Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Jan 17;103(3):103450. doi: 10.1016/j.psj.2024.103450

Floor eggs in goose breeders: patterns, genetic and environmental influences, and physiological indexes

Wang Gu *,1, Rongxin Chang *,1, Qi Xu *,†,‡, Wenming Zhao *,2, Guohong Chen *,†,‡
PMCID: PMC10840337  PMID: 38277891

Abstract

A floor egg is an egg that is not laid in the nest, which is a prevalent issue in many fowl breeder farms, lowering egg collection efficiency, hatching performance, and economic benefits. Although the pattern and influencing factors of floor laying have been extensively reported in chickens and ducks, it is not clear in geese. Herein, the Yangzhou goose breeders were selected, and the time and location preferences, genetic and environmental influences, and physiological indexes in floor laying were investigated. The results revealed distinct time and location preferences existed. More floor eggs were laid from 2:00 to 5:00 and 8:00 to 12:00 am, with a concentration observed in the feed trough. Moreover, the proportion of floor eggs was higher at the early stage than at other stages of the laying cycle, and the fast-growing line laid more floor eggs than dual-purpose and high-yielding lines (P < 0.05). In addition to genetic factors, the effect of environmental influences on floor eggs was also surveyed. More floor eggs were observed in the family housing system than in large-group and small-population housing systems, and geese who reared in north-facing houses laid more floor eggs than in south-facing houses (P < 0.05). Physiological indexes were compared between floor-laying and nest-laying geese. Significantly decreased serum progesterone and prolactin levels were detected, alongside down-regulated gene expressions of progesterone receptor in ovaries, oxytocin receptor in both pituitary and ovaries, corticotropin-releasing hormone in ovaries, and dopamine receptor D2 in hypothalamus and ovaries in floor-laying geese compared to nest-laying geese (P < 0.05). In addition, a practical and inexpensive approach of adding a single decoy egg to the nest box effectively reduced the proportion of floor eggs (P < 0.05). Taken together, these data provide scientific information for patterns, genetic and environmental influences, and physiological indexes of floor eggs, thereby contributing to effective control of floor laying in goose breeders' production.

Key words: goose breeder, floor egg, preference, physiological index

INTRODUCTION

Eggs outside the nest box, termed floor eggs, are laid by poultry raising in a noncage environment. Ground rearing presently prevails in goose breeders' production. The occurrence of floor eggs among goose breeders is attributed to individual preferences, genetics, environmental factors, and rearing management (McGibbon, 1976; Hulzebosch, 2006; Campbell, 2023). Floor eggs cause various negative effects on the efficiency of manual egg collection, qualification rate, hatching rate, egg contamination and disease transmission, and individual egg production records in breeding, as well as animal welfare (Baker et al., 1985; Hulzebosch, 2006; Campbell, 2023). Effectively controlling the incidence of floor eggs during the laying cycle is a challenging issue in rearing management. In a field survey, there was a huge difference in the proportion of floor eggs between different parental broiler breeders: the highest was 18% and the lowest was 0.1% (Hulzebosch, 2006). The proportion of floor eggs in commercial ducks was up to 40% in the early stage of the laying cycle, while decreased and stabilized at around 10% (Makagon and Mench, 2011; Barrett et al., 2019). In addition, the proportion of floor eggs in Roman geese was about 40% (Wang et al., 2019). Studies also suggested that the proportion of floor eggs could be effectively controlled through appropriate measures or methods (Hulzebosch, 2006; Campbell, 2023). Therefore, it is crucial to clarify the causes of the occurrence of floor eggs and implement scientific solutions to address the issue.

The phenomenon of floor laying in poultry is a comprehensive problem influenced by multiple factors. These include but are not limited to, individual preferences, nest design, genetic lines, rearing environment, early experience, and social behaviors pertaining to nest sites. Although many studies have proposed some improvement methods for floor eggs, such as improving the design and environment of nest boxes, prenatal training, and robot egg picking, the issue of floor eggs remains unresolved by a single practical coping strategy (Appleby, 1984; Hulzebosch, 2006; Campbell, 2023). The critical is to understand the reason or motivation behind poultry laying floor eggs. From the perspective of nest boxes, the availability and attraction of nest boxes are the primary factors affecting the production of floor eggs in poultry, determined by the number, distribution location, design, and comfort (Appleby, 1984; Campbell, 2023). The relatively insufficient number of nest boxes leads to competition, uneven distribution, and suboptimal structural conditions (i.e., design parameters, construction materials, decorative features, and enclosure level), which aggravate the occurrence of floor eggs under certain conditions. However, compared to the wild state, the nest box serves as a positive laying stimulus (Appleby and McRae, 1986). Therefore, ambiguous results in different studies suggest that individual preference is an alternative explanation (Campbell, 2023). Poultry with different genetic backgrounds exhibit variations in laying performance, particularly in floor laying. It has been observed that broiler breeder hens have a higher tendency to lay floor eggs in comparison to commercial egg layers (Purdum et al., 2020). In hens, brown strains, being generally heavier than white strains, exhibit less motivation to access the nest box, thereby contributing to a higher incidence of floor laying (Farkas et al., 2022; Villanueva et al., 2017). However, there is also a study that fails to find this difference (van den Oever et al., 2020). In addition to genetic differences, nest preferences, time spent in the nest, and floor-laying behaviors (nest box acceptance) are heritable within genetic strains (Becot et al., 2021; Wolc et al., 2021; Bécot et al., 2023). The selection of different hen lines against undesirable traits is possible to achieve a reduction in the percentage of floor eggs (Sørensen et al., 2017). Considering the environmental factors, the interference of obstacles (e.g., housing structure beams and columns, and feeding and drinking facilities) around the nest box tends to hinder the use of nest boxes, thus increasing the production of floor eggs (Hulzebosch, 2006; Campbell, 2023). In addition, the microclimate is formed in the aviary with different housing structures, where light, temperature, humidity, and other factors significantly influence the occurrence of floor eggs (Hulzebosch, 2006; Campbell, 2023). Social and individual factors play a role in poultry floor laying. Commercial or breeding birds are typically raised in a gregarious manner, where social factors including competition and hierarchy significantly influence the production of floor eggs in poultry. Dominant birds are more likely to gain preferential access to nest boxes, experiencing less aggressive pecking (Freire et al., 1998; Makagon and Mench, 2011; Barrett et al., 2019). Primiparous or prelaying hens lacking individual experience are prone to laying floor eggs, suggesting that early laying induction and training is a crucial ameliorative measure (Oliveira et al., 2019; Bari et al., 2020; Wolc et al., 2021). In addition, individual preference is a relatively subordinate factor affecting floor laying in group rearing (Campbell, 2023).

In the natural environment, egg-laying poultry engage in behaviors like nesting, dust bathing, perching, foraging, brooding, and other behaviors (Hemsworth and Edwards, 2020). Though some behaviors are eliminated in highly selective breeding, similar behavioral characteristics can be rekindled in a noncage environment. Nevertheless, floor laying represents an undesirable maternal behavior, different from nest laying. Ducks laying floor eggs sit more, walk less, fight less, avoid entering into the next box, and exhibit no nest-seeking behavior (Barrett et al., 2019), which is similar in mammals and rodents (Deacon, 2006; Kinsley and Amory-Meyer, 2011; Jirkof, 2014). For example, rabbits with poor motherhood do not make a nest before delivery or give birth in the nest (González-Mariscal and Gallegos, 2014). With the emergence of modern molecular genetics and more detailed analysis of maternal behaviors, the role of changes in the endocrine hormone levels [i.e., progesterone (P4), prolactin (PRL), and dopamine (DA)] and specific gene expressions [e.g., progesterone receptor (PGR), oxytocin receptor (OXTR), and dopamine receptor (DRD)] in the participation and regulation of maternal behaviors has received more attention (Bridges, 2015; Bridges, 2020). However, studies on maternal behaviors have predominantly focused on mammals and rodents, leaving their association with floor laying in poultry unclear.

Due to multi-factors such as individual preferences, genetics, environment, and rearing management, floor laying in poultry is frequent, which brings a series of problems and ultimately impairs work efficiency, egg quality, animal welfare, and economic benefits. The reasons for the occurrence of floor eggs in poultry remain unclear, and the corresponding coping strategies are relatively simple and insufficiently effective. To date, research on floor eggs in geese is limited compared to chickens and ducks. Hence, this study was conducted to systematically analyze spatial and temporal preferences, as well as the effects of different genetic lines and housing systems on floor laying in Yangzhou goose breeders. By comparing the morphological and histological changes, serum physiological hormone levels, and specific gene expressions in different reproductive tissues of floor-laying geese and nest-laying geese, the physiological basis of floor-laying was explored. In addition, attempts were made to mitigate the occurrence of floor eggs by adding a single decoy egg or padding to the nest box. These data provide scientific information for patterns, genetic and environmental influences, and physiological indexes of floor eggs, which contribute to the control of floor laying in goose breeders' production.

MATERIALS AND METHODS

Ethics Statement

All animal protocols were approved by the Animal Care and Use Committee of Yangzhou University.

Daily Observation and Production Records of Floor Eggs

The study was conducted in the Tiange Goose Industry Co., Ltd., in Yangzhou, Jiangsu, China with normal feeding management. The ratio of male to female was 1: 6, with a rearing density of 1.5 m2 per goose. Manual feeding and egg collection were performed twice a day at 8 am and 4 pm. The dietary composition and nutritional ingredients during the laying cycle were shown in Table 1. Geese had access to nest boxes in laying housing systems from 175 d of age to the end of the laying cycle, to ensure familiarity with the nest boxes prior to the onset of laying (adaptation). The open-topped nest box, made of wood, was placed on the ground without nesting materials. The back and sides of the nest box were solid, while the top and front were open. An intelligent laying identification and recording device (Chinese patent number: CN 209914746 U; 2019SR0601239) was arranged at the bottom of the nest box to identify the laying goose via the individual foot ring. Floor eggs were recorded by daily collection, observation, and video footage for analysis with no daily egg accumulation. In addition to normal natural light conditions, white lighting in the passage was used every night to facilitate feeding and video recording.

Table 1.

Ingredient composition and nutritional level of Yangzhou breeders during the laying cycle.

Ingredient composition (%) Nutritional level
Corn 64.00 ME (MJ/kg) 11.5
Soybean meal 24.00 Crude protein (%) 16.5
Rice husk 2.50 Crude fiber (%) 4.5
Wheat bran 1.00 Ca (%) 3.0
Stone powder 6.20 Total phosphorus (%) 0.70
Calcium hydrogen phosphate 1.50 Available phosphorus (%) 0.48
Methionine 0.10 Met (%) 0.35
Lysine 0.10 Cys (%) 0.35
Salt 0.50 Lys (%) 0.75
Premix 0.10
Total 100
Open in a new tab

The premix per kilogram mainly contains 15, 000, 000 IU VA; 3, 000, 000 IU VD; 20, 000 IU VE; 70 g niacin; 90 g Fe; 85 g Mn and 95 g Zn. The nutrient level was calculated values.

The schematic diagram of geese laying floor eggs and the experimental strategy were presented in Figure 1. Given the low annual egg production, the unique flavor of goose eggs, and the large demand for meat consumption, the dual-use line is the main raising group in goose production. Therefore, we chose the dual-purpose line to explore the effects of environmental influences and physiological indexes on floor laying. The sample size (n) provided for each trial was the number of female geese. For daily time preference, each time floor eggs laid by female geese (n = 72) of the dual-purpose line in the family housing system facing south was recorded in 8 wk at the early stage of the laying cycle by video observation. For time preference of the laying cycle, the number and proportion of floor eggs laid by female geese (n = 240) of the dual-purpose line in the family housing system facing south were recorded in 8 wk at the different stages of the laying cycle by daily observation. For location preference, each location of floor eggs laid by female geese (n = 240) of the dual-purpose line in the family housing system facing south was recorded in 8 wk at the early stage of the laying cycle by daily observation. The number and proportion of floor eggs laid by female geese of 3 lines (fast-growing line, dual-purpose line, high-yielding line, n = 402) in the family housing system facing south were recorded in 8 wk at the early stage of the laying cycle by daily observation. The number and proportion of floor eggs laid by female geese of the dual-purpose line in 3 housing systems [Large-group housing system (n = 720), Small-population housing system (n = 90), family housing system (n = 240)] facing south were recorded in 8 wk at the early stage of the laying cycle by daily observation. In addition, the number and proportion of floor eggs laid by female geese (n = 240) of the dual-purpose line in the family housing systems with 2 location orientations (facing south or north) were recorded in 8 wk at the early stage of the laying cycle by daily observation. In terms of mitigation measures, the number and proportion of floor eggs were observed by adding a single decoy egg or 3 cm thick padding to the nest box for female geese (n = 72) of the dual-purpose line in the family housing system facing south were recorded in 8 wk at the early stage of the laying cycle by daily observation. In addition, decoy eggs are made of plastic materials, and the padding is composed of rice husk.

Figure 1.

Figure 1

Open in a new tab

Schematic diagram of geese laying floor eggs and the experimental strategy. Individual preferences (time and location), genetic and environmental influences, and physiological indexes of floor laying in geese. The information with underlining is a common basic condition under different influencing factors in goose breeders' production.

Identification of Geese Laying Floor Eggs and Sample Collection

To identify geese laying floor eggs, the necks, wings, and backs of the geese were marked with colored numbers. Individual goose number was determined by video observation of floor laying and reconfirmed by a foot ring using the intelligent laying identification and recording system.

After special marking and floor-laying observation, 12 geese of the dual-purpose line (half of the geese laying floor eggs, and half laying nest eggs) raised in a south-facing family house at the age of 266 d were sacrificed. After 6 h of fasting, live individual BW was measured, and the blood was collected. After the centrifugation at 3,000 rpm for 10 min at 4°C, the serum was separated for the determination of hormone level. After phenotypic observations and photography, the different gonadal axis-related organs of the hypothalamus, pituitary, ovaries, and uterus were collected and transferred to -70°C for storage, with the relevant contents and adhesive substances removed. In addition, 1 cm3 samples of 4 organs from the middle part were fixed in formaldehyde for HE staining.

HE Staining and Histomorphological Analysis

In short, tissue samples were fixed in 4% paraformaldehyde and embedded in paraffin. Secondly, sections were made, and placed in xylene, ethanol, and 75% ethanol followed by water washing. Then, sections were stained with hematoxylin followed by eosin. At last, sections were placed in ethanol and xylene, and sealed with neutral gum. Histological images were captured for analysis using a micro-image analysis system (EVOS FL Auto, Thermo Fisher Scientific Inc., Shanghai, China).

Determination of Serum Hormone Levels by ELISA

Serum levels of gonadotropin-releasing hormone (GnRH), follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), P4, and PRL were detected by ELISA following protocols from commercial kits (H297, H101-1-1, H206-1-1, H102-1-1, H089-1-1, H095-1-1, Nanjing Jiancheng Bioengineering Institute, Co., Ltd., Nanjing, China). In brief, 50 µL of prepared sample, standards, and biotin antigen were added into the empty hole respectively, reacting for 30 min at 37°C. Then, after the plate was washed 5 times, 50 µL of horseradish peroxidase conjugate reagent was added, followed by another 30-min incubation at 37°C. In the next step, after the plate was washed 5 times, 50 µL of chromogen solution A and B were added, reacting for 30 min at 37°C. Finally, 50 µL of stop solution was added and OD values were measured for calculation within 10 min.

RNA Extraction, Reverse Transcription, and Real-time Quantitative PCR (RT-qPCR)

To determine gene expressions, total RNA extraction, reverse transcription, and RT-qPCR were conducted following the guidance from commercial kits (R401-01, R212-01, Q111-02, Nanjing Vazyme Biotech Co., Ltd., Nanjing, China). The gene primers, designed based on the GenBank database, were shown in Table 2, with the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene serving as the internal reference. RT-qPCR data were analyzed with the 2−∆∆Ct method using the Ct value.

Table 2.

The information of Gene primers for RT-qPCR.

Gene Accession number Sequence (5′ → 3′)
GnRH XM_013200960.2 F: GAAGGCCTTTGTTGGTATCCTCCTGT
R: AATCTTCTTTCGTCTGGCTTCTCCTTC
FSH-β XM_013177587.2 F: CACCAGTATCATCCGTTCAGC
R: CAGTGCTGTCAGTGTCACAGGTC
LH DQ023159.1 F: GGTGTATCGCAGCCCTTTG
R: TCGTAGCGCAGCGCCCCAT
ESR2 XM_013182962.2 F: CTAGACAGGGACGAGGGGAA
R: GGAAACATGCTGGAATTGAGG
OXTR XM_013182233.2 F: GGGTCTGAGCTCCAACGCC
R: CACATCTGCACGAAGAAAAAGG
CRH XM_048061782.1 F: TCTTTCTCCGCCTCTTCCAG
R: ACCGCTTCTCCCTCTCCAC
DRD2 XM_013187290.2 F: AAAGCCCTTCAGACAACCACG
R: CCTCCACTCACCAACCACCTC
PGR XM_013178063.2 F: AGGAGGAAGAGGAGGAGGAAG
R: CGGGGCTCAGGAAGGTGTC
GAPDH XM_013199522.2 F: GTGGTGCAAGAGGCATTGCTGA
R: GCTGATGCTCCCATGTTCGTGA
Open in a new tab

Statistical Analysis

Statistical significance was analyzed by SPSS software (version 25.0, IBM Corp, Armonk, NY). Descriptive analysis was employed to assess daily time and location preferences, while the Chi-square test was used to determine differences in various aspects of different stages of the laying cycle, genetic lines, housing systems, and mitigation measures. In physiological changes, differences in hormone levels and specific gene expressions between geese laying floor eggs and nest eggs were compared using the student t test, based on the homogeneity of variances. Statistical significance was set at P < 0.05.

RESULTS

Time and Location Preferences for Floor Laying in Geese

From the perspective of daily egg-laying time, floor laying in geese was mainly concentrated in time periods of 2 to 5 am and 8 to 12 am (Figure 2A). From the laying cycle point of view, the proportion of floor eggs laid by geese was significantly higher in the early stage than those in the peak and later stages (P < 0.05; Figure 2B). Judging from different locations of floor eggs, the highest proportion was found in the feed trough, followed by around the nest box, and then on the low-lying ground, but not in the water of the leisure pool (Figure 3). It was observed that geese had a clear preference for the time and location of laying floor eggs.

Figure 2.

Figure 2

Open in a new tab

Time preferences for geese laying floor eggs. (A) The daily time preference for floor laying in geese of the dual-purpose line in the family housing system facing south in 8 wk at the early stage of the laying cycle. The daily time period is based on a unit of 1 h. N = 72. (B) The laying cycle preference for floor laying in geese of the dual-purpose line in the family housing system facing south in 8 wk at the different stages of the laying cycle. The laying cycle contains the early, peak, and later stages. N = 240. Different letters represent significant variances.

Figure 3.

Figure 3

Open in a new tab

Location preferences for geese laying floor eggs. (A) Schematic diagram of potential locations where geese lay floor eggs, including places around the nest box, in the feed trough, on the low-lying ground, and in water. (B) Location preferences for floor laying in geese of the dual-purpose line in the family housing system facing south in 8 wk at the early stage of the laying cycle. N = 240.

Effect of Genetic Lines on Floor Laying in Geese

Geese from different genetic lines exhibit varying egg-laying performances, and the effect of genetic lines on the occurrence of floor eggs is unclear. A comparative analysis of floor eggs laid by geese of 3 different lines (high-yielding line, dual-purpose line, and fast-growing line) was conducted. The proportion of floor eggs in the fast-growing line was the highest, followed by the dual-purpose line, and then the high-yielding line (P < 0.05; Figure 4).

Figure 4.

Figure 4

Open in a new tab

Effect of genetic lines on geese laying floor eggs. There are 3 genetic lines of the fast-growing, dual-purpose, and high-yielding in Yangzhou goose. The proportion of floor eggs laid by female geese of 3 lines in the family housing system facing south were recorded in 8 wk at the early stage of the laying cycle by daily observation. N = 402. Different letters represent significant variances.

Effects of Different Poultry House Environments on Floor Laying in Geese

In terms of housing structure, the highest proportion of floor eggs was observed in geese raised in the family housing system, followed by the large-group housing system, and then the small-population housing system (P < 0.05; Figures 5A and 5B). Considering house orientation, geese raised in the south-facing house exhibited a lower proportion of floor eggs than those in the north-facing house (P < 0.05; Figure 5C and 5D).

Figure 5.

Figure 5

Open in a new tab

Effect of poultry house environments on geese laying floor eggs. (A) Schematic diagram of 3 housing systems of the large-group (n = 720), small-population (n = 90), and family (n = 240) in Yangzhou goose. (B) The proportion of floor eggs laid by female geese of the dual-purpose line in 3 housing systems facing south were recorded in 8 wk at the early stage of the laying cycle by daily observation. (C) Schematic diagram of the orientation of goose house, facing south or north. (D) The proportion of floor eggs laid by female geese of the dual-purpose line in the family housing systems with 2 location orientations were recorded in 8 wk at the early stage of the laying cycle by daily observation. N = 240. Different letters represent significant variances.

Morphological Structure of Reproductive-Related Tissues in Geese Laying Floor Eggs

The morphology and structure (filling degree, glossiness, integrity, etc.) of the ovary, fallopian tube, and uterus of geese laying floor eggs or nest eggs were generally similar (Figure 6A). In detail, F1–F5 hierarchical follicles were present on ovaries, containing full-filling and brightly colored; there were no significant differences in length in the fallopian tubes; and the uterus was regularly shaped and consistent in size. In addition, it was also found that there was no obvious structural damage or inflammation in the hypothalamus, pituitary, ovaries, and uterus by HE staining (Figure 6B).

Figure 6.

Figure 6

Open in a new tab

Phenotypes and histomorphology of reproductive organs related to hypothalamic-pituitary-gonadal (HPG) axis in geese laying floor eggs. (A) Morphology of reproductive tracts of ovaries and uterine tubes. (B) Histomorphology of reproductive tissues of hypothalamus, pituitary, ovaries, and uterus. The scale is 400 μm.

Serum Physiological Hormone Levels and Expressions of Genes Related to Reproduction in Different Reproductive Tissues of Geese Laying Floor Eggs

Hormones play a crucial role in egg production, while their effect on floor eggs remains unknown. Compared with geese laying nest eggs, the serum hormone levels of GnRH, FSH, P4, and PRL in geese laying floor eggs significantly decreased (P < 0.05), whereas there were no significant changes in the hormone levels of LH and E2 (Figure 7A).

Figure 7.

Figure 7

Open in a new tab

Changes in serum hormone levels and gene expressions related to the hypothalamic-pituitary-gonadal (HPG) axis in geese laying floor eggs. (A) Serum hormone levels of contain gonadotropin-releasing hormone (GnRH), follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), progesterone (P4), and prolactin (PRL) were detected by ELISA. (B) Genes expressions containing GnRH, FSH-β, LH, and ESR2 in relevant tissues were detected by RT-qPCR. N = 6. Different letters represent significant variances.

Compared with geese laying nest eggs, the expression of the GnRH gene in the hypothalamus of geese laying floor eggs showed no change. However, the expression of the FSH-β gene in the pituitary was significantly down-regulated (P < 0.05), while the expression of the LH gene remained unchanged. In addition, the expression of the ESR2 gene in the ovaries was significantly up-regulated (P < 0.05; Figure 7B).

Expressions of Genes Related to Maternal Behavior in Different Reproductive Tissues of Geese Laying Floor Eggs

In addition, the expression of the PGR gene in the hypothalamus and uterus was significantly up-regulated (P < 0.05), while significantly down-regulated in ovaries (P < 0.05), but there was no significant change in the pituitary. The expression of the OXTR gene was significantly up-regulated in the hypothalamus and uterus (P < 0.05) but significantly down-regulated in the pituitary and ovaries (P < 0.05). The expression of the corticotropin-releasing hormone (CRH) gene was significantly down-regulated only in ovaries (P < 0.05), and there was no significant change in other tissues. The expression of the DRD2 gene was significantly down-regulated in the hypothalamus and ovaries (P < 0.05), and there was no significant change in other tissues (Figure 8).

Figure 8.

Figure 8

Open in a new tab

Changes in maternal gene expressions related to hypothalamic-pituitary-gonadal (HPG) axis in geese laying floor eggs. Maternal gene expressions containing progesterone receptor (PGR), oxytocin receptor (OXTR), corticotropin-releasing hormone (CRH), and dopamine receptor D2 (DRD2) in relevant tissues were detected by RT-qPCR. N = 6. Different letters represent significant variances.

Effects of Adding Decoy Eggs or Padding on Floor Laying in Geese

Discovering and implementing effective methods to control floor eggs is the key to solving problems in poultry production. In the early stage of laying, adding decoy eggs to the nest box effectively reduced the occurrence of floor eggs in geese (P < 0.05; Figure 9). However, no significant improvement was observed by adding padding (Figure 9).

Figure 9.

Figure 9

Open in a new tab

Mitigating effects of adding decoy eggs or padding to the nest box on geese laying floor eggs. (A) Schematic diagram of mitigation measures of adding a single decoy egg or 3 cm thick padding to the nest box. (B) The proportion of floor eggs laid by female geese of the dual-purpose line in the family housing system facing south in 8 wk at the early stage of the laying cycle through 2 mitigation measures were recorded by daily observation. N = 72. Different letters represent significant variances.

DISCUSSION

Floor eggs, laid outside the nest by poultry in non-cage systems, are influenced by various factors such as individual preference, genetics, environment, and rearing management. As a result, geese frequently lay floor eggs during floor rearing, the predominant way in current goose production (Campbell, 2023). Floor laying causes a variety of negative effects on manual egg collection efficiency, qualification rate, hatching rate, egg contamination and disease transmission, and individual egg production records, as well as animal welfare. In poultry production, there is a lack of effective measures or methods to control or solve the problem of floor laying (Hulzebosch, 2006; van den Oever et al., 2021). Although some studies have proposed a novel method of robotic pick-up of eggs, it requires high investment and has not yet been applied on a large scale in production (Li et al., 2022; Zhang et al., 2023). In addition, the key triggering factors and physiological basis for floor laying in poultry, especially in geese, remain unclear. Compared with chickens and ducks, geese exhibit lower annual egg production, magnifying the adverse effects of floor eggs with fewer relevant studies. Therefore, effectively controlling the occurrence of floor eggs has become a challenging issue in the rearing and management of goose breeders during the laying cycle.

This study revealed distinct time and location preferences in geese for laying floor eggs. Geese exhibited a higher production of floor eggs during the daily time periods of 2 to 5 am and 8 to 12 am. The peak of daily egg laying was concentrated in the morning (Bao et al., 2022), which resulted in competition among laying geese for centralized use of nest boxes, causing a relative shortage of nest boxes, and ultimately the occurrence of floor eggs (Barrett et al., 2019; Campbell, 2023). Interestingly, the proportion of floor eggs decreased significantly from the early stage to the peak stage and then increased significantly from the peak stage to the later stage throughout the laying cycle in geese. Geese switching from the non-laid stage to the early stage were prone to laying floor eggs due to changes in physiology, experience, and environmental stress, which was consistent with other birds (Makagon and Mench, 2011; Bari et al., 2020; Campbell, 2023). Although increased egg production exacerbated the competition of nest use, physiological and environmental adaptation, and enhanced maternal experience ameliorated floor laying of geese in the peak stage to some extent (Riber, 2010; Campbell, 2023). However, there was a similar aggravation of floor laying in geese in the later stage. This suggests that providing good pre-laying aids (i.e., training or induction of older laying geese) and a comfortable laying environment (e.g., the addition of decoy eggs or padding) before the early stage of the laying cycle is critical to reducing floor laying throughout the whole laying cycle (Campbell, 2023). In terms of location preference, the trough was the location where geese laid the most floor eggs, due to the comfortable environment of covering with feed and the high frequency of foraging behavior accompanied by laying behavior. A previous study suggested that feed restriction was beneficial in reducing the conflicts between eating and nesting behavior during the laying cycle (Appleby, 1984). Floor laying around the nest box is attributed to hierarchy or failure in competition for nest use (Freire et al., 1998; Makagon and Mench, 2011; Barrett et al., 2019). Higher percentages of floor eggs in low-lying areas result from advantageous features such as low topography, effective concealment, and enhanced comfort, contributing to the development of nesting, laying, and incubating behaviors of geese and improved animal welfare (Hemsworth and Edwards, 2020). Notably, the absence of floor eggs in water aligns with the instinctive maternal care of geese to safeguard their offspring.

Different housing systems affect the laying preferences and behaviors of geese, associated with floor laying. The present study revealed that geese reared in family housing systems exhibited the highest proportion of floor eggs, followed by those in large-group and small-population housing systems. Despite the limited number of family geese, the abundance of compartments fostered some highly concealed corners for floor laying. The fewest corners in large-group housing systems but the highest geese population led to serious competition and hierarchy, resulting in increased floor eggs. Geese in small-population housing systems shared fewer corners and fights, exhibiting the lowest proportion of floor eggs. Aviary orientation affects light and temperature, especially for seasonal laying geese. Compared with the south-facing house, the north-facing house obstructed sunlight, formed shorter photoperiods, and maintained a small temperature difference, increasing concealment, environmental comfort, and floor laying (Farghly et al., 2019).

Egg-laying performance and floor-laying vary in poultry based on genetic factors. Broiler breeder hens tend to lay more floor eggs than commercial egg layers (Purdum et al., 2020). In hens, brown strains are heavier than white strains, which contributes to a higher incidence of floor laying (Villanueva et al., 2017; Farkas et al., 2022). In this study, a gradual decrease in the proportion of floor eggs was observed from the fast-growing line to the dual-purpose line and then to the high-yielding line, which indicated a correlation between genetic lines and floor laying in geese. In addition, Genetic selection appears to enhance egg-laying performance and maternal factors in high-yield geese, thus reducing floor laying.

Differences exist in the behaviors of floor laying and nest laying in poultry. Floor-laying Pekin ducks in commercial farms sat more, walked less, and engaged in less aggression than nest-laying ducks, without nest-seeking (Barrett et al., 2019). Compared with nest laying, floor laying in geese is an undesirable maternal behavior, regulated by hormone secretion and maternal genes, with limited studies. In this study, the morphology and structure of various reproductive tissues in geese laying nest eggs and floor eggs were similar in a healthy physiological state. Compared with nest-laying geese, serum GnRH, FSH, P4, and PRL hormone levels as well as FSH-β gene expression were significantly decreased in floor-laying geese, suggesting fluctuations in endocrine regulation. However, the E2 hormone level remained unchanged with a compensatory elevation of ESR2 gene expression to maintain follicular development. Intriguingly, the decreased levels of P4 and PRL hormones heightened susceptibility to maternal behavior, elucidating the physiological basis for floor lay in geese. Parental animals keep high levels of P4 hormone for most of gestation, maintaining the threshold for activating the maternal behavior regulation system (Bridges, 1975; Bridges, 2015). As delivery (or laying) approaches, P4 hormone levels decrease, sensitize the parental maternal behavioral regulatory system to the effects of E2 and PRL hormone levels by lowering the threshold, and prompt a sensitive response (Slotnick et al., 1973; Bridges, 2015). The P4 hormone acts through receptor-mediated ligand-dependent nuclear transcription factor or through conversion to iso-progesterone (Mani et al., 1997; Zwain and Yen, 1999). Herein, we observed a significant reduction in the expression of the PGR gene in the ovaries leading to the abnormal maternal behavior of floor laying. However, its expression was significantly increased in the hypothalamus and uterus, suggesting a compensatory mechanism or potentially other roles. In addition, the circulating level of PRL hormone is positively correlated with maternal behavior and motherhood (Bridges et al., 1985; Bridges, 2015). The gene expression of OXTR, the receptor of PRL, was reduced in the pituitary and ovaries while compensatory increased in the hypothalamus and uterus, leading to floor laying in geese, similar to observations in mice with defective maternal care (Takayanagi et al., 2005; Bridges, 2015). Elevated circulating levels of the CRH hormone serve as a delivery trigger, and the CRH gene acts as a marker determining the duration of pregnancy and delivery (Bridges, 2015; Bridges, 2020). The substantial reduction in CRH gene expression in ovaries contributes to the occurrence of floor eggs in geese. DA, the most systematically studied neurotransmitter in maternal care in animals, is involved in the development and maintenance of maternal behavior (Hansen et al., 1991). Blockade of DA receptors impairs maternal behavior, which was observed in the hypothalamus and ovaries of geese laying floor eggs (Silva et al., 2001; Pereira and Ferreira, 2006). Overall, the decreases in endocrine hormone levels (P4 and PRL), as well as the down-regulation of maternal genes (PGR, OXTR, CRH, and DRD2) in the ovaries induced abnormal maternal behavior (undesirable floor laying) in geese. However, the up-regulation of these genes in the hypothalamus and uterus suggested potential roles that required further investigation.

Nest boxes serve as positive stimuli for poultry laying eggs, and the construction, decoration, and box environment influence the occurrence of floor eggs (Appleby and McRae, 1986; Wang et al., 2019). Studies have shown that decoy eggs (an egg mimicry model) and padding are physical measures to improve comfort, attractiveness, and laying behaviors, inducing nest laying in poultry (Appleby et al., 1988; Makagon et al., 2011; Barrett et al., 2019). In this study, we found a significant reduction in the occurrence of floor eggs with the addition of decoy eggs at the early stage of the laying cycle. This suggested that decoy eggs could mimic real eggs, alleviate anxiety or abnormal behaviors, and attract nest laying of primiparous female geese. However, the padding failed to enhance the comfort of nest laying due to inappropriate thickness or environmental stress, thus not mitigating the occurrence of floor eggs. Some studies have proposed the use of robotic systems to pick up floor eggs in time, thereby reducing breakage rates and contamination levels without compromising egg production performance or animal welfare (Vroegindeweij et al., 2014; Li et al., 2022; Zhang et al., 2023). However, these applications face limitations as they do not substantially reduce the overall number of floor eggs, and their implementation costs are considerable. In addition to genetic selection and improved management measures, seeking biological agents is a promising approach. These methods aim to optimize the physiological hormone levels and laying regulatory mechanisms in geese laying floor eggs, thus regulating the physiological basis and reducing the occurrence of floor eggs at the source.

CONCLUSIONS

In summary, geese exhibit time and location preferences in floor laying, and floor laying is influenced by genetic lines and housing systems with decreased endocrine hormone levels and maternal gene expressions. This phenomenon is mitigated by a practical and cost-effective approach of adding decoy eggs to the nest box. These findings provide valuable scientific information on patterns, genetic and environmental influences, and physiological indexes of floor eggs, contributing to effective control of floor laying in goose breeders' production.

ACKNOWLEDGMENTS

This work was supported by the Postgraduate Research & Practice Innovation Program of Jiangsu Province (grant number KYCX22_3529), the Modern Agro-industry Technology Research System (grant number CARS-42-3), the “JBGS” Project of Seed Industry Revitalization in Jiangsu Province (grant number JBGS[2021]023), and Key and General Projects of Modern Agriculture in Jiangsu Province (grant number BE2022350).

DISCLOSURES

The authors declare no conflict of interest.

REFERENCES

  1. Appleby M.C. Factors affecting floor laying by domestic hens: a review. World's. Poult. Sci. J. 1984;40:241–249. [Google Scholar]
  2. Appleby M.C., Hogarth G.S., Hughes B.O. Nest box design and nesting material in a deep litter house for laying hens. Br. Poult. Sci. 1988;29:215–222. [Google Scholar]
  3. Appleby M.C., McRae H.E. The individual nest box as a super-stimulus for domestic hens. Appl. Anim. Behav. Sci. 1986;15:169–176. [Google Scholar]
  4. Baker R.C., Qureshi R.A., Sandhu T.S., Timoney J.F. The frequency of salmonellae on duck eggs. Poult. Sci. 1985;64:646–652. doi: 10.3382/ps.0640646. [DOI] [PubMed] [Google Scholar]
  5. Bao Q., Yao Y., Weng K., Zheng M., Zhang Y., Zhang Y., Chen G., Xu Q. Research note: comparison on laying behavior and clutch traits among Zhedong white geese (Anser cygnoides), Sichuan white geese (Anser cygnoides), and Hungarian geese (Anser anser) Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bari M.S., Cohen-Barnhouse A.M., Campbell D.L.M. Early rearing enrichments influenced nest use and egg quality in free-range laying hens. Animal. 2020;14:1249–1257. doi: 10.1017/S1751731119003094. [DOI] [PubMed] [Google Scholar]
  7. Barrett L., Malecki I., Blache D. Differences in pre-laying behavior between floor-laying and nest-laying Pekin ducks. Animals. 2019;9:40. doi: 10.3390/ani9020040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Becot L., Bedere N., Burlot T., Coton J., Roy P.L.e. Nest acceptance, clutch, and oviposition traits are promising selection criteria to improve egg production in cage-free system. PLoS One. 2021;16 doi: 10.1371/journal.pone.0251037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bécot L., Bédère N., Coton J., Burlot T., Roy P.L.e. Nest preference and laying duration traits to select against floor eggs in laying hens. Genet. Sel. Evol. 2023;55:8. doi: 10.1186/s12711-023-00780-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bridges R.S. Long-term effects of pregnancy and parturition upon maternal responsiveness in the rat. Physiol. Behav. 1975;14:245–249. doi: 10.1016/0031-9384(75)90028-1. [DOI] [PubMed] [Google Scholar]
  11. Bridges R.S. Neuroendocrine regulation of maternal behavior. Front. Neuroendocrinol. 2015;36:178–196. doi: 10.1016/j.yfrne.2014.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bridges R.S. The behavioral neuroendocrinology of maternal behavior: past accomplishments and future directions. Horm. Behav. 2020;120 doi: 10.1016/j.yhbeh.2019.104662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Bridges R.S., DiBiase R., Loundes D.D., Doherty P.C. Prolactin stimulation of maternal behavior in female rats. Science. 1985;227:782–784. doi: 10.1126/science.3969568. [DOI] [PubMed] [Google Scholar]
  14. Campbell D.L.M. Floor egg laying: can management investment can prevent it? J. Appl. Poult. Res. 2023;32 [Google Scholar]
  15. Deacon R.M.J. Assessing nest building in mice. Nat. Protoc. 2006;1:1117–1119. doi: 10.1038/nprot.2006.170. [DOI] [PubMed] [Google Scholar]
  16. Farghly M.F.A., Mahrose K.M., Rehman Z.U., Yu S., Abdelfattah M.G., El-Garhy O.H. Intermittent lighting regime as a tool to enhance egg production and eggshell thickness in Rhode Island Red laying hens. Poult. Sci. 2019;98:2459–2465. doi: 10.3382/ps/pez021. [DOI] [PubMed] [Google Scholar]
  17. Farkas T.P., Szász S., Orbán A., Mezőszentgyörgyi D., Pető L., Sütő Z. Examination of nesting behavior of laying hens of different genotypes housed in indoor alternative pens using a video system. Appl. Sci. 2022;12:9093. [Google Scholar]
  18. Freire R., Appleby M.C., Hughes B.O. Effects of social interactions on pre-laying behaviour in hens. Appl. Anim. Behav. Sci. 1998;56:47–57. [Google Scholar]
  19. González-Mariscal G., Gallegos J.A. The maintenance and termination of maternal behavior in rabbits: involvement of suckling and progesterone. Physiol. Behav. 2014;124:72–76. doi: 10.1016/j.physbeh.2013.10.031. [DOI] [PubMed] [Google Scholar]
  20. Hansen S., Harthon C., Wallin E., Löfberg L., Svensson K. The effects of 6-OHDA-induced dopamine depletions in the ventral or dorsal striatum on maternal and sexual behavior in the female rat. Pharmacol. Biochem. Behav. 1991;39:71–77. doi: 10.1016/0091-3057(91)90399-m. [DOI] [PubMed] [Google Scholar]
  21. Hemsworth P.H., Edwards L.E. Natural behaviours, their drivers and their implications for laying hen welfare. Anim. Prod. Sci. 2020;61:915–930. [Google Scholar]
  22. Hulzebosch J. How to reduce the number of floor eggs. World Poultry. 2006;22:26–28. [Google Scholar]
  23. Jirkof P. Burrowing and nest building behavior as indicators of well-being in mice. J. Neurosci. Methods. 2014;234:139–146. doi: 10.1016/j.jneumeth.2014.02.001. [DOI] [PubMed] [Google Scholar]
  24. Kinsley C.H., Amory-Meyer E. Why the maternal brain? J. Neuroendocrinol. 2011;23:974–983. doi: 10.1111/j.1365-2826.2011.02194.x. [DOI] [PubMed] [Google Scholar]
  25. Li G., Hui X., Zhao Y., Zhai W., Purswell J.L., Porter Z., Poudel S., Jia L., Zhang B., Chesser G.D. Effects of ground robot manipulation on hen floor egg reduction, production performance, stress response, bone quality, and behavior. PLoS One. 2022;17 doi: 10.1371/journal.pone.0267568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Makagon M.M., Mench J.A. Floor laying by Pekin ducks: effects of nest box ratio and design. Poult. Sci. 2011;90:1179–1184. doi: 10.3382/ps.2010-01287. [DOI] [PubMed] [Google Scholar]
  27. Makagon M.M., Tucker C.B., Mench J.A. Factors affecting nest choice by Pekin ducks. Appl. Anim. Behav. Sci. 2011;129:121–128. [Google Scholar]
  28. Mani S.K., Blaustein J.D., O'malley B.W. Progesterone receptor function from a behavioral perspective. Horm. Behav. 1997;31:244–255. doi: 10.1006/hbeh.1997.1393. [DOI] [PubMed] [Google Scholar]
  29. McGibbon H.W. Floor laying—a heritable and environmentally influenced trait of the domestic fowl. Poult. Sci. 1976;55:765–771. [Google Scholar]
  30. Oliveira J.L., Xin H., Chai L., Millman S.T. Effects of litter floor access and inclusion of experienced hens in aviary housing on floor eggs, litter condition, air quality, and hen welfare. Poult. Sci. 2019;98:1664–1677. doi: 10.3382/ps/pey525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pereira M., Ferreira A. Demanding pups improve maternal behavioral impairments in sensitized and haloperidol-treated lactating female rats. Behav. Brain Res. 2006;175:139–148. doi: 10.1016/j.bbr.2006.08.013. [DOI] [PubMed] [Google Scholar]
  32. Purdum S., Eusebio P., Hanford K. The effects of 2 genetic lines on spatial distribution and use and preference of perch and nest area in an aviary system. Poult. Sci. 2020;99:3328–3333. doi: 10.1016/j.psj.2020.03.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Riber A.B. Development with age of nest box use and gregarious nesting in laying hens. Appl. Anim. Behav. Sci. 2010;123:24–31. [Google Scholar]
  34. Silva M.R., Bernardi M.M., Felicio L.F. Effects of dopamine receptor antagonists on ongoing maternal behavior in rats. Pharmacol. Biochem. Behav. 2001;68:461–468. doi: 10.1016/s0091-3057(01)00471-3. [DOI] [PubMed] [Google Scholar]
  35. Slotnick B.M., Carpenter M.L., Fusco R. Initiation of maternal behavior in pregnant nulliparous rats. Horm. Behav. 1973;4:53–59. [Google Scholar]
  36. Sørensen P., Okeno T., Buitenhuis A.J. The motivation of hens to lay eggs on the floor in non-cage systems has a heritable background. Eur. Poult. Sci. 2017;81:1–12. [Google Scholar]
  37. Takayanagi Y., Yoshida M., Bielsky I.F., Ross H.E., Kawamata M., Onaka T., Yanagisawa T., Kimura T., Matzuk M.M., Young L.J. Pervasive social deficits, but normal parturition, in oxytocin receptor-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 2005;102:16096–16101. doi: 10.1073/pnas.0505312102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. van den Oever A.C.M., Bolhuis J.E., van de Ven L.J.F., Kemp B., Rodenburg T.B. High levels of contact dermatitis and decreased mobility in broiler breeders, but neither have a relationship with floor eggs. Poult. Sci. 2020;99:3355–3362. doi: 10.1016/j.psj.2020.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. van den Oever A.C.M., Candelotto L., Kemp B., Rodenburg T.B., Bolhuis J.E., Graat E.A.M., van de Ven L.J.F., Guggisberg D., Toscano M.J. Influence of a raised slatted area in front of the nest on leg health, mating behaviour and floor eggs in broiler breeders. Animal. 2021;15 doi: 10.1016/j.animal.2020.100109. [DOI] [PubMed] [Google Scholar]
  40. Villanueva S., Ali A.B.A., Campbell D.L.M., Siegford J.M. Nest use and patterns of egg laying and damage by 4 strains of laying hens in an aviary system. Poult. Sci. 2017;96:3011–3020. doi: 10.3382/ps/pex104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Vroegindeweij B.A., van Willigenburg G.L., Koerkamp P.W.G.G., van Henten E.J. Path planning for the autonomous collection of eggs on floors. Biosyst. Eng. 2014;121:186–199. [Google Scholar]
  42. Wang C.M., Lien C.Y., Wang S.D., Lin M.J., Hsiao C.C., Lin T.Y. The effect of the nest type on the nest egg ratio of the white Roman geese. J. Taiwan Lives. Res. 2019;52:45–50. [Google Scholar]
  43. Wolc A., Settar P., Fulton J.E., Arango J., Rowland K., Lubritz D., Dekkers J.C.M. Heritability of perching behavior and its genetic relationship with incidence of floor eggs in Rhode Island Red chickens. Genet. Sel. Evol. 2021;53:38. doi: 10.1186/s12711-021-00630-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhang Y., Ge Y., Guo Y., Miao H., Zhang S. An approach for goose egg recognition for robot picking based on deep learning. Br. Poult. Sci. 2023;64:343–356. doi: 10.1080/00071668.2023.2171769. [DOI] [PubMed] [Google Scholar]
  45. Zwain I.H., Yen S.S. Neurosteroidogenesis in astrocytes, oligodendrocytes, and neurons of cerebral cortex of rat brain. Endocrinology. 1999;140:3843–3852. doi: 10.1210/endo.140.8.6907. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES