflamm Allergy. 2005; 4(3):281–286. doi: 10.2174/1568010054022024 [DOI] [PubMed] [Google Scholar]
- 43.Ji C, Zhang Z, Chen J, Song D, Liu B, Li J, et al. Immune-enhancing effects of a novel glucan from purple sweet potato Ipomoea batatas (L.) Lam on RAW264.7 macrophage cells via TLR2- and TLR4-mediated pathways. J Agric Food Chem. 2021; 69(32):9313–9325. doi: 10.1021/acs.jafc.1c03850 [DOI] [PubMed] [Google Scholar]
- 44.He C, Lin HY, Wang CC, Zhang M, Lin YY, Huang FY, et al. Exopolysaccharide from Paecilomyces lilacinus modulates macrophage activities through the TLR4/NF‑κB/MAPK pathway. Mol Med Rep. 2019; 20(6):4943–4952. doi: 10.3892/mmr.2019.10746 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Ren Z, Qin T, Qiu F, Song Y, Lin D, Ma Y, et al. Immunomodulatory effects of hydroxyethylated Hericium erinaceus polysaccharide on macrophages RAW264.7. Int J Biol Macromol. 2017; 105(Pt 1):879–885. Epub 2017/07/22. doi: 10.1016/j.ijbiomac.2017.07.104 [DOI] [PubMed] [Google Scholar]
- 46.Yu Q, Nie SP, Li WJ, Zheng WY, Yin PF, Gong DM, et al. Macrophage immunomodulatory activity of a purified polysaccharide isolated from Ganoderma atrum. Phytother Res. 2013; 27(2):186–191. Epub 2012/04/19. doi: 10.1002/ptr.4698 [DOI] [PubMed] [Google Scholar]
- 47.Kim S, Lee CH, Yeo J, Hwang KW, Park S. Immunostimulatory activity of stem bark of Kalopanax pictus in RAW264.7 macrophage. J Herb Med. 2022; 32:100504. 10.1016/j.hermed.2021.100504. [DOI] [Google Scholar]
- 48.Kim Y-S, Kim E-K, Nawarathna WP, Dong X, Shin W-B, Park J-S, et al. Immune-stimulatory effects of Althaea rosea flower extracts through the MAPK signaling pathway in RAW264.7 cells. Molecules. 2017; 22(5):679. doi: 10.3390/molecules22050679 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Yoon YD, Kang JS, Han SB, Park S-K, Lee HS, Kang JS, et al. Activation of mitogen-activated protein kinases and AP-1 by polysaccharide isolated from the radix of Platycodon grandiflorum in RAW 264.7 cells. Int Immunopharmacol. 2004; 4(12):1477–1487. doi: 10.1016/j.intimp.2004.06.012 [DOI] [PubMed] [Google Scholar]
- 50.Seo JY, Lee CW, Choi DJ, Lee J, Lee JY, Park YI. Ginseng marc-derived low-molecular weight oligosaccharide inhibits the growth of skin melanoma cells via activation of RAW264.7 cells. Int Immunopharmacol. 2015; 29(2):344–353. Epub 2015/11/10. doi: 10.1016/j.intimp.2015.10.031 [DOI] [PubMed] [Google Scholar]






