Abstract
Helicobacter pylori as a common gastrointestinal (GI) pathogen must possess certain virulence characteristics to colonize the stomach, evade host immune responses, and subsequently induce GI diseases. This research aimed to investigate the expression level of two important genes, the sialic acid-binding adherence (SabA) and the blood group antigen-binding adhesion (BabA) in H. pylori strains isolated from adult patients living in the northern part of Iran, and their association with peptic ulcer disease (PUD) and gastric cancer (GC). This cross-sectional study was carried out on adult patients referring to the GI clinic of the hospitals affiliated to Babol University of Medical Sciences, Iran. New cases diagnosed with gastritis, peptic ulcer or gastric cancer were included. Endoscopic-guided gastric biopsies were examined and H. pylori positive colonies were analyzed to determine the expression of babA and sabA genes, utilizing specific primers and the SYBR Green dye. Among 175 patients with mean age of 51.6±15.6 years, 101 (57.7%) of the individuals tested positive for H. pylori infection. Statistical analysis revealed a significant correlation between sabA (P=0.003) and babA (P=0.002) gene expression and development of PUD and GC. Smoking (P=0.052), gender (P=0.004) and positive babA gene expression (P=0.009) had the greatest association with occurrence of PUD or GC in H. pylori positive patients. In summary, the presence of the sabA gene in people infected with H. pylori increased the risk of GC compared to gastritis, while, the presence of the babA gene was significantly increased in gastric ulcer patients. Considering the diversity of H. pylori isolates and the varying results observed in different geographical regions, further comprehensive studies are required to evaluate the function of these genes in H. pylori pathogenesis and their relationship with clinical outcomes.
Key Words: Helicobacter pylori, Peptic Ulcer Disease, Gastric Cancer, sabA, babA
Introduction
Helicobacter pylori (H. pylori) infection has been represented as an important cause of gastrointestinal disorders such as gastritis, peptic ulcer disease (PUD) and gastric cancer (GC) (1). In 1994, it was identified as a carcinogen factor, and now this pathogen is the most frequent cause of infection-related malignancies in different regions (2).
The worldwide occurrence of H. pylori infection in females and males was reported to be 42.7%.and 46.3%, respectively. The prevalence in adults aged 18 years and over is significantly higher than in children (3). The different prevalence rates of this infection in various countries are attributed to economic factors, the coverage of screening programs and social conditions (4).
Most of the infected patients might be asymptomatic, or only have mild gastritis which can be investigated through endoscopic examination; while 15% of individuals can develop to have PUD, and less than 1% may develop to GC. The wide range of clinical features of H. pylori infection is a result of interaction between genetic characteristics of the host (such as interleukin)s( or tumor necrotizing factors), bacterial virulence characteristics, and environmental factors (e.g. dietary pattern, smoking, alcohol or substance use) (5).
H. pylori virulence factors have been shown to be involved in three primary processes of pathogenesis, namely colonization, immune evasion, and the progression of disease. The process of adherence is regarded as a crucial mechanism for the successful establishment of H. pylori colonization within the stomach. A review of the literature has highlighted the significance of outer membrane proteins (OMPs) in the adhesion of this pathogen to gastric epithelial cells. Numerous genes encoding OMPs belonging to different gene families have been discovered. Notably, the outer membrane protein (Hop) group, the blood group antigen-binding adhesion (BabA), and the sialic acid-binding adhesion (SabA) are among the most extensively investigated OMPs in H. pylori (5). BabA and SabA share a high degree of similarity; however, SabA does not possess the four-strand antiparallel sheet crown which is essential for BabA to bind to its receptor Leb on gastric epithelial cells (6). The SabA protein was described as a “club shaped” molecule which impacts on the interaction of H. pylori with host-cell glycoproteins. It has been suggested that SabA may not only interact with sialyl-Lewis receptors, but also with non-sialylated antigens (5).
Different studies examined the association of various H. pylori virulence factors with development of serious gastrointestinal disorders (7, 8). However, research into potential virulence factors is critical in order to provide useful clinical data. Because there is no information available about babA and sabA gene expression in H. pylori strains within our specific region in Iran, this study aimed to investigate the association of babA and sabA gene expression with PUD and GC.
Materials and methods
Study design and Patients
This cross-sectional was carried out on adult patients aged 18 years and over referring to the gastroenterology (GI) clinic at teaching hospital affiliated to Babol University of Medical Sciences, north of Iran.
A total of 175 participants with gastrointestinal disorders, including gastritis, PUD or GC who were diagnosed by the research gastroenterologist were included. Individuals who had a history of taking antibiotics, antacids or proton pump inhibitors for 14 days before initiation of the research, and people who underwent chemotherapy were excluded (9).
All participants signed written informed consent before enrolment. This study was approved by the Ethics Committee of the Babol University of Medical Sciences (approval no. MuBabol.REC.1394171).
Gastric biopsy and transferring the samples to the microbiology laboratory. All the participants underwent upper endoscopy by the research gastroenterologist, a faculty member; and a biopsy specimen from the antrum of patients were taken. The biopsy specimen was transported using microtubes containing Brucella broth (Himedia, India) to the microbiology laboratory within 3-5 h. Microbial culture and detection of H. pylori colonies
The antral gastric biopsies were immediately dissected and inoculated onto Brucella agar (Himedia, India) enriched with 7% sheep blood and specific antibiotics (amphotericin B 2.5 mg, trimethoprim 5 mg vancomycin 10 mg and polymyxin B 2500 IU). Then, media were incubated at 37 °C under microaerobic conditions for 5-10 days. Identification was based on the Gram staining results, as well as positive catalase, oxidase, and urease tests. The pure cultures were then stored at -70 °C in a mixture of Brucella broth, glycerol.
Molecular detection and expression of babA and sabA genes
RNA was extracted from exponential phase H. pylori cultures with a commercial RNA extraction kit according to the manufacturer’s instructions (Roche, high pure RNA isolation kit, Roche Company, Germany). Moreover, cDNA was synthesized with a commercial cDNA synthesized kit according to the manufacturer’s instructions (Thermo Scientific™ Fermentas, Company, UK).
Then, the expression of babA, and sabA genes, and 16S ribosomal RNA (as the control gene) was investigated using the specific primers (Table 1) and the use of SYBR Green dye (SYBR Green qPCR master mix, Yekta Tajhiz Azma Company, Iran) in the ABI 7300 real time PCR machine (USA). Statistical Analytical analyses were conducted using SPSS version 22 (IBM Corporation, Armonk, NY, USA). The normalized average expression of the target genes compared to the housekeeping gene was calculated with QGene software. Also, quantitative data such as the normalized average of the gene expression were measured by the Wilcoxon Test and Kruskal Wallis Test. Moreover, the ORs and their corresponding 95% CIs were used to assess qualitative data. A p-value of less than 0.05 was considered statistically significant.
Table 1.
Characteristics of the primers used for assessment of babA, and sabA gene expression, and 16S ribosomal RNA
| Primer name | Primer sequences | Amplicon size |
|---|---|---|
| babA | F*: GCACCCTAAACACCCTTATCAAA R**: ATACCCTGGCTCGTTGTTGAA |
254 (bp) |
| sabA | F: AGCATTCAAAACGCCAACAA R: AAAAACCCAATACCGAAGTGATAA |
145 (bp) |
| 16S ribosomal RNA | F: GGAGTACGGTCGCAAGATTAAA R: CTAGCGGATTCTCTCAATGTCAA |
127 (bp) |
*F=Forward primer; **R=Reverse primer
Results
In total, 175 patients with mean age of 51.6±15.6 years including 92 (52.6%) men and 83 (47.4%) women were recruited. Among them, 62 (35.4%) had gastritis, 70 (40%) had PU and 43 (24.6%) had GC. The mean age among the persons diagnosed with gastritis was 45.4±13.1 years; in patients with peptic ulcer: 48.7±13.3 and in persons with gastric cancer were 65.1±14.6 years, respectively. Out of all collected samples, 101 (57.7%) of the patients had H. pylori infection based on culture as previously described (9).
Gene expression by Real-time qRT-PCR
Among the 101 patients with positive H. pylori infection, expression of babA and sabA genes in three defined disease groups showed that in the group with gastritis, 25 patients (83.3%) had sabA, and 9 (30.0%) had babA gene expression.
In patients with PU, 35 (87.5%) were sabA positive, and 20 (50.0%) were babA positive, in patients with GC, 13 (41.9%) had sabA and 4 (12.9%) had babA gene expression. Furthermore, in the gastric group, 25 (83.3%) had sabA gene expression and 9 (30%) had babA gene expression. A Comparison of sabA and babA gene expression in these three disease groups is presented in Table 2. Accordingly, there are significant associations between expression of sabA and babA and Gastric cancer (p=<0.001 and p=0.004), respectively.
Table 2.
Investigating the qualitative expression of genes related to pathogenesis in H. pylori by disease groups
| Genes | Disease groups |
Total
(%) |
P- value | |||
|---|---|---|---|---|---|---|
| Gastric | Gastric ulcer | Gastric cancer | ||||
| No (%) | No (%) | No (%) | ||||
| Qualitative gene expression sabA | Positive Negative |
25 (83.3) 5 (16.7) |
35 (87.5) 5 (12.5) |
13 (42) 18 (58) |
73 (72.3) 28 (27.7) |
<0.001 |
| Qualitative gene expression babA | Positive Negative |
9 (30) 21 (70) |
20 (50) 20 (50) |
4 (12.9) 27 (87.1) |
33 (32.7) 68 (67.3) |
0.004 |
The numbers in the table are reported as numbers (percentages) and P < 0.05 is considered significant.
According to Table 3, the chance of developing GC was higher in H. pylori infected individuals with the presence of the sabA gene compared to those without the gene (p=0.010), suggesting that the sabA gene may be an important factor in the development of GC. Table 3. Comparison of sabA and babA gene expression in gastric ulcer and gastric cancer.
Table 3.
Comparison of sabA and babA gene expression in gastric ulcer and gastric cancer
| Characteristics | PU | GC | ||
|---|---|---|---|---|
| OR (95% CI) | P-value | OR (95% CI) | P-value | |
| Positive sabA gene expression | 1.051 | 0.952 | 0.069 | 0.010 |
| Positive babA gene expression | 4.046 | 0.032 | 1.02 | 0.98 |
* Likelihood ratio test; GC: Gastric cancer, PU
Characteristics PU GC
Additionally, the presence of the babA gene in H. pylori infected individuals was associated with a 4.04-fold increase in the risk of developing PU compared to gastritis, indicating that the babA gene may be an important risk factor for PU (p=0.032).
The mean, standard error of the mean, and median of the normalized values of the two genes, sabA and babA, in different disease groups were examined using the Kruskal-Wallis test in Table 4. Based on the results, no correlation was observed between the normalized values of the two genes and gastrointestinal diseases. However, based on the median, it was indicated that sabA was expressed more than babA. Furthermore, based on the type of disease, it was indicated that sabA was expressed more in the GC samples than in the PU samples. On the other hand, babA was expressed more in the PU samples than in the GC samples. Table 4: The mean, standard error of the mean, and median of the normalized expression values of sabA and babA genes in different disease groups.
Table 4.
The mean, standard deviation, and median of the normalized expression values of sabA and babA genes in different disease groups
| sabA | babA | |
|---|---|---|
|
Genes
Type of disease |
Mean ± SD**
(Median) |
Mean ± SD
(Median) |
| Gastric | 2.71 ± -1.89 (-1.60) | 3.26 ± 3.68- (-3.26) |
| Gastric ulcer | 2.12± 1.69- )1.35( | 2.12 ± 2.45-(1.99) |
| Gastric cancer | 3.54 ± 2.73- (0.83( | 5.1 ± 5.19 (3.38( |
| P- value* | 0.898 | 0.372 |
* Kruskul Wallis Test
** SD: standard deviation ± mean
Discussion
In earlier investigations, it has been demonstrated that individuals with H. pylori infection and gastric ulcers face a higher risk of developing GC, whereas only a small number of DU cases progress to GC.
According to our findings, of the 175 patients studied, 40%, 35%, and 25% had PU, gastritis, and GC, respectively, with 57.7% of them having H. pylori infection. Additionally, the mean age of the referring patients was 65.1 years, and among those with H. pylori infection, the average age was 64 years, which is considered a probable risk factor for cancer.
It is interesting to note that there was a significant relationship between gender and gastrointestinal diseases. Among the referring patients, men were more often than women suffering from PU and GC. This result was contrary to gastric inflammation, as women had more cases of gastritis than men. Moreover, the prevalence of H. pylori depends on geographic regions, age, social and economic status, occupation, and living environment (10, 11).
The virulence factors expressed by H. pylori can serve as a predictive indicator for the development of diverse gastroduodenal diseases. Studies have shown that the expression of the babA and sabA genes, adhesins found in H. pylori, is significantly higher in patients with PU and GC compared to healthy individuals (12, 13). This implies that babA and sabA are the main adhesin genes of H. pylori, facilitating both colonization and motility processes.
Accordingly, another important finding of ours was that 72.3% and 32.7% of isolates had expression of the sabA and babA genes, respectively. PU and GC samples had the highest and lowest expression of the sabA gene, respectively. Recent studies have demonstrated that the sabA gene is the primary factor in the initial colonization of H. pylori and is more active during chronic inflammation, which is in agreement with the findings(14).
The expression of the sabA gene in H. pylori varies depending on the geographic region (15). In some regions, such as Europe, the sabA gene is found in up to 90% of H. pylori strains, whereas in other regions, such as Africa, the frequency is much lower, ranging from 0-20%.
In the current study, the presence of the sabA gene in people infected with H. pylori increased the risk of GC compared to gastritis, and was an important factor in supporting GC. However, it was not significant in relation to PU. These results are consistent with those of other studies conducted in Iran (83.6-100%)(16-18), Taiwan (80%) (19), France (86%) (20), and the Netherlands (93%) (21), while our findings do not support the previous research in Iran (28.7%) (22) and Turkey (7.3%) (13). This result revealed that sabA genetically varies among different strains and geographic areas (23), and may not be present in all H. pylori isolates.
Numerous epidemiological studies have examined the significance of SabA in the progression of gastroduodenal diseases. SabA has been linked to conditions such as atrophic gastritis, intestinal metaplasia, and gastric cancer (24). Nevertheless, the relationship between SabA and diseases within the gastroduodenal tract remains a subject of controversy (25).
Moreover, the babA gene was detected among 50% of peptic ulcer patients. This finding of the current study is consistent with those of other studies that found 40.6% of H. pylori isolates had the babA gene. However, Talebi et al demonstrated that the presence of the babA gene is associated with gastric cancer(25).
Furthermore, Kpoghomou et al. have proposed that the presence of H. pylori carrying the positive babA2 gene may potentially elevate the risk of gastric cancer, particularly within the Asian population (26). In the present study, the presence of the babA gene was significantly increased in gastric ulcer patients. Additionally, the results of our study showed that the babA gene can be a risk factor for PU, such that the presence of the babA gene in people infected with H. pylori compared to the absence of babA in infected people increases the risk of developing gastric ulcers (OR = 4.04). This inconsistency may be due to the expression of different virulence factors, host genetics, and environmental factors (27).
The results of this study did not show any significant expression of the sabA and babA genes and gastrointestinal diseases. However, the results showed that the expression of sabA was higher than babA regardless of the type of gastrointestinal infection. Doohan et al. demonstrated that the absence of babA expression can lead to a decrease in the capacity of H. pylori to adhere to the Lewis antigen on the surface of gastric epithelial cells (12).
Numerous investigations have proposed a connection between babA2 and heightened inflammation of the gastric mucosa, along with an increased risk of developing clinical outcomes (12). In a study conducted by Fujimoto et al., it was observed that strains with low BabA production exhibited more extensive mucosal damage and were linked to gastritis (28). Ansari et al. concluded that while high-level BabA expression is correlated with severe clinical outcomes, several reports have also indicated that low-level expression can lead to severe outcomes, although the underlying mechanism remains unclear (6).
Previous research has indicated that the sabA gene's "on/off" switch allows for a swift response to changing conditions in the gastric, which may help prevent the host's immune system from reacting (12). It is also possible that the expression of the sabA gene is regulated by the secretion of gastric acid. Various animal models have shown that the expression of functional BabA is lost during the infection phase, which suggests that the adhesion function of BabA is highly dynamic and similar to that seen in human infections (29, 30). This may be related to H. pylori's ability to avoid unfavorable colonization environments and evade the host's immune response (12). Limited studies have focused on research outcome variables similar to our research, and this makes it difficult to compare our findings with similar or opposite studies. We did not examine the participants' blood group, dietary pattern, or comorbid disorders such as diabetes mellitus or immunosuppressive disorders, which can alter the patient's biologic profile. These points can be presented as the limitations of this research. Multi-center studies and recruitment of patients with different genetic characteristics are recommended for further research.
The current study found that, similar to most other studies, the expression of sabA was greater than that of babA. However, the expression of sabA was notably lower compared to other findings reported in the literature. Considering the diversity of H. pylori isolates and the varying results observed in different geographical regions, further comprehensive studies are required to evaluate the function of these genes in H. pylori pathogenesis and their relationship with clinical outcomes in Iran. It is imperative to conduct studies with a substantial sample size to gain deeper insights into the interplay between environmental factors, bacterial genotype, and host factors concerning the risk of GC.
Acknowledgments
We would like to thank Babol University of Medical Sciences for funding this study (grant number 9440842).
References
- 1.Tempera PJ, Michael M, Tageldin O, et al. Gastric cancer due to chronic H pylori infection: what we know and where we are going. Diseases. 2022;10:57. doi: 10.3390/diseases10030057. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sathianarayanan S, Ammanath AV, Biswas R, et al. A new approach against Helicobacter pylori using plants and its constituents: A review study. Microb Pathog. 2022;168:105594. doi: 10.1016/j.micpath.2022.105594. [DOI] [PubMed] [Google Scholar]
- 3.Zamani M, Ebrahimtabar F, Zamani V, et al. Systematic review with meta-analysis: the worldwide prevalence of Helicobacter pylori infection. Aliment Pharmacol Ther. 2018;47:868–76. doi: 10.1111/apt.14561. [DOI] [PubMed] [Google Scholar]
- 4.Alsulaimany FAS, Awan ZA, Almohamady AM, et al. Prevalence of Helicobacter pylori Infection and Diagnostic Methods in the Middle East and North Africa Region. Medicina (Kaunas) 2020:56. doi: 10.3390/medicina56040169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chang WL, Yeh YC, Sheu BS. The impacts of H pylori virulence factors on the development of gastroduodenal diseases. J Biomed Sci. 2018;25 doi: 10.1186/s12929-018-0466-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ansari S, Yamaoka Y. Helicobacter pylori BabA in adaptation for gastric colonization. World J Gastroenterol. 2017;23:4158–69. doi: 10.3748/wjg.v23.i23.4158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Ansari S, Yamaoka Y. Helicobacter pylori Virulence Factors Exploiting Gastric Colonization and its Pathogenicity. Toxins (Basel) 2019:11. doi: 10.3390/toxins11110677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kao CY, Sheu BS, Wu JJ. Helicobacter pylori infection: An overview of bacterial virulence factors and pathogenesis. Biomed J. 2016;39:14–23. doi: 10.1016/j.bj.2015.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Salehi M, Sadeghi F, Shokri Shirvani J, et al. Study on relationship between acute gastrointestinal disease and Helicobacter pylori infections. J Acute Dis. 2017;6:264–7. [Google Scholar]
- 10.Ailloud F, Didelot X, Woltemate S, et al. Within-host evolution of Helicobacter pylori shaped by niche-specific adaptation, intragastric migrations and selective sweeps. Nat Commun. 2019;10:2273. doi: 10.1038/s41467-019-10050-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Elshair M, Ugai T, Oze I, et al. Impact of socioeconomic status and sibling number on the prevalence of Helicobacter pylori infection: a cross-sectional study in a Japanese population. Nagoya J Med Sci. 2022;84:374–87. doi: 10.18999/nagjms.84.2.374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Doohan D, Rezkitha YAA, Waskito LA, et al. Helicobacter pylori BabA-SabA Key Roles in the Adherence Phase: The Synergic Mechanism for Successful Colonization and Disease Development. Toxins (Basel) 2021:13. doi: 10.3390/toxins13070485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Yilmaz N, Koruk Ozer M. The Prevalence of Helicobacter Pylori babA, homB, aspA, and sabA Genes and Its Relationship with Clinical Outcomes in Turkey. Can J Gastroenterol Hepatol. 2019;2019:1271872. doi: 10.1155/2019/1271872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Yamaoka Y. Increasing evidence of the role of Helicobacter pylori SabA in the pathogenesis of gastroduodenal disease. J Infect Dev Ctries. 2008;2:174–81. doi: 10.3855/jidc.259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Fang M, Xue Z, He L, et al. Distribution characteristics of the sabA, hofC, homA, homB and frpB-4 genes of Helicobacter pylori in different regions of China. PLoS One. 2022;17:e0268373. doi: 10.1371/journal.pone.0268373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Pakbaz Z, Shirazi MH, Ranjbar R, et al. Frequency of sabA Gene in Helicobacter pylori Strains Isolated From Patients in Tehran, Iran. Iran Red Crescent Med J. 2013;15:767–70. doi: 10.5812/ircmj.5044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sohrabi M, Khashei R, Alizadeh M, et al. Low Rate of babA2 Genotype among Iranian Helicobacter pylori Clinical Isolates. J Clin Diagn Res. 2017;11:DC32–DC6. doi: 10.7860/JCDR/2017/24810.10277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yadegar A, Alebouyeh M, Zali MR. Analysis of the intactness of Helicobacter pylori cag pathogenicity island in Iranian strains by a new PCR-based strategy and its relationship with virulence genotypes and EPIYA motifs. Infect Genet Evol. 2015;35:19–26. doi: 10.1016/j.meegid.2015.07.026. [DOI] [PubMed] [Google Scholar]
- 19.Sheu BS, Odenbreit S, Hung KH, et al. Interaction between host gastric Sialyl-Lewis X and H pylori SabA enhances H pylori density in patients lacking gastric Lewis B antigen. Am J Gastroenterol. 2006;101:36–44. doi: 10.1111/j.1572-0241.2006.00358.x. [DOI] [PubMed] [Google Scholar]
- 20.Lehours P, Menard A, Dupouy S, et al. Evaluation of the association of nine Helicobacter pylori virulence factors with strains involved in low-grade gastric mucosa-associated lymphoid tissue lymphoma. Infect Immun. 2004;72:880–8. doi: 10.1128/IAI.72.2.880-888.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.de Jonge R, Pot RG, Loffeld RJ, et al. The functional status of the Helicobacter pylori sabB adhesin gene as a putative marker for disease outcome. Helicobacter. 2004;9:158–64. doi: 10.1111/j.1083-4389.2004.00213.x. [DOI] [PubMed] [Google Scholar]
- 22.Sedarat Z, Khashei R, Shirzad H, et al. Frequency of helicobacter pylori hopQI, hopQII and sabA genes among Iranian patients with gastroduodenal diseases. Jundishapur J Microbiol. 2018:11. [Google Scholar]
- 23.Shao L, Takeda H, Fukui T, et al. Genetic diversity of the Helicobacter pylori sialic acid-binding adhesin (sabA) gene. Biosci Trends. 2010;4:249–53. [PubMed] [Google Scholar]
- 24.Yamaoka Y, Ojo O, Fujimoto S, et al. Helicobacter pylori outer membrane proteins and gastroduodenal disease. Gut. 2006;55:775–81. doi: 10.1136/gut.2005.083014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Talebi Bezmin Abadi A, Taghvaei T, Mohabbati Mobarez A, et al. High correlation of babA 2-positive strains of Helicobacter pylori with the presence of gastric cancer. Intern Emerg Med. 2013;8:497–501. doi: 10.1007/s11739-011-0631-6. [DOI] [PubMed] [Google Scholar]
- 26.Kpoghomou MA, Wang J, Wang T, et al. Association of Helicobacter pylori babA2 gene and gastric cancer risk: a meta-analysis. BMC Cancer. 2020;20:465. doi: 10.1186/s12885-020-06962-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Alexander SM, Retnakumar RJ, Chouhan D, et al. Helicobacter pylori in Human Stomach: The Inconsistencies in Clinical Outcomes and the Probable Causes. Front Microbiol. 2021;12:713955. doi: 10.3389/fmicb.2021.713955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Fujimoto S, Olaniyi Ojo O, Arnqvist A, et al. Helicobacter pylori BabA expression, gastric mucosal injury, and clinical outcome. Clin Gastroenterol Hepatol. 2007;5:49–58. doi: 10.1016/j.cgh.2006.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ohno T, Vallstrom A, Rugge M, et al. Effects of blood group antigen-binding adhesin expression during Helicobacter pylori infection of Mongolian gerbils. J Infect Dis. 2011;203:726–35. doi: 10.1093/infdis/jiq090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Solnick JV, Hansen LM, Salama NR, et al. Modification of Helicobacter pylori outer membrane protein expression during experimental infection of rhesus macaques. Proc Natl Acad Sci U S A. 2004;101:2106–11. doi: 10.1073/pnas.0308573100. [DOI] [PMC free article] [PubMed] [Google Scholar]