Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2023 Dec 9;103(3):103344. doi: 10.1016/j.psj.2023.103344

CRISPR-Cas9-mediated chicken prmt5 gene knockout and its critical role in interferon regulation

Qinghua Zeng ⁎,1, Jingjing Cao †,1, Fei Xie ‡, Lina Zhu ‡, Xiangdong Wu ⁎, Xifeng Hu ⁎, Zheng Chen ⁎, Xiaoqing Chen ⁎, Xiangzhi Li †, Cheng-Ming Chiang §,#,‖, Huansheng Wu ⁎,2
PMCID: PMC10840345  PMID: 38277892

Abstract

Protein arginine methyltransferase 5 (PRMT5), a type II arginine methyltransferase, controls arginine dimethylation of a variety of substrates. While many papers have reported the function of mammalian PRMT5, it remains unclear how PRMT5 functions in chicken cells. In this study, we found that chicken (ch) PRMT5 is widely expressed in a variety of chicken tissues and is distributed in both the cytoplasm and the nucleus. Ectopic expression of chPRMT5 significantly suppresses chIFN-β activation induced by chMDA5. In addition, a prmt5 gene-deficient DF-1 cell line was constructed using CRISPR/Cas9. In comparison with the wild-type cells, the prmt5−/− DF-1 cells displays normal morphology and maintain proliferative capacity. Luciferase reporter assay and overexpression showed that prmt5−/− DF-1 cells had increased IFN-β production. With identified chicken PRMT5 and CRISPR/Cas9 knockout performed in DF-1 cells, we uncovered a functional link of chPRMT5 in suppression of IFN-β production and interferon-stimulated gene expression.

Key words: chicken PRMT5, knockout, IFN-β response, CRISPR-Cas9

INTRODUCTION

The innate immune system plays a critical role in defending hosts against bacterial and viral infection by detecting various pathogen-associated molecular patterns (PAMPs) in living hosts and cells (Kawai et al., 2005). Pattern-recognition receptors (PRRs) which detect viral nucleic acids and subsequently activate the production of type-I interferon (IFN-I) are crucial for initiating antiviral immune responses (Kato et al., 2006). For instance, double-stranded RNA (dsRNA) could be recognized by toll-like receptors (TLRs) (Wang et al., 2021), which transduce different signals to activate TBK1 and IRF3, leading to IFN-I production (Xu et al., 2005). Another PRR is RIG-I-like receptors (RLRs) that, activate TBK1-IRF3/7 and NF-κB to produce IFN-I and proinflammatory cytokines through distinct adaptor proteins-dependent signaling cascades including MAVS and STING, respectively (Motwani et al., 2019; Zhu et al., 2021). As in mammals, the TBK1-IRF3 signaling pathway, is crucial for innate immune responses to defend against invasive infections in chicken (Seth et al., 2005). Besides, chicken and mammals have certain common or related immune response pathways (Lin et al., 2020). For instance, RNA virus infection can activate TBK1 to trigger IFN-I synthesis in both chicken and mammals (Cheng et al., 2018).

Considering the key role of TBK1 in integrating both the DNA-sensing and RNA-sensing pathways, understanding the mechanism of TBK1 regulation is important for controlling viral infection and immune homeostasis. Regulation of TBK1 activity includes phosphorylation, ubiquitination, acetylation, modulation of kinase activity, and functional TBK1-IRF3 complex formation (Zhao, 2013). Recent studies also showed arginine methylation in modulating TBK1-IRF3 signaling (Zhang et al., 2019; Yan et al., 2021).

In mammals, argine methyltransferases (PRMTs) transfer the methylation group from S-adenosylmethionine to the guanidine nitrogen of arginine (Wang et al., 2018; Mulvaney et al., 2021). Three types of PRMTs were identified according to the way they the transfer methyl group to specific guanidino nitrogen atoms of arginine (Jarrold and Davies, 2019; Xu and Richard, 2021). Type I PRMTs (PRMT1, 3, 4/CARM1, 6, and 8) catalyze asymmetric dimethylarginines formation, in which 2 methyl molecules are attached to the same nitrogen atom. Type II PRMT, including PRMT5 and PRMT7, catalyze symmetric dimethylarginines formation, in which 2 methyl groups are added to different nitrogen atoms. Another class of PRMTs, including PRMT7, PRMT8, and PRMT9, drives the formation of monomethylarginine (Guccione and Richard, 2019). PRMTs are ubiquitously expressed in human tissues and implicated in multiple biological processes, including gene expression and pre-mRNA splicing, cancer development, immune cell development and inflammatory responses (Biggar and Li, 2015; Guccione and Richard, 2019). Recent studies indicated that PRMTs can act as coactivators of NF-κB to regulate inflammatory responses (Kim et al., 2016), and are also involved in the TBK1-IRF3 cascade to trigger the antiviral immune response. For instance, IFN-β production is inhibited by PRMT1 via arginine methylation of TBK1, while support of IFN-β production induced by the TLR4-IRF3 signaling pathway is dependent on the enzymatic activity of PRMT2 via arginine methylation of TLR4 (Wang et al., 2021; Yan et al., 2021). PRMT5 controls cGAS/STING and NLRC5 pathways as well as IFN-β production induced by DNA virus via targeting IFI16 (Kim et al., 2020). PRMT6 reduces the effectiveness of innate antiviral immunity via inhibiting the TBK1-IRF3 pathway (Zhang et al., 2019). PRMT7 regulates the synthesis of IFN-β by methylating MAVS at R52 (Zhu et al., 2021).

In chicken, PRMT1, PRMT4, PRMT5, and PRMT8 have recently been identified (Berberich et al., 2017; Wang et al., 2017; Hu et al., 2023a,b); however, PRMT2 and PRMT6 seem absent in chickens. As known, PRMT5 regulates the production of type I interferons (IFNs), impairing the host defenses against RNA/DNA virus infection in human (Cui et al., 2020), but the role of chicken PRMT5 in the innate immune response remains unclear. With genome-editing technology such as CRISPR/Cas9 (Gupta et al., 2019) that allows targeted gene knock-in and knock-out (Jakutis and Stainier, 2021), a targeting efficiency up to 80% that is significantly higher than ZFN and TALEN can be readily achieved (Banan, 2020). CRISPR/Cas9 has been widely used in human cells (Zhang et al., 2016), but has so far been rarely used in chicken cells. In this study, a prmt5-knockout DF-1 cell line, known as the C5 clone, was constructed utilizing CRISPR/Cas9, showing that this technique can be reliably used for editing the chicken genome. Using this cell line to examine the impact of prmt5 deletion on chMDA5-induced IFN-β production, we found that chPRMT5 plays a role in attenuating the antiviral immune response.

MATERIALS AND METHODS

Cell Culture

Dulbecco's modified Eagle's medium (DMEM; Gibco, Carlsbad, CA) containing 10% fetal bovine serum (FSP500; ExCell Bio, Uruguay) was used for culturing human embryonic kidney 293T cells, which were procured from the China Center for Type Culture Collection. Chicken fibroblast line DF-1 cells (IM-C027, IMMOCELL) were maintained in MEM (IM-204, IMMOCELL) contained with 10% FBS (IM-101-500, IMMOCELL). Both cell lines were cultured at 37°C and 5% CO2.

Antibodies and Reagents

Anti-FLAG mouse monoclonal antibody (H3663) was purchased from Sigma-Aldrich (St. Louis, MO). Mouse anti-Myc (M200212F), Anti-FLAG agarose (M20018), anti-β-actin (M20009F) monoclonal antibody and rabbit anti-PRMT5 (T55454) were purchased from Abmart (Shanghai, China). Horseradish peroxidase (HRP) labeled anti-mouse and anti-rabbit IgG antibodies were purchased from KPL (Milford, MA). Cell lysis buffer NP-40 (P0013F, 50 mM Tris-HCl [pH7.4], 150 mM NaCl, 1% NP-40) was used for Western blotting. Immunofluorescence secondary antibodies including fluorescein isothiocyanate (FITC)-labeled goat anti-mouse antibody (A0562), the dual luciferase reporter detection kit (RG027) and puromycin (ST551) were purchased from Beyotime (Shanghai, China). Exfect Transfection Reagent (T101-01/02) and T7 Endonuclease I Assay (T7E1) (EN303-01) were both purchased from Vazyme Biotechnology (Nanjing, China). SynScript III cDNA synthesis Mix (TSK322S) and 2 × TSINGKE Master qPCR Mix (TSE201) were purchased from TSINGKE Biotechnology (Beijing, China). The enhance chemiluminescence (ECL) reagent (34075) was purchased from Thermo Fisher (Waltham, MA).

Cloning and Sequence Analysis of chPRMT5

Total RNA was isolated from DF-1 cells using Trizol reagents (R0016, Beyotime, Shanghai, China) in accordance with the instructions. To amplify the complete coding sequence of chPRMT5 (NM 001396412.1), reverse transcription of 1 μg RNA was carried out in accordance with the ReverAid RT reverse transcription kit's instructions (K1691, Thermo Fisher, Waltham, MA). Specific PCR primers (Table 1) were designed for the PCR amplification of the complete coding sequence. The complete sequence of chPRMT5 was subsequently inserted into the pCMV-FLAG/Myc-N empty vector (Clontech, Mountain View, CA).

Table 1.

The primers used in this study.

Primers Sequences Amplicons Accession
chPRMT5F GCGAATTCGCATGGCGGCGGCTGGACCGGGCGCTG 1935 bp NM 001396412.1
chPRMT5R GCCTCGAGTCAGAGGCCGATGGTGTAGGAGCGG
PRMT5sg1 GGGAATCGGGTCGGATCCAT NM 001396412.1
PRMT5sg2 CGCTTCCGAGTTGCGCCTCA NM 001396412.1
PRMT5sgF GACACCATAAGACCCCCCAGAGGAC 430 bp NM 001396412.1
PRMT5sgR CCAAATCCTCCCTTTTCACCCCA
chIFNβ-F CCTCAACCAGATCCAGCATT 148 bp GU119897
chIFNβ-F GGATGAGGCTGTGAGAGGAG
chMx-1F GTTTCGGACATGGGGAGTAA 152 bp GQ390353.1
chMx-1R GCATACGATTTCTTCAACTTTGG
chPKRF TGCTTGACTGGAAAGGCTACT 150 bp NM 204487.3
chPKRR TCAGTCAAGAATAAACCATGTGTG
chGAPDHF CCCAGCAACATGAAATGGGCAGAT 155 bp NM 204305.2
chGAPDHR TGATAACACGCTTAGCACCACCCT
Open in a new tab

DNA Construction, Transfection and Drug Selection

Plasmids FLAG-chMDA5, FLAG-chMAVS, chIFN-β-luciferase (luci) were stored in our laboratory, and pRL-TK was purchased from Promega (Fitchburg, WI). The CRISPR program (crispr.tefor.net) was used to create 2 distinct sgRNA sequences targeting exon3 of chPRMT5, which were then inserted into the lentiCRISPRv2 vector (Addgene: 52961). Sanger sequencing was used to validate each recombinant plasmid. According to the instructions, Exfect Transfection Reagent was used to transfect the plasmids into the cells. DF-1 cells were grown in MEM with 2 μg/mL of puromycin for 7 d until no additional cell death occurring 48 h post of transfection. Selected cells were subjected to continuing culture, with genomic DNA extracted to determine the effectiveness of gene knock-out.

Dual Luciferase Reporter Assays

Reporter plasmids chIFN-β-luci and pRL-TK along with the relevant plasmids were transiently transfected into DF-1 cells grown in 12-well plates. The luciferase activity was measured by a dual reporter luciferase kit according to the manufacturer's protocol. At least 3 replicates were performed through each reporter assay.

Western Blot

Western blotting was performed as previously (Hu et al., 2022). Briefly, proteins were transferred to 0.45 μm nitrocellulose membranes (NC, GE Healthcare, Chicago, IL) after being separated by 8 or 12% SDS-PAGE. The blotted membranes were first incubated with the primary antibodies followed by incubation with goat anti-rabbit or goat anti-mouse antibody conjugated with HRP. A loading control was performed using the β-actin bands. Finally, the signals were scanned and quantified using AMERSH Amersham ImageQuant 800 (AI800) (GE Healthcare).

T7 Endonuclease I Assay

Mismatched DNA repair upon cleavage was detected with T7 endonuclease I (T7EI), which allowed for estimation of the knockout efficiency. DNA fragments containing the 2 target locations were amplified using the primers (Table 1) outside of exon3. The T7EI digestion assay was carried out in accordance with the established methods. T7E1-mixed buffer was briefly annealed at 95°C for 5 min, then touched down at a temperature reduction of 0.1°C/s. After that, T7E1 endonuclease was used to digest the PCR products for 30 min at 37°C. Further analysis of the digested fragments was performed using 1.5% agarose gel electrophoresis.

Single DF-1 Cell Culture and Knock Out Genomic DNA Sequencing

To create a single cell for identifying stable knock out cell lines, selected DF-1 cells were serially diluted in 96-well plates. Cells in individual wells were subjected to PCR after reaching confluency, and the products were inserted into a pMD18-T cloning vector for sequencing.

Reverse Transcription and Real-Time Quantitative Polymerase Chain Reaction

Total RNA was isolated from DF-1 cells by utilizing Trizol reagents in accordance with a prior publication (Hu et al., 2022). Then, using SynScript III cDNA Synthesis Mix, 1 μg of RNA was reversely transcribed in accordance with the manufacturer's instructions. Amplification was used to examine the frequency of target gene transcription, with expression of gapdh serving as an internal control. Quantitative polymerase chain reaction (qPCR) was carried out using 2 × TSINGKE Master qPCR mix (SYBR Green I) in the QuantStudio 7 Flex Real-time PCR Detection System (ABI7900, Applied Biosystems, CA). The Reverse transcription (RT)-qPCR primer sequences are listed in Table 1. The 20 μL PCR reaction mix contained: 2 μL of cDNA or control ddH2O, 10 μL of 2 × TSINGKE Master qPCR mix (SYBR Green I), 0.5 μL of each primer (10 μM). The amplification procedure was 95°C for 30 s, 40 cycles of 95°C for 5 s and 60°C for 1 min. The fluorescence signal was collected at the end of each cycle of the 60°C extension step. The 2−△△CT calculation was used to quantify the level of gene transcription.

CCK8 Assessment

Proliferation of DF-1 and DF-1-prmt5 knockout (KO) cells was evaluated by using the Cell Counting Kit-8 (CCK8) assay. Growing cells were individually added to a 96-well plate along with 20 μL of the CCK8 reagent. A 450 nm absorption wavelength was used to analyze the signals at 6, 12, 24, 48, and 72 h after seeding.

Confocal Scanning Microscopy

DF-1 cells in a confocal dish (Nest, China) were transfected with indicated plasmids (4 μg) for 24 h. The cells were then fixed with 4% paraformaldehyde for 10 min and penetrated with 0.2% Triton X-100 for 5 min at room temperature. The fixed cells were subsequently incubated with rabbit anti-Myc polyclonal antibodies for 2 h at room temperature. Next, the cells were stained with FITC-labeled goat anti-rabbit IgG for another 1 h at 37°C. The nucleus was then stained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Roche, 10236276001). Fluorescence signals were scanned using an Olympus laser scanning confocal microscopy (Olympus Corporation, Tokyo, Japan).

Statistical Analysis

Graphpad Prism 5.0 was used to evaluate the means ± standard deviations (SD) of each group's results. To establish whether there was a statistically significant difference between the 2 groups, a student t test was utilized. When P < 0.05, statistical significance was noted. The data presented were obtained from 3 independent replicates.

RESULTS

chPRMT5 Expression Analysis

To better elucidate the role of chPRMT5 in interferon-β (IFN-β) production, we first amplified the complete coding sequence (CDS) of chPRMT5 from DF-1 chicken fibroblast cells. The CDS of chPRMT5 includes 1,935 nucleotides that code for 644 amino acids. The predicted molecular mass is 70.84 kDa. Amino acid sequence alignments showed that chPRMT5 was highly different from the other species’ PRMT5, but the enzymatic core sequence, 379VLGAGRGPLVNA381 was identical to that of other species’ PRMT5, highlighting an evolutionarily conserved enzymatic activity (data not shown). To better examine the evolution of chPRMT5, a phylogenetic tree of chPRMT5 (Gallus) was created together with other species’ PRMT5. Surprisingly, we have not find duck or goose PRMT5 genomic information, which may has not been reported or even absent from their genomes. chPRMT5 was in a branch separated from PRMT5 in other species (data not shown), indicating that its function might not be similar to that of other PRMT5 in mammals. Expression of chPRMT5 in different tissues has not been clarified previously, and analysis of the mRNA levels of chPRMT5 in the current study revealed that chPRMT5 is widely distributed in many tissues, including heart, liver, spleen, lung, kidney, thymus, brain, and bursal of Fabricius (BF) as well as other organs. The level of chPRMT5 in pectoral was significant higher than that of in other organs (Figure 1). These findings demonstrate that chPRMT5 expression is not only found in immune system tissues but is also in nonimmune tissues, suggesting that chPRMT5 may have a variety of functions in addition to those that regulate the immune system.

Figure 1.

Figure 1

Open in a new tab

chPRMT5 expression analysis. Comparison of the relative amounts of chPRMT5 expression in various tissues of a healthy, 4-wk-old, 3 yellow chicken. Using RT-qPCR, the chicken gapdh gene was used as a reference to examine the expression of the chPRMT5 gene in various tissues. The mean and standard deviation (n = 6) of the analysis data were displayed. All the experiments were performed in 3 independent repeats. Ns: nonspecific; *, P < 0.05.

chPRMT5 Negatively Regulates IFN-β Production

By using an IFA staining experiment, we observed at the intracellular localization of chPRMT5, which was diffused distributed in both of cytoplasmic and nucleus (Figure 2A), suggesting that chPRMT5 shares the similar cellular localization with mammalian PRMT5. We analyzed exogenous expression of Myc-tagged chPRMT5 in human 293T or chicken DF-1 cells, and found that anti-Myc antibody was able to identify a particular band of 72 kDa in both cell types (Figure 2B). Given human PRMT5 was shown to support IFI16 methylation that positively controls cGAS-STING-mediated IFN-β production (Kim et al., 2020), we decided to examine the function of chPRMT5 in IFN-β regulation. Several dual luciferase reporter experiments were performed in DF-1 cells to investigate the function of chPRMT5 in chMDA5-IFN-β regulation. Our data showed that chPRMT5 severely reduced ∼3-fold chMDA5-induced IFN-β promoter activation (Figure 2C). Moreover, chPRMT5 dramatically reduced ∼2-fold IFN-β promoter activation induced by chMAVS (Figure 2D). Overexpression of chPRMT5 significantly suppressed IFN-β gene transcription as determined by RT-qPCR (Figure 2E). Through cotransfection and immunoprecipitation, we found that chPRMT5 could efficiently interact with chMDA5 (Figure 2F). Our study thus suggests that chicken PRMT5 negatively regulates the MDA5/MAVS/IFN-β signaling pathway via interacting with chMDA5.

Figure 2.

Figure 2

Open in a new tab

chPRMT5 negatively regulates IFN-β production. (A) Myc-chPRMT5 was transfected into monolayer DF-1 cells grown in a confocal dish for 24 h. Transfected cells were then employed for indirect immunofluorescence staining. Green denotes a protein expression signal. The nucleus was stained with DAPI. The scale bar shows 10 μm. (B) Myc-chPRMT5 plasmid or an empty vector was transfected into 293T or DF-1 cells for 24 h. Western blotting was performed with transfected cell lysates using Myc antibodies. A loading control was performed with β-actin. (C and D) DF-1 cells were cotransfected with reporter plasmids chIFN-β-luci and pRL-TK and plasmids encoding chPRMT5 and chMDA5 (C) or chMAVS (D) for 36 h. With the use of a dual-luciferase reporter kit, the activity of the chIFN-β promoter was examined. Western blot analysis was performed with cell lysates using the recommended antibodies. A loading control was performed with β-actin. Data are means from 3 independent experiments. Mean ± SD, ***P < 0.001. (E) DF-1 cells were cotransfected with plasmids encoding chPRMT5 and chMDA5 for 36 h. RT-qPCR was used to analyze the IFN-β transcription level. A loading control was performed with β-actin. Data are means from 3 independent experiments. Mean ± SD, ***P < 0.001. (F) 293T cells were cotransfected with Myc-chPRMT5 and FLAG-tagged chMDA5 for 48 h. IP was performed with the lysates of transfected cells using anti-FLAG antibody-conjugated agarose beads. Western blot analysis was used to further evaluate IP fragments with the recommended antibodies. A loading control was performed with β-actin.

Design of chPRMT5 Knockout Strategy

According to bioinformatics analysis, the chicken Prmt5 gene is located on chromosome 5 and has 18 exons with 20,301 base pairs (Figure 3A). The 4 genes that make up the majority of chicken chromosome 5 are PSM65, LOC121108129, PRMT5, and OXA1L. Single guide RNA (sgRNA) was predicted to have a high score using the CRISPR software. Sequences in both exon1 and exon2 did not yield any suitable sgRNAs. In chicken PRMT5 exon3, 2 high-scoring reverse-direction sgRNAs were discovered (Table 1) and subsequently inserted into the lentiCRISPRv2 vector (Figure 3B, C).

Figure 3.

Figure 3

Open in a new tab

Method for knocking out of the prmt5 gene in DF-1 cells using CRISPR/Cas9 technique. (A) A schematic showing the location of the target site on the chicken PRMT5 gene. The sequence at exon 3 serves as the basis for the design of 2 target sites. (B) Diagram of the CRISPR-Cas9 vector utilized in this study. (C) Information of 2 sgRNA sequences predicted by CRISRP tool (crispr.tefor.net). (D) Sequencing data demonstrating the full connection of gRNA1 and gRNA2 to the lentiCRISPRv2 vector.

Construction of Prmt5 Gene Knockout in DF-1 Cells

Drug selective DF-1 cells were performed with CRISPR/Cas9 vector-transfected cells (pLentiCRISPR v2 empty vector as the negative control) (Figure 3C). Puromycin with 2 μg/mL were added to the growth media for 7 d for selecting positive clones and the untransfected-cells completely died after puromycin selection. The T7E1 assay showed that drug-selected DF-1 fibroblasts indeed contain insertion or deletion mutations at the prmt5 gene. In sgRNA1 and sgRNA2-transfected cells, the knockout efficiency was nearly 90% and less than 10%, respectively, according to the T7E1 digestion assay (Figure 4A, B). Thus, the sgRNA1-transfected cells were then utilized to construct a chicken prmt5 gene-deficient monoclonal cell line using the limiting dilution method. Seven clonal lines (A1/B3/B8/C5/D8/D11/E2) that had grown for 12 d were analyzed for endogenous PRMT5 expression. We found that endogenous PRMT5 expression in the C5 clone cells had completed disappeared when compared with the other clonal and WT cells (Figure 4C). Sequencing of the C5 clonal cells revealed a homozygous mutation with a 14-bp deletion near the protospacer adjacent motif (PAM) sequence, resulting in a frame shift (Figure 4D). Deletion of the chicken prmt5 gene persist after 10 passages of cell culture, as reflected by Western blotting (Figure 4E). There was no noticeable difference of the cell morphology between WT DF-1 and the C5 clonal DF-1 (Figure 4F), nor discernible differences in proliferation between WT and C5 clonal cells at different culturing times analyzed by the CCK8 assay (Figure 4G). These results indicate that knockout of PRMT5 had no effect on cell proliferation in DF-1 chicken cells, thus allowing the use of chPRMT5-knockout cells for further analysis.

Figure 4.

Figure 4

Open in a new tab

Construction of prmt5 gene knock-out DF-1 cells. (A) T7E1 assay was used to digest the PCR products of the target sites for sgRNA1 and sgRNA2. Following electrophoresis on a 1.5% agarose gel, the digested products were imaged using a Bio-Rad XR+ Imagelab (Bio-Rad, CA). (B) Cloning and sequencing analysis of the knockout effectiveness of chPRMT5 sgRNA1 and chPRMT5 sgRNA2. (C) Lysates of 8 monoclonal chPRMT5 knockout DF-1 cells and WT cells were analyzed by Western blotting using PRMT5 antibody. A loading control was included using β-actin. (D) Clones of chPRMT5 sgRNA1-chosen cells' PCR products were constructed in pMTD18T, and later sequenced. Sequences of knockout and wild-type genes were aligned, with results showing a homozygous mutant with a 14-bp deletion. (E) Cell lysates of WT DF-1 cells and passaged C5 clonal cells were subjected to Western blot analysis using PRMT5 antibody. β-actin was used as the loading control. (F) Morphologies of WT DF-1 cells and C5 clonal cells (chPrmt5 gene knockout cells) were imaged using a phase-contrast microscope (Nikon, Tokyo). The scar bar is 100 μm. (G) Proliferation of WT DF-1 cells and the C5 clonal cells is examined by CCK8 assay at different time points. Data are means from 3 independent experiments. Mean ± SD.

Knockout of chPRMT5 Enhances IFN-β Production

The C5 clonal cells were used to evaluate the role of chPRMT5 in innate immunity. We found that chMDA5 overexpression significantly increased IFN-β promoter activity in chPRMT5-deficient DF-1 cells, which was inhibited by ectopic expression of chPRMT5 (Figure 5A). Our data furtherly support the findings that chPRMT5 suppressed chMDA5-mediated IFN-β production. When transcription of IFN-β and IFN-related genes was examined in both DF-1 and C5 clonal cells, we found chMDA5-induced IFN-β mRNA levels were approximately 300-fold higher in prmt5-deleted C5 clonal cells than in the normal DF-1 cells. Ectopic expression of chPRMT5 dramatically reduced IFN-β transcript levels, confirming that the inhibitory effect of chPRMT5 on reducing IFN-β production (Figure 5B). Expression of IFN-β-stimulated genes Mx-1 and PKR, whose expression was controlled by IFN-I and induced by chMDA5, was drastically enhanced in prmt5-deleted C5 clonal cells, which again was further suppressed by ectopic expression of chPRMT5 (Figure 5C, D). Our results further demonstrated that chPRMT5 is crucial for inhibiting chMDA5-mediated IFN-β induction. Thus deletion of the chPRMT5 gene facilitates chMDA5-mediated IFN-β production.

Figure 5.

Figure 5

Open in a new tab

Knock out of prmt5 facilitates IFN-β generation. (A) chIFN-luci, and pRL-TK were cotransfected with chMDA5 or chPRMT5 vector, into DF-1 or C5 clonal cells. After cotransfection, luciferase analysis was conducted at 36 h post-transfection. With the use of a dual-luciferase reporter kit, the activity of the chIFN-β promoter was examined. Western blot analysis was performed with cell lysates using the indicated antibodies. A loading control was included using with β-actin. Data are means from 3 independent experiments. Mean ± SD, ***P < 0.001. (B–D) chMDA5 or ectopic expression of chPRMT5 in C5 clonal cells were cotransfected into DF-1 or C5 cells, respectively, 24 h after cotransfection, RT-qPCR was carried out to determine IFN-β (B), MX-1 (C), and PKR (D) transcript levels. Western blot analysis was performed with cell lysates using the indicated antibodies. β-actin was used as the loading control. Data are means from 3 independent experiments. Mean ± SD, ***P < 0.001.

DISCUSSION

RLR receptors in mammals, such as MDA5 and RIG-I, are crucial sensors of RNA virus infection (Wu et al., 2013). Additional viral RNA sensors in the nucleus, like hnRNPA2B1 and SAFA, have also been discovered (Franzoni et al., 2009; Wang et al., 2019; Liu et al., 2021). Because the RIG-I gene does not exist in chickens, RNA sensors in chickens are only mediated by MDA5 (Krchlíková et al., 2021). According to previous reports, chicken MDA5 has a comparable role to mammalian MDA5 in detecting RNA viral genomes and contributing to type I interferon signaling (Lin et al., 2020). However, how this chicken MDA5 system is regulated remains unclear.

In this study, we found that overexpression of PRMT5 negatively regulates IFN-β production. Whether this inhibition is dependents on methylation activity is not clear, since enzymatic activity of some mammals’ PRMTs is crucial for blocking IFN-β generation (Yan et al., 2021). Additionally, chicken Prmt5 gene knock-out DF-1 cells were subsequently constructed using the CRISPR/Cas9 technology. CRISPR/Cas9 is a cutting-edge gene-editing method that has been widely applied to human cells and numerous other animals (Tyagi et al., 2020). However, the use of CRISPR/Cas9 in chicken cells is still in its infancy. A low mutation efficiency is one obstacle to its utilization in chicken cells (Oishi et al., 2016; Ahn et al., 2017; Wang et al., 2017). In this study, using 2 different sgRNAs targeting exon 3 of chicken Prmt5 inserted into the lentiCRISPRv2 plasmid, we found the gene-editing rate of chPRMT5 sgRNA1 and sgRNA2 was about 90% and less than 10%, respectively. To our knowledge, CRISPR/Cas9 has never been introduced in this high efficiency in chicken cells. Based on previous reports, several genes, such as SQSTM1 knock out DF-1 cells have been constructed using CRISPR/Cas9 technology (Li et al., 2020), suggesting that this gene editing technology could be used for edit Gallus genome in cultured cells.

The DF-1 C5 clonal cell line has normal morphology and retains a consistent proliferation ability in comparison with the WT DF-1 cells, indicating that this clonal cell line can be employed for further research. Functional analysis revealed that in C5 clonal cells, chMDA5-induced IFN-β production was significantly higher compared to the WT cells. We confirmed that chPRMT5 regulates chMDA5-mediated IFN-β induction and interferon-stimulated gene transcription, independently of the enzymatic activity of chPRMT5. These data suggest that in chicken cells, chMDA5-mediated IFN-β production is significantly blocked by chPRMT5.

In conclusion, the CRISPR-Cas9 technique was successfully used to generate a chPRMT5-knockout DF-1 cell line with high efficiency. The prmt5-knockout chicken cells showed higher IFN-β production, supporting the finding that chPRMT5 is a suppressor of chMDA5-mediated IFN-β regulation. Our study illustrates a successful CRISPR/Cas9 in chicken cells and provides a cell model for molecular understanding of the chPRMT5 gene regulation.

ACKNOWLEDGMENTS

This work was supported by the Natural Science Foundation of Jiangxi Province (20232ACB205015) and National Natural Science Foundation of China (31900147). C.-M. C.’s research was supported by US National Institutes of Health grant 1RO1CA251698-01 and CPRIT grants RP180349 and RP190077.

Data Availability Statement: All data generated or analyzed during this study are included in this article. The datasets used and/or analyzed during the current study are available from the corresponding author.

Author Contributions: H. S. W. and J. J. C. conceived and designed the research; Q. H. Z., F. X., and L. N. Z. performed the experiments and analyzed the data; H. S. W. and J. J. C. wrote the manuscript; X. D. W., X. F. H., Z. C., X. Q. C., X. Z. L., and C. M. C. revised the manuscript critically. All authors read and approved the manuscript.

DISCLOSURES

The authors have no competing interests to declare.

REFERENCES

  1. Ahn J., Lee J., Park J.Y., Oh K.B., Hwang S., Lee C.-W., Lee K. Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system. Poult. Sci. 2017;96:1445–1450. doi: 10.3382/ps/pew435. [DOI] [PubMed] [Google Scholar]
  2. Banan M. Recent advances in CRISPR/Cas9-mediated knock-ins in mammalian cells. J. Biotechnol. 2020;308:1–9. doi: 10.1016/j.jbiotec.2019.11.010. [DOI] [PubMed] [Google Scholar]
  3. Berberich H., Terwesten F., Rakow S., Sahu P., Bouchard C., Meixner M., Philipsen S., Kolb P., Bauer U.M. Identification and in silico structural analysis of Gallus gallus protein arginine methyltransferase 4 (PRMT 4) FEBS Open Biol. 2017;7:1909–1923. doi: 10.1002/2211-5463.12323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Biggar K.K., Li S.S.-C. Non-histone protein methylation as a regulator of cellular signalling and function. Nat. Rev. Mol. Cell. Biol. 2015;16:5–17. doi: 10.1038/nrm3915. [DOI] [PubMed] [Google Scholar]
  5. Cheng Y., Lun M., Liu Y., Wang H., Yan Y., Sun J. CRISPR/Cas9-mediated chicken TBK1 gene knockout and its essential role in STING-mediated IFN-beta induction in chicken cells. Front Immunol. 2018;9:3010. doi: 10.3389/fimmu.2018.03010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cui S., Yu Q., Chu L., Cui Y., Ding M., Wang Q., Wang H., Chen Y., Liu X., Wang C. Nuclear cGAS functions non-canonically to enhance antiviral immunity via recruiting methyltransferase Prmt5. Cell Rep. 2020;33 doi: 10.1016/j.celrep.2020.108490. [DOI] [PubMed] [Google Scholar]
  7. Franzoni E., Monti M., Pellicciari A., Muratore C., Verrotti A., Garone C., Cecconi I., Iero L., Gualandi S., Savarino F. SAFA: a new measure to evaluate psychiatric symptoms detected in a sample of children and adolescents affected by eating disorders. Correlations with risk factors. Neuro Dis. Treat. 2009;5:207–214. doi: 10.2147/ndt.s4874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Guccione E., Richard S. The regulation, functions and clinical relevance of arginine methylation. Nat. Rev. Mol. Cell. Biol. 2019;20:642–657. doi: 10.1038/s41580-019-0155-x. [DOI] [PubMed] [Google Scholar]
  9. Gupta D., Bhattacharjee O., Mandal D., Sen M.K., Dey D., Dasgupta A., Kazi T.A., Gupta R., Sinharoy S., Acharya K. CRISPR-Cas9 system: a new-fangled dawn in gene editing. Life Sci. 2019;232 doi: 10.1016/j.lfs.2019.116636. [DOI] [PubMed] [Google Scholar]
  10. Hu X., Chen Z., Wu X., Fu Q., Chen Z., Huang Y., Wu H. PRMT5 facilitates infectious bursal disease virus replication through arginine methylation of VP1. J. Virol. 2023;97 doi: 10.1128/jvi.01637-22. e01637-01622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hu X., Wu X., Chen Z., Wu H. Chicken PRMT1 promotes infectious bursal disease virus replication via suppressing IFN-β production. Dev. Commun. Immunol. 2023;141 doi: 10.1016/j.dci.2022.104628. [DOI] [PubMed] [Google Scholar]
  12. Hu X., Wu X., Xue M., Chen Y., Zhou B., Wan T., You H., Wu H. Chicken TAX1BP1 suppresses type I interferon production via degrading chicken MAVS and facilitates infectious bursal diseases virus replication. Dev. Commun. Immunol. 2022;135 doi: 10.1016/j.dci.2022.104490. [DOI] [PubMed] [Google Scholar]
  13. Li Y., Hu B., Ji G., Zhang Y., Xu C., Lei J., Ding C., Zhou J. Cytoplasmic cargo receptor p62 inhibits avibirnavirus replication by mediating autophagic degradation of viral protein VP2. J. Virol. 2020;94:1–12. doi: 10.1128/JVI.01255-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jakutis G., Stainier D.Y. Genotype–phenotype relationships in the context of transcriptional adaptation and genetic robustness. Annu. Rev. Gene. 2021;55:71–91. doi: 10.1146/annurev-genet-071719-020342. [DOI] [PubMed] [Google Scholar]
  15. Jarrold J., Davies C.C. PRMTs and arginine methylation: cancer's best-kept secret? Trends Mol. Med. 2019;25:993–1009. doi: 10.1016/j.molmed.2019.05.007. [DOI] [PubMed] [Google Scholar]
  16. Kato H., Takeuchi O., Sato S., Yoneyama M., Yamamoto M., Matsui K., Uematsu S., Jung A., Kawai T., Ishii K.J. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. 2006;441:101–105. doi: 10.1038/nature04734. [DOI] [PubMed] [Google Scholar]
  17. Kawai T., Takahashi K., Sato S., Coban C., Kumar H., Kato H., Ishii K.J., Takeuchi O., Akira S. IPS-1, an adaptor triggering RIG-I-and Mda5-mediated type I interferon induction. Nat. Immunol. 2005;6:981–988. doi: 10.1038/ni1243. [DOI] [PubMed] [Google Scholar]
  18. Kim H., Kim H., Feng Y., Li Y., Tamiya H., Tocci S., Ronai Z.e.A. PRMT5 control of cGAS/STING and NLRC5 pathways defines melanoma response to antitumor immunity. Sci. Transl. Med. 2020;12:eaaz5683. doi: 10.1126/scitranslmed.aaz5683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim J.H., Yoo B.C., Yang W.S., Kim E., Hong S., Cho J.Y. The role of protein arginine methyltransferases in inflammatory responses. Med. Inflamm. 2016;2016 doi: 10.1155/2016/4028353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Krchlíková V., Hron T., Těšický M., Li T., Hejnar J., Vinkler M., Elleder D. Repeated MDA5 gene loss in birds: an evolutionary perspective. Viruses. 2021;13:2131. doi: 10.3390/v13112131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lin X., Yu S., Mao H., Ren P., Jin M. hnRNPH2 as an inhibitor of chicken MDA5-mediated type I interferon response: analysis using chicken MDA5–host interaction. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.541267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liu B.-y., Yu X.-j., Zhou C.-m. SAFA initiates innate immunity against cytoplasmic RNA virus SFTSV infection. PLoS Pathog. 2021;17 doi: 10.1371/journal.ppat.1010070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Motwani M., Pesiridis S., Fitzgerald K.A. DNA sensing by the cGAS–STING pathway in health and disease. Nat. Rev. Gene. 2019;20:657–674. doi: 10.1038/s41576-019-0151-1. [DOI] [PubMed] [Google Scholar]
  24. Mulvaney K.M., Blomquist C., Acharya N., Li R., Ranaghan M.J., O'Keefe M., Rodriguez D.J., Young M.J., Kesar D., Pal D. Molecular basis for substrate recruitment to the PRMT5 methylosome. Mol. Cell. 2021;81:3481–3495. doi: 10.1016/j.molcel.2021.07.019. e3487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Oishi I., Yoshii K., Miyahara D., Kagami H., Tagami T. Targeted mutagenesis in chicken using CRISPR/Cas9 system. Sci. Rep. 2016;6:23980. doi: 10.1038/srep23980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Seth R.B., Sun L., Ea C.-K., Chen Z.J. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-κB and IRF3. Cell. 2005;122:669–682. doi: 10.1016/j.cell.2005.08.012. [DOI] [PubMed] [Google Scholar]
  27. Tyagi S., Kumar R., Das A., Won S.Y., Shukla P. CRISPR-Cas9 system: a genome-editing tool with endless possibilities. J. Biotechnol. 2020;319:36–53. doi: 10.1016/j.jbiotec.2020.05.008. [DOI] [PubMed] [Google Scholar]
  28. Wang Y., Hu W., Yuan Y. Protein arginine methyltransferase 5 (PRMT5) as an anticancer target and its inhibitor discovery. J. Med. Chem. 2018;61:9429–9441. doi: 10.1021/acs.jmedchem.8b00598. [DOI] [PubMed] [Google Scholar]
  29. Wang J., Hua H., Wang F., Yang S., Zhou Q., Wu X., Feng D., Peng H. Arginine methylation by PRMT2 promotes IFN-β production through TLR4/IRF3 signaling pathway. Mol. Immunol. 2021;139:202–210. doi: 10.1016/j.molimm.2021.08.014. [DOI] [PubMed] [Google Scholar]
  30. Wang L., Wen M., Cao X. Nuclear hnRNPA2B1 initiates and amplifies the innate immune response to DNA viruses. Science. 2019;365 doi: 10.1126/science.aav0758. eaav0758. [DOI] [PubMed] [Google Scholar]
  31. Wang L., Yang L., Guo Y., Du W., Yin Y., Zhang T., Lu H. Enhancing targeted genomic DNA editing in chicken cells using the CRISPR/Cas9 system. PLoS One. 2017;12 doi: 10.1371/journal.pone.0169768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wu B., Peisley A., Richards C., Yao H., Zeng X., Lin C., Chu F., Walz T., Hur S. Structural basis for dsRNA recognition, filament formation, and antiviral signal activation by MDA5. Cell. 2013;152:276–289. doi: 10.1016/j.cell.2012.11.048. [DOI] [PubMed] [Google Scholar]
  33. Xu J., Richard S. Cellular pathways influenced by protein arginine methylation: implications for cancer. Mol. Cell. 2021;81:4357–4368. doi: 10.1016/j.molcel.2021.09.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xu L.-G., Wang Y.-Y., Han K.-J., Li L.-Y., Zhai Z., Shu H.-B. VISA is an adapter protein required for virus-triggered IFN-β signaling. Mol. Cell. 2005;19:727–740. doi: 10.1016/j.molcel.2005.08.014. [DOI] [PubMed] [Google Scholar]
  35. Yan Z., Wu H., Liu H., Zhao G., Zhang H., Zhuang W., Liu F., Zheng Y., Liu B., Zhang L. The protein arginine methyltransferase PRMT1 promotes TBK1 activation through asymmetric arginine methylation. Cell Rep. 2021;36 doi: 10.1016/j.celrep.2021.109731. [DOI] [PubMed] [Google Scholar]
  36. Zhang H., Han C., Li T., Li N., Cao X. The methyltransferase PRMT6 attenuates antiviral innate immunity by blocking TBK1–IRF3 signaling. Cell. Mol. Immunol. 2019;16:800–809. doi: 10.1038/s41423-018-0057-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang J.-H., Adikaram P., Pandey M., Genis A., Simonds W.F. Optimization of genome editing through CRISPR-Cas9 engineering. Bioengineering. 2016;7:166–174. doi: 10.1080/21655979.2016.1189039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhao W. Negative regulation of TBK1-mediated antiviral immunity. FEBS Lett. 2013;587:542–548. doi: 10.1016/j.febslet.2013.01.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhu J., Li X., Cai X., Zha H., Zhou Z., Sun X., Rong F., Tang J., Zhu C., Liu X. Arginine monomethylation by PRMT7 controls MAVS-mediated antiviral innate immunity. Mol. Cell. 2021;81:3171–3186. doi: 10.1016/j.molcel.2021.06.004. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES