FANCD2-dependent mitotic DNA synthesis relies on PCNA K164 ubiquitination

SUMMARY

Ubiquitination of proliferating cell nuclear antigen (PCNA) at lysine 164 (K164) activates DNA damage tolerance pathways. Currently, we lack a comprehensive understanding of how PCNA K164 ubiquitination promotes genome stability. To evaluate this, we generated stable cell lines expressing PCNA^K164R from the endogenous PCNA locus. Our data reveal that the inability to ubiquitinate K164 causes perturbations in global DNA replication. Persistent replication stress generates under-replicated regions and is exacerbated by the DNA polymerase inhibitor aphidicolin. We show that these phenotypes are due, in part, to impaired Fanconi anemia group D2 protein (FANCD2)-dependent mitotic DNA synthesis (MiDAS) in PCNA^K164R cells. FANCD2 mono-ubiquitination is significantly reduced in PCNA^K164R mutants, leading to reduced chromatin association and foci formation, both prerequisites for FANCD2-dependent MiDAS. Furthermore, K164 ubiquitination coordinates direct PCNA/FANCD2 colocalization in mitotic nuclei. Here, we show that PCNA K164 ubiquitination maintains human genome stability by promoting FANCD2-dependent MiDAS to prevent the accumulation of under-replicated DNA.

Graphical Abstract

In brief

Leung et al. show that FANCD2-dependent mitotic DNA synthesis (MiDAS) in non-transformed human cells relies on PCNA lysine 164 (K164) ubiquitination. Specifically, PCNA K164 ubiquitination promotes FANCD2 ubiquitination and recruitment to under-replicated regions and coordinates interactions in mitotic nuclei to promote MiDAS.

INTRODUCTION

Maintenance of genome integrity is an intricate process that requires an extended protein network and coordination of multiple cellular pathways.¹ Proper DNA replication is essential for genome maintenance and ensures precise duplication without leaving sequences under-replicated or replicated more than once. Endogenous and exogenous sources of DNA damage can impede DNA synthesis, stall replication forks, and generate aberrant fork structures that can give rise to chromosomal alterations.^2,3 In response to DNA lesions, proliferating cell nuclear antigen (PCNA) is ubiquitinated at the conserved lysine 164 (K164) residue, activating DNA damage tolerance (DDT) pathways.⁴ Mono-ubiquitination at K164 by the E3 ubiquitin ligase radiation sensitive 18 (RAD18) activates the translesion synthesis (TLS) DDT pathway.^5,6 TLS is catalyzed by specialized low-fidelity DNA polymerases to bypass DNA lesions and fill single-stranded DNA (ssDNA) gaps.⁷ Mono-ubiquitinated PCNA can be further modified by K63-linked poly-ubiquitin chains to activate the template-switching (TS) DDT pathway. TS utilizes a recombination-like mechanism by which the nascent DNA of the sister chromatid serves as a template for replication.⁸ Given the importance of PCNA K164 ubiquitination, it is not surprising that mutating this residue renders cells hypersensitive to DNA damage.^9-11 However, how this modification functions in maintaining human genome stability under unperturbed conditions is not understood.

Regions of the genome that are particularly reliant on DDT pathways include late-replicating or so-called “hard-to-replicate” loci, including common fragile sites (CFSs). Failure to complete DNA replication leads to the accumulation of late replication intermediates and under-replicated regions. As the cell cycle proceeds, these regions are marked by the formation of Fanconi anemia (FA) group D2 protein (FANCD2) foci.^12,13 If left unresolved, these aberrant structures can cause DNA bridges in anaphase and/or are sequestered into p53-binding protein 1 (53BP1) nuclear bodies (NBs) during the subsequent G1 phase. One mechanism to resolve these issues and to ensure proper chromosome segregation is mitotic DNA synthesis (MiDAS).^14,15 MiDAS utilizes a recombination-like mechanism similar to break-induced replication (BIR) to complete DNA synthesis at under-replicated loci in G2/M phase. Human cancer cells can utilize RAD52- or FANCD2-dependent MiDAS¹⁵; however, we demonstrated that in non-transformed (i.e., non-cancerous) human cells, the RAD52-dependent mechanism is absent, and instead, MiDAS relies on FANCD2.^16,17 Interestingly, a recent study found that PCNA K164 ubiquitination by RAD18 is required for MiDAS in cancer cell lines but did not investigate its necessity in non-transformed human cells.¹⁸

In this study, we demonstrate that PCNA K164 ubiquitination is critical for accurate DNA replication and genome stability in non-transformed human cells. Loss of PCNA K164 ubiquitination in human telomerase reverse transcriptase (hTERT) immortalized retinal pigment epithelium-1 (RPE-1) (referred to subsequently as RPE-1) cells disrupts global DNA replication, causing chronic replication stress. This leads to under-replicated regions that are transmitted to daughter cells and marked by 53BP1 NBs. The repair of these regions by MiDAS is compromised and is directly linked to decreased FANCD2 mono-ubiquitination and chromatin association. Finally, we show that K164 ubiquitination is required for PCNA/FANCD2 colocalization in mitotic nuclei. Taken together, our data show that PCNA ubiquitination at K164 is not only important for progressive S-phase DNA synthesis but promotes FANCD2-dependent MiDAS to ensure complete genome duplication prior to cell division.

RESULTS

Stable PCNA^K164R mutants are severely sensitive to lesion-induced DNA damage

Previous studies investigating the role of PCNA ubiquitination in human cells relied on ectopic expression of PCNA^K164R or PCNA-ubiquitin fusions in cells expressing wild-type PCNA, with or without knockdown of endogenous PCNA.^10,11,18 To understand the importance of PCNA K164 modification when stably expressed from the endogenous locus, we utilized CRISPR-Cas9-mediated gene targeting to knock in an A>G mutation in the codon for K164 of PCNA in RPE-1 cells (Figure S1A). PCR analyses identified mono- and biallelic targeting of PCNA (Figures S1B and S1C), and sequencing confirmed one homozygous PCNA^K164R (2B10) and two hemizygous PCNA^K164R/− (A1 and B1) clonal cell lines. Regardless of whether mutant cell lines carried one or two functional PCNA^K164R alleles, both total PCNA expression (Figure S1D) and the amount of chromatin-bound PCNA was comparable to wild type (Figure 1A). These observations demonstrate that a single PCNA^K164R allele is sufficient to maintain wild-type expression levels in RPE-1 cells. Finally, western blot analyses of PCNA ubiquitination after UV irradiation showed a dose-dependent increase in wild-type cells but not in the PCNA^K164R cell lines (Figure 1A), functionally validating these mutant cell lines.

Figure 1. PCNA^K164R mutant cell lines have increased sensitivity to DNA damage.

(A) Western blot analyses of chromatin-associated PCNA, ubiquityl-PCNA (K164), phospho-RPA32 (S33), and γH2AX, with or without 20 and 40 J/m² UV treatment, with histone H2AX as the loading control from wild-type RPE-1 and PCNA^K164R cells. Quantified band intensities were normalized to loading controls.

(B) Western blot analyses of whole-cell extracts from wild-type RPE-1 and PCNA^K164R cells for phospho-p53 (S15), p53, and p21, with or without 20 and 40 J/m² UV treatment, with GAPDH or tubulin as the loading control. Quantified intensities of phospho-p53 (S15), p53, and p21 levels were normalized to loading controls.

(C) Comparison of drug sensitivity comparing average percentage of viability in RPE-1 wild-type and PCNA^K164R cell lines. Each drug and concentration tested is indicated. Error bars indicate standard deviation, and statistical significance was calculated using Student’s t test with *p < 0.05, **p < 0.01, and ***p < 0.001; n = 9–12 replicate wells across three biological replicates for all data points.

(D) Representative cell-cycle distributions based on DNA content (DAPI) of RPE-1 wild-type and PCNA^K164R cell lines treated with MMC (20 nM) or MMS (20 μM) for 48 h.

(E) Cell-cycle distributions of RPE-1 wild-type and PCNA^K164R cell lines treated with MMC or MMS from three biological replicates. Percentage of each population in G1 (green), S (purple), or G2/M phase (gray) is shown. Error bars indicate standard deviation, and statistical significance was calculated using Student’s t test with *p < 0.05, **p <0.01, and ***p < 0.001; n = 6 replicate wells across three biological replicates. For wild type, statistics represent the comparison of each cell-cycle phase in drug-treated (MMC, MMS) versus untreated (UT) cell lines. For PCNA^K164R cell lines, statistics represent the comparison of each cell-cycle phase versus wild type within each treatment group (UT, MMC, MMS).

(F) Histogram (left, middle) and quantification of mean fluorescent intensity (right) of EdU staining of S-phase cells from RPE-1 wild-type (blue) and PCNA^K164R cells (maroon) treated with MMC and MMS; n = 6 across three biological replicates. Error bars indicate standard deviation, and significance was calculated using two-way ANOVA with *p < 0.05, **p < 0.01, and ***p < 0.001.

To understand the effects of stable expression of PCNA^K164R on the response to UV exposure, we examined phosphorylated replication protein A (pRPA32) at S33 and phosphorylated histone H2AX (γH2AX) at S139 as readouts for an ataxia telangiectasia and Rad3-related (ATR)-mediated replication stress response and DNA double-stranded breaks (DSBs), respectively. We found a dose-dependent increase in pRPA32 and γH2AX in all cell lines, with significantly elevated levels in the PCNA^K164R mutants (Figure 1A). Due to the observed increases in replication stress and DSB markers, we investigated the expression of p53, as well as its phosphorylated form, p-p53 (S15). Although both markers showed a modest increase in the untreated mutant cell lines, the p53 target p21 was not significantly activated (Figure 1B). These observations suggest that the inability to ubiquitinate K164 confers increased susceptibility to UV-induced replication stress but that endogenous DNA damage does not trigger a robust checkpoint response. Next, we wanted to characterize DNA damage resistance in stable PCNA^K164R cell lines in response to other DNA lesions. Utilizing luminescent cell viability assays, we observed that PCNA^K164R mutants were highly sensitive to methyl methanesulfonate (MMS), mitomycin C (MMC), and 4-nitroquinoline 1-oxide (4NQO) (Figure 1C). To assess the effects of MMC and MMS on the cell cycle, we utilized quantitative flow cytometry. We determined the cell-cycle distribution using DAPI staining for total DNA content in combination with a 30 min 5-ethynyl-2′-deoxyuridine (EdU) pulse to label S-phase cells. These analyses revealed a G2/M-phase arrest in PCNA^K164R mutants when challenged with MMC or MMS (Figures 1D and 1E) and a significant decrease in S-phase DNA synthesis (Figure 1F). Taken together, these data suggest that PCNA K164 post-translational modification, presumably ubiquitination, is required in RPE-1 cells for tolerance of lesion-induced replication stress, consistent with previous literature.⁴

Unperturbed DNA replication and cell-cycle progression are altered in PCNA^K164R mutants

Although markers of replication stress and DNA damage were not significantly increased without exogenous genotoxic stress, we noted a growth defect in PCNA^K164R mutants under unperturbed conditions (Figure 2A). To understand this defect, we utilized complementary techniques to evaluate DNA replication and cell-cycle progression. First, using single-cell quantitative chromatin flow cytometry, we observed small changes in the cell-cycle distribution of PCNA^K164R cells compared to wild type (Figures 2B and S2A), with an increase in the G2/M-phase population and a proportional decrease in the G1-phase population. PCNA^K164R mutants also displayed a mild decrease in S-phase EdU incorporation (Figures 2C and S2B) and MCM2 loading during late G1 phase (Figures 2D and S2C), and although small, these changes were statistically significant. However, western blot analyses of these mutants did not detect a significant change in chromatin-bound MCM2 or ORC2 (Figure S2D), suggesting that the differences observed by flow cytometry may be a result of a particularly stringent gating strategy (Figure S2C). Similar to our RPE-1 cells, when we compared transformed wild-type 293T cells with PCNA^K164R mutants, shown previously to express equivalent amounts of wild-type or mutant PCNA,¹⁹ we found small but detectable perturbations in cell-cycle distribution, S-phase EdU incorporation, and MCM2 loading in late G1 phase (Figure S3). Second, we utilized single-molecule DNA combing analyses, outlined schematically in Figure S2E, to assess DNA replication in RPE-1 cells more closely. Although replication fork speed was unaltered (Figure 2E), we observed increased interorigin distances (IODs) in PCNA^K164R mutants (Figure 2F). The average IOD in wild-type cells was ~102 kb, whereas the average in PCNA^K164R mutants was increased to ~140 kb (Figure 2F), which equates to at least 30% fewer origins. Taken together, these analyses suggest that DNA replication and cell-cycle progression in PCNA^K164R mutants are modestly disrupted under unperturbed conditions. Consistent with this, using a combination of Annexin V and propidium iodide staining, we observed a small increase in apoptosis in two out of three PCNA^K164R mutants in comparison to wild type, although only one cell line showed a statistically significant increase (Figures 2G and S2F). Based on these data, we conclude that the inability to ubiquitinate PCNA at K164 causes mild, chronic replication stress that reduces cell proliferation and may result in cell death.

Figure 2. The PCNA-K164R mutation disrupts DNA replication without exogenous genotoxic stress.

(A) Average cell proliferation rate in PCNA^K164R cell lines normalized to wild type. For each cell line, n = 9 wells across three biological replicates. Error bars indicate standard deviation, and significance was calculated using one-way ANOVA with *p < 0.05, **p < 0.01, and ***p < 0.001.

(B) Cell-cycle distribution of RPE-1 wild-type and PCNA^K164R cell lines from four biological replicates. Percentage of each population in G1 (green), S (purple), or G2/M phase (gray) is shown. Error bars indicate standard deviation, and significance was calculated using Student’s t test with *p < 0.05, **p < 0.01, and ***p < 0.001.

(C) Quantification of mean fluorescent intensity of EdU staining in S-phase cells from RPE-1 wild-type (blue) and PCNA^K164R cells (maroon); n = 12 across four biological replicates. Error bars indicate standard deviation, and significance was calculated using Student’s t test with *p < 0.05, **p < 0.01, and ***p < 0.001.

(D) Quantification of the percentage of MCM2-stained cells in late G1 from RPE-1 wild-type (blue) and PCNA^K164R cells (maroon); n = 12 across four biological replicates. Error bars indicate standard deviation, and significance was calculated using Student’s t test with ***p < 0.001.

(E) Fork speed quantification from two biological replicates in RPE-1 wild-type (blue) and PCNA^K164R cells (maroon). Average IOD and number (n) quantified are listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ***p < 0.001.

(F) IOD quantification from two biological replicates in RPE-1 wild-type (blue) and PCNA^K164R cells (maroon). Average IOD and number (n) quantified are listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ***p < 0.001.

(G) Percentage of apoptotic cells in RPE-1 wild-type (blue) and PCNA^K164R populations. Error bars indicate standard deviation, and significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with *p < 0.05; n = 12 replicates across four biological replicates.

PCNA^K164R mutants display DNA under-replication and suppressed MiDAS activation

Chronic replication stress primarily affects late-replicating and hard-to-replicate regions.²⁰ The inability to complete replication of these regions can generate late-replicating intermediates (LRIs) and under-replicated DNA. The persistence of LRIs in mitosis may result in the formation of chromatin bridges during anaphase.²¹ If these bridges persist, they can disrupt the spindle apparatus and cause aberrant chromosome segregation, including lagging chromosomes.²¹ When we analyzed the frequency of anaphase abnormalities including DAPI-positive bridges and lagging chromosomes, these events were extremely rare in wild-type and PCNA^K164R mutant RPE-1 cells (Figure 3A). However, exacerbating replication stress with a low dose (300 nM) of the DNA polymerase inhibitor aphidicolin (APH) caused a significant increase in anaphase abnormalities, especially in PCNA^K164R mutants (Figure 3A). One fate of under-replicated regions that are inherited by daughter cells is their sequestration into G1-phase 53BP1 NBs.²² Quantification of 53BP1 NBs in G1 nuclei revealed that PCNA^K164R mutants had a 3-fold increase in 53BP1 NBs under unperturbed conditions (Figure 3B). Interestingly, low-dose APH treatment (300 nM) led to an increase in 53BP1 NBs in wild-type cells but not PCNA^K164R mutants (Figure 3B). A similar phenotype was observed when we performed the same experiment in wild-type and PCNA^K164R 293T cell lines (Figure S4A). These data suggest that PCNA^K164R mutants have reached the maximal number of 53BP1 NBs under unperturbed conditions and/or that these mutants upregulate alternative mechanisms to resolve under-replication in response to APH. Unexpectedly, RPE-1 PCNA^K164R mutants were not more sensitive to APH than wild-type cells (Figure 3C). A similar response was observed following exposure to hydroxyurea (HU) (Figure S4B). These data show that although K164 ubiquitination is broadly important for the cellular response to replication stress, it is only acutely essential for viability in response to certain, chemically modified, lesions. Furthermore, we speculate that the ability of PCNA^K164R mutants to tolerate aberrant chromosome structures, at least over relatively few population doublings, likely comes at the expense of reduced genome stability.

Figure 3. Phenotypes associated with DNA under-replication are increased in PCNA^K164R mutants.

(A) (Top) Representative images of DAPI-stained chromosomes during anaphase: (left) normal, (middle) chromatid bridge, and (right) lagging chromosome. Scale bar, 5 μm. (Bottom) Percentage of abnormal anaphases in UT and APH-treated cells in wild-type (blue) and PCNA^K164R lines (maroon). Number (n) of anaphases quantified is listed. Error bars indicate standard deviation, and significance was calculated using Student’s t test with *p < 0.05.

(B) (Top) Image of 53BP1 NB and cyclin A staining in RPE-1 cell lines. DAPI (blue), 53BP1 NB (green), and cyclin A (pink) are indicated. Scale bar, 20 μm. (Bottom) 53BP1 NB quantification of UT and APH-treated cells in wild type (blue) and PCNA^K164R lines (maroon). Number (n) of nuclei quantified is listed. Error bars indicate standard deviation, and significance was calculated using Kruskal-Wallis with Dunn’s multiple comparison test.

(C) Comparison of APH sensitivity based on the average percentage viability at each APH concentration in RPE-1 wild-type and PCNA^K164R cell lines. Concentrations tested are indicated. Error bars indicate standard deviation, and statistical significance was calculated using Student’s t test when comparing wild-type cells with each respective PCNA^K164R cell line with *p < 0.05, **p < 0.01, and ***p < 0.001; n = 9–12 replicate wells across three biological replicates for all data points.

An increase in under-replicated genomic regions can lead to the formation of FANCD2 foci during, and activation of MiDAS as the cells’ final attempt to complete DNA replication prior to, cell division.^16,18 Whereas transformed cells utilize RAD52 and FANCD2 for MiDAS, non-transformed cell lines do not require RAD52 and are dependent on FANCD2.¹⁶ To visualize APH-induced MiDAS, we pulse labeled cells with EdU and quantified the number of EdU and FANCD2 foci in nuclei that stained positive for histone H3 phosphorylation at serine 10 (pH3-S10), a hallmark of mitotic chromosomes (Figure S5A).^15,16 Given the altered replication dynamics in PCNA^K164R cells, we suspected that these mutants would upregulate MiDAS to minimize under-replicated DNA passing through mitosis. Surprisingly, RPE-1 PCNA^K164R cells had significantly fewer FANCD2 foci (~2- to 3-fold) and a corresponding decrease in EdU foci (~1.5- to 3.5-fold) compared to wild-type cells (Figures 4A-4C). Similar results were seen in 293T PCNA^K164R mutant cells (Figures 4D and 4E), suggesting a shared aspect of FANCD2-dependent MiDAS regulation in transformed and non-transformed cell types.

Figure 4. FANCD2-dependent MiDAS is impaired when PCNA K164 cannot be ubiquitinated.

(A) Representative images of phospho-H3 S10-stained nuclei (blue), EdU foci (green), and FANCD2 (red) foci from APH-treated RPE-1 wild-type and PCNA^K164R cell lines. EdU foci almost exclusively (>95%) colocalized with FANCD2 foci. Scale bar, 5 μm.

(B) FANCD2 foci quantification from two biological replicates in RPE-1 wild-type (blue), PCNA^K164R (maroon), RAD18^−/− (salmon), and RAD18^−/−;PCNA^K164R (pink) cells treated with 300 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ***p < 0.001. FANCD2 foci overlapped with EdU foci in 98% of nuclei.

(C) EdU foci quantification from two biological replicates in RPE-1 wild-type (blue), PCNA^K164R (maroon), RAD18^−/− (salmon), and RAD18^−/−;PCNA^K164R (pink) cells treated with 300 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ***p < 0.001.

(D) FANCD2 foci quantification from two biological replicates in 293T wild-type (blue) and PCNA^K164R cells (maroon) treated with 450 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by one-way ANOVA with Tukey’s multiple comparison test with ***p < 0.001.

(E) EdU foci quantification from two biological replicates in 293T wild-type (blue) and PCNA^K164R cells (maroon) treated with 450 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by one-way ANOVA with Tukey’s multiple comparison test with ***p < 0.001.

(F) Western blot analyses of chromatin associated PCNA, with or without 40 J/m² UV treatment, with histone H2AX as the loading control from RPE-1 wildtype, PCNA^K164R, and reverted PCNA^K164 cells.

(G) FANCD2 foci quantification from two biological replicates in RPE-1 wild-type (blue), PCNA^K164R (maroon), and reverted PCNA^K164 (purple) cells treated with 300 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ****p < 0.001.

(H) EdU foci quantification from two biological replicates in RPE-1 wild-type (blue), PCNA^K164R (maroon), and reverted PCNA^K164 (purple) cells treated with 300 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ****p < 0.001.

To further evaluate the contribution of PCNA K164 ubiquitination in non-transformed cells, we generated RPE-1 RAD18^−/− single and RAD18^−/−:PCNA^K164R double mutants (Figure S5B) and examined them for mitotic EdU and FANCD2 foci. RAD18^−/− cells displayed approximately 40% fewer foci compared to wild type. However, RAD18^−/−:PCNA^K164R double mutants had similar levels of FANCD2 and EdU foci as the PCNA^K164R single mutants, consistent with RAD18 acting upstream of PCNA ubiquitination (Figures 4A-4C and S5B). The number of FANCD2 foci in RAD18^−/− cells was elevated in comparison with PCNA^K164R and RAD18^−/−:PCNA^K164R double mutants (Figure 4B). These results agree with reports that three additional E3 ubiquitin ligases, ring finger protein 8 (RNF8), Cullin-4-RING-ligase (CRL4)-Ddb1-Cdt2 (CRL4^Cdt2), and ring finger and WD repeat domain 3 (RFWD3), are capable of mono-ubiquitinating PCNA.^23-25 Therefore, in the absence of RAD18, PCNA ubiquitination by alternative E3 ligases may partially activate MiDAS. In contrast, when PCNA is unable to be ubiquitinated at K164, MiDAS is severely compromised.

To demonstrate that the MiDAS defects in RPE-1 cell lines were due specifically to the inability to ubiquitinate PCNA K164, we utilized CRISPR-Cas9-mediated gene targeting to revert the mutation in the codon for K164 at the endogenous PCNA locus in RPE-1 cells (Figure S5C). Western blot analyses of these reverted cell lines following UV exposure demonstrated a complete restoration in the ability to ubiquitinate PCNA K164 (Figure 4F). Furthermore, we found that both FANCD2 foci formation and EdU incorporation in pSer10-histone H3-positive nuclei were rescued in reverted cell lines (Figures 4G and 4H). Taken together, these data indicate that PCNA K164 plays a critical role in activating FANCD2-dependent MiDAS in response to under-replicated DNA.

PCNA K164 is an important regulator of FANCD2 mono-ubiquitination to promote MiDAS

FANCD2 has emerged as a central player in MiDAS, particularly in non-transformed human cell lines.¹⁶ The mono-ubiquitination of FANCD2, catalyzed by the E3 ligase FANCL, is needed for robust DNA association^26,27 and is a prerequisite for focus formation. To confirm this, we performed MiDAS experiments in FANCD2 and FANCL null RPE-1 cell lines (Figures S6A and S6B). As expected, FANCD2 foci were undetectable in nuclei of FANCD2^−/− or FANCL^−/− mutants (Figure S6C). However, MiDAS was not completely abolished, implying that an alternative FANCD2-independent pathway exists in RPE-1 cells. Next, we examined whether K164 ubiquitination correlated with FANCD2 mono-ubiquitination. Under unperturbed conditions, FANCD2 mono-ubiquitination was drastically reduced in comparison to wild type in asynchronous RPE-1 PCNA^K164R cells (Figure 5A) but not in 293T PCNA^K164R cells (Figure S6E). Upon low-level APH-induced replication stress identical to that used to evaluate MiDAS, FANCD2 mono-ubiquitination was elevated in RPE-1 and 293T wild-type cells but not in the PCNA^K164R mutants (Figures 5A and S6E). This phenotype was completely rescued in reverted RPE-1 clones (Figure 5B), confirming the link between PCNA K164 ubiquitination and FANCD2 ubiquitination in response to replication stress.

Figure 5. PCNA K164 is required for robust FANCD2 ubiquitination and chromatin association.

(A) Western blot analyses of FANCD2 with Ku86 or Tubulin as the loading control in nuclear fractions (top) or whole-cell extracts (bottom) from RPE-1 wild-type and PCNA^K164R cells with or without 300 nM APH treatment. Quantified band intensities were normalized to loading controls.

(B) Western blot analyses of FANCD2 with Ku86 as the loading control in whole-cell extracts (bottom) from RPE-1 wild-type, PCNA^K164R, and reverted PCNA^K164 cells with or without 300 nM APH treatment. Quantified band intensities were normalized to loading controls.

(C) Representative cell-cycle distributions based on propidium iodide staining from RPE-1 wild-type, PCNA^K164R, and reverted PCNA^K164 cells with or without 300 nM APH treatment.

(D) Cell-cycle distributions of RPE-1 wild-type, PCNA^K164R and reverted PCNA^K164 cell lines from two biological replicates. Percentage of each population in G1 (green), S (purple), or G2/M phase (gray) is shown. Error bars indicate standard deviation, and significance was calculated using Student’s t test with *p < 0.05, **p < 0.01, and ***p < 0.001. Statistics in white text represent comparisons between each cell-cycle phase versus wild type in each treatment condition. Statistics in yellow text represent comparisons between each cell-cycle phase in reverted PCNA^K164 cell lines versus their parental PCNA^K164R mutant with 300 nM APH treatment.

The observed decrease in FANCD2 mono-ubiquitination was not due to an overall reduction in FANCD2 expression (Figures 5A and S6E). Since FANCD2 is mono-ubiquitinated in S phase,²⁸ and since the S-phase distribution of wild-type and PCNA^K164R mutants was similar (Figure 2B), these differences were likely not due to cell-cycle variations. To confirm this, we analyzed the cell-cycle distribution of wild-type, PCNA^K164R, and reverted cell lines following low-dose APH exposure (300 nM). As expected, the percentage of each population in S phase was nearly identical across all cell lines (Figures 5C and 5D). Importantly, the accumulation in G1 phase observed in PCNA^K164R cells following APH treatment was rescued in the reverted cell lines (Figure 5D). These data are consistent with the notion that PCNA K164 ubiquitination promotes FANCD2 ubiquitination and chromatin loading in S phase to facilitate DNA synthesis in mitosis. Finally, to understand the relationship between PCNA and FANCD2 specifically during MiDAS, we utilized proximity ligation assays (PLAs) to quantify close-proximity protein colocalization in pH3-S10-positive nuclei (Figure 6A). Interestingly, the number of PLA foci in wild-type nuclei was significantly higher than in PCNA^K164R mutants, which was identical to the FANCD2 null control, with foci formation returning to wild-type levels in the reverted cell lines (Figure 6B). Furthermore, overlapping PLA and EdU foci were extremely rare (Figure 6C), suggesting that PCNA/ FANCD2 colocalization occurs prior to, but not during, the DNA synthesis step of MiDAS. Taken together, we propose a model in which PCNA K164 ubiquitination activates MiDAS first by promoting FANCD2 ubiquitination and chromatin association in S phase, followed by direct close-proximity colocalization to mark under-replicated genomic loci that engage MiDAS prior to cell division (Figure 6D).

Figure 6. PCNA K164 ubiquitination promotes its colocalization with FANCD2 in mitotic nuclei.

(A) Representative images of phospho-H3 S10-stained nuclei (blue), EdU foci (green), and PLA foci (red) from APH-treated RPE-1 cells. Scale bar, 5 μm.

(B) PLA foci quantification from at least three biological replicates in RPE-1 wild-type (blue), FANCD2^−/− (green), PCNA^K164R (maroon), and reverted PCNA^K164 (purple) cells treated with 300 nM APH. Number (n) of nuclei quantified is listed. Significance was calculated by Kruskal-Wallis with Dunn’s multiple comparison test with ****p > 0.001.

(C) Quantification of overlapping PLA and EdU foci from at least three biological replicates in RPE-1 wild-type (blue), FANCD2^−/− (green), PCNA^K164R (maroon), and reverted PCNA^K164 (purple) cells treated with 300 nM APH. Number (n) of nuclei quantified is listed.

(D) In wild-type (PCNA^K164) cells (left), PCNA is ubiquitinated at K164 in response to replication stress by RAD18. During S phase, this facilitates the switch from processive DNA polymerase to TLS polymerases (for example, Pol η) to complete DNA synthesis. At alternative loci, ubiquitinated PCNA promotes the ubiquitination and chromatin association of FANCD2. During G2/M phase, PCNA recruits subunits of TLS Pol ζ to FANCD2-marked foci to initiate MiDAS and then facilitates processive replication through association with components of Pol δ. In mutant (PCNA^K164R) cells (right), PCNA ubiquitination is impaired. Subsequently, TLS polymerase and FANCD2 recruitment to stressed replication forks is reduced in S and G2/M phases, causing the persistence of under-replicated genomic loci.

DISCUSSION

In this study, we utilized non-transformed human cell lines stably expressing mutant PCNA^K164R from the endogenous locus to fill gaps in our understanding of PCNA’s role(s) in maintaining genome stability. We present evidence that PCNA^K164R mutants experience chronic replication stress, producing under-replicated regions that are not rescued by MiDAS. We propose that these defects are due, at least in part, to the inability of unmodified PCNA to appropriately recruit and/or activate TLS DNA polymerases and facilitate stable chromatin binding of FANCD2 in S and G2/M phases of the cell cycle.

Replication stress, whether acute or chronic, can be caused by many exogenous and endogenous sources that disrupt the normal DNA replication program.²⁰ Consistent with previous studies in mammalian cells, RPE-1 PCNA^K164R mutants were acutely sensitive to DNA lesions induced by UV, MMS, and MMC (Figure 1),^10,11,29,30 implying that TLS was significantly impaired. In this context, PCNA K164 ubiquitination is critical for the recruitment of specialized DNA polymerases that bypass lesions and fill ssDNA gaps. Interestingly, K164-dependent gap filling is also critical under normal growth conditions, helping to prevent nascent DNA degradation at stalled forks and promoting Okazaki fragment maturation.¹⁹ Here, we find that PCNA^K164R mutants experience chronic replication stress that causes perturbations in the global replication program, including a significant reduction in origin activation as indicated by increased IODs (Figure 2F). This chronic replication stress significantly slowed proliferation (Figures 2, S2, and S3) without eliciting a DNA damage response (DDR; Figure 1B). These data are consistent with previous observations where mild replication stress caused ssDNA accumulation and under-replication of CFSs, but not a DDR, in checkpoint-proficient cells.³¹ We observed that PCNA^K164R mutants accumulated under-replicated DNA that was sequestered into G1-phase 53BP1 NBs (Figures 3B and S4A) and an increase in anaphase abnormalities in the presence of low-dose APH (Figure 3A). As APH has classically been used to stimulate under-replication and breakage at CFSs, these genomic loci may be even more sensitive to replication stress in PCNA^K164R mutants.

Human cells employ MiDAS to promote genome stability by completing DNA synthesis at under-replicated loci prior to cell division. However, MiDAS in cancerous and non-transformed cell models is not identical.^16,17 A recent study found that RAD18-mediated PCNA K164 ubiquitination, and not sumoylation, was critical for MiDAS in human cancer cell lines.¹⁸ We extend these findings to 293T cancer cells and, importantly, non-transformed RPE-1 cells, as PCNA^K164R mutants in both backgrounds were defective in MiDAS (Figure 4). We observed a similar defect in RPE-1 RAD18^−/− cells (Figures 4B and 4C), whereas RAD18^−/−:PCNA^K164R double mutants had no additional defect, confirming that RAD18 and PCNA function in the same MiDAS pathway. In our study, RAD18-dependent K164 ubiquitination only partially accounted for the MiDAS defect, suggesting that other E3 ligases may modify K164 to activate MiDAS. Using cancer cell lines, Wu et al. proposed that K164 ubiquitination was required to first recruit components of TLS polymerase zeta (Pol ζ) to initiate MiDAS, which were then exchanged for subunits of the processive replicative Pol delta (Pol δ).¹⁸ Interestingly, Bergoglio et al. found that the absence of TLS Pol eta (Pol η) increased MiDAS as the result of impaired gap filling and CFS under-replication in S phase.³² Taken together, these data suggest that in the absence of PCNA K164 ubiquitination, appropriate spatial and temporal recruitment of TLS polymerases is lost, generating ssDNA gaps and under-replicated regions in S phase that cannot be rescued by DNA synthesis in G2/M phase.

FANCD2 is a canonical marker of under-replicated loci, including CFSs, and is the main regulator of MiDAS in non-transformed cells.^16,17 FANCD2 exists as a homodimer and in response to replication stress one subunit is exchanged for FANCI, forming a FANCD2-FANCI heterodimer. Ubiquitination of this DNA-bound complex by the FA core complex locks it onto DNA.^26,27 Specifically, FANCD2 is mono-ubiquitinated during S phase by FANCL.³³ We demonstrate here that mono-ubiquitination of FANCD2 is significantly reduced in PCNA^K164R cells, despite wild-type FANCD2 expression levels (Figures 5A and S6E). This phenotype was present during unperturbed and APH treatment conditions and cannot be explained by a reduction in the S-phase population (Figure 5D). Furthermore, in mitotic pH3-S10-positive nuclei, the number of FANCD2, EdU, and PCNA/ D2 close-proximity colocalization (PLA) foci were each significantly reduced in PCNA^K164R mutants and rescued with restoration of wild-type PCNA expression (Figures 4 and 6). Based on these observations, we propose that FANCD2 is recruited to or stabilized at under-replicated regions by PCNA. In particular, we propose that ubiquitinated PCNA is required for robust FANCD2 recruitment/stabilization, although in the present study, we cannot delineate between the role(s) of mono- or poly-ubiquitinated PCNA. Reciprocally, we speculate that FANCD2 might prevent unloading of ubiquitinated PCNA from stalled forks in S phase to promote MiDAS at under-replicated loci. One possibility is that PCNA directly recruits FANCD2 through its PCNA-interacting peptide (PIP) box²² and/or through its coupling of ubiquitin conjugation to endoplasmic reticulum degradation (CUE) domain.³⁴ In addition, evidence suggests that FANCL recruitment also requires RAD18-mediated PCNA K164 ubiquitination, which stimulates FANCD2 mono-ubiquitination,³⁵ and that loss or depletion of RAD18 impairs FANCD2 foci formation in response to replication stress.³⁶ Consistent with the notion that PCNA recruits FANCD2 and activates the FA pathway, PCNA and FANCD2 colocalize following HU- or APH-induced replication stress.³⁷ Finally, FA proteins participate in a BIR-like mechanism, similar to MiDAS, to alleviate replication stress during S phase.³⁸ Based on these data, we propose that, as for TLS polymerases, spatial and temporal recruitment and activation of FANCD2 are lost in PCNA^K164R mutants.

Our findings support a model that applies to both untreated and APH-treated cells in which PCNA K164 ubiquitination prevents the accumulation of under-replicated DNA in multiple ways (Figure 6D). First, during S phase, replication forks stall under stress, and PCNA recruits TLS polymerases, including but perhaps not limited to Pol η, to proceed with DNA synthesis and prevent under-replication. PCNA also promotes robust origin activation, through an undefined mechanism, to avoid perpetuating ssDNA gaps and under-replicated regions to subsequent cell cycles. At loci that remain under-replicated, PCNA promotes the ubiquitination and chromatin association of FANCD2. Next, as cells progress to G2/M phase, PCNA recruits subunits of TLS Pol ζ to FANCD2-marked loci to initiate MiDAS and then facilitate processive replication through association with components of Pol δ. When the ability to ubiquitinate PCNA K164 is reduced or abolished as it is in RAD18 and PCNA mutants, respectively, TLS polymerase and FANCD2 recruitment are impaired. Notably, PCNA directly interacts with the E3 ubiquitin ligase TRAF-interacting protein (TRAIP)^39,40 and the DNA helicase regulator of telomere length 1 (RTEL1),⁴¹ two proteins with demonstrated roles in MiDAS.^42,43 Future studies may be warranted to understand whether the contributions of PCNA K164 ubiquitination in suppressing under-replication and promoting MiDAS also include the regulation of these two factors. Ultimately, our data place PCNA K164 ubiquitination at a key position in pathways that not only resolve replication stress in S phase but rescue DNA synthesis at particularly sensitive loci prior to cell division.

Limitations of the study

Our study provides strong evidence for the contribution of PCNA K164 ubiquitination in preventing the generation of under-replicated DNA and in promoting FANCD2-dependent MiDAS in human cells. However, gaps in our knowledge remain. First, our data cannot distinguish whether PCNA K164 promotes MiDAS through mono- or poly-ubiquitination. Given the mechanistic similarities between TS, BIR, and MiDAS, evaluating the requirements of PCNA mono- and poly-ubiquitination would be informative. Second, we do not understand the mechanism underlying reduced replication initiation in PCNA^K164R mutants. Using a particularly stringent gating strategy for late-G1-phase cells, we found a statistically significant reduction in the amount of chromatin-bound MCM2. However, western blot analyses of chromatin-bound MCM2 and ORC2 did not detect any differences (Figure S2D), suggesting that any biological effect on origin licensing is relatively small. Interestingly, Madireddy et al. reported that FANCD2 was required for efficient replication initiation at the FRA16D locus in lymphoblast and fibroblast cell lines, an effect that may occur genome wide.⁴⁴ Establishing that PCNA ubiquitination promotes FANCD2 recruitment for robust origin firing either genome wide or at specific loci is an enticing model but, at the moment, remains speculative.

STAR★METHODS

RESOURCE AVAILABILITY

Lead contact

Please direct requests for resources and reagents to Anja-Katrin Bielinsky, Ph.D. (azu3jn@virginia.edu).

Materials availability

All unique/stable reagents generated in this study are available from the lead contact with a completed materials transfer agreement.

Data and code availability

• The original data within the paper will be available from the lead contact upon request.

• This paper does not report custom code.

• Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL DETAILS AND STUDY PARTICIPANT DETAILS

Cell lines

Non-transformed p53-proficient hTERT RPE-1 cells (ATCC, CRL-4000, RRID:CVCL_4388) were grown in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F12 (DMEM/F12, Gibco 11320) supplemented with 10% fetal bovine serum (FBS, Sigma F4135) and 1% Penicillin-Streptomycin (Gibco 15140). Transformed p53-deficient 293T cells (ATCC, CRL-3216, RRID:CVCL_0063) were grown in Dulbecco’s Modified Eagle Medium (DMEM, Gibco 11995) supplemented with 10% FBS and 1% Pen Strep. Cells were cultured at 37°C and 5% CO₂.

METHOD DETAILS

Cell line generation using CRISPR/Cas9 gene editing

To generate PCNA^K164R cells, a guide RNA (gRNA) targeting PCNA exon 5 was designed (gRNA: 5′- ATACGTGCAAATTCACCAGA -3′) and cloned into a CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR associated 9) plasmid (hSpCas9(BB)-2A-GFP/PX458; Addgene plasmid #48138). Utilizing golden gate cloning, a double stranded donor plasmid containing the desired K164R mutation was constructed. Silent mutations were introduced into the donor plasmid to generate a novel restriction enzyme recognition site. Parental RPE-1 wildtype cells were transfected with the CRISPR/Cas9 plasmid containing the PCNA gRNA and the donor plasmid containing the K164R mutation via electroporation (Neon Transfection System, Invitrogen MPK5000; 1530 V, 10 ms, 3 pulses). Two days post-transfection GFP-expressing cells were collected by flow cytometry and subcloned. Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5′- TGGCGCTAGTATTTGAAGCA -3′, Reverse: 5′- ACTTGGGATCCAATTCTGTCTACT -3′, Restriction Enzyme: EcoRI, NEB R3101). Specific mutations were identified by Sanger sequencing (Sequencing: 5′- AGGTGTTGCCTTTTAAGAAAGTGAGG -3′). 293T PCNA^K164R lines were generated as described previously.²⁸

To generate RAD18^−/− and RAD18^−/−:PCNA^K164R mutant cell lines, a gRNA targeting RAD18 exon 2 (gRNA: 5′- AGACAATAGATGATTTGCTG -3′) was designed such that DNA cleavage would disrupt an endogenous restriction enzyme recognition site and was subsequently cloned into a CRISPR/Cas9 plasmid as described above. RPE-1 wildtype cells and PCNA^K164R 2B10 cells were transfected with the CRISPR/Cas9 plasmid containing the RAD18 gRNA using the Neon Transfection System. Two days post-transfection GFP-expressing cells were collected by flow cytometry and subcloned. Subclones were screen for correct targeting by PCR amplification and restriction enzyme digestion (Forward: 5′- GTAGTACCATGCCGAAAGCAC -3′, Reverse: 5′- GGAACCACCTATCTGTTATCC -3′, Restriction Enzyme: TseI, NEB R0591). Knockout lines were identified by Sanger sequencing (Sequencing: 5′- CTACCTCATGTAAAAATCGC -3′) and Tracking of Indels by Decomposition (TIDE) analyses⁶⁷.

To generate PCNA^K164/− reversion cell lines, a synthetic sgRNA (Synthego, 5′-GUAAUUUCUUGUGCAAGAGA-3′) specifically targeting the R164 allele on exon 5 of PCNA and an 89 nt single-stranded oligodeoxynucleotide (ssODN) donor with a point mutation to revert the arginine (AGA) back to a lysine (AAA) (5′-GCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGCGCAAAAGACGGAGTGAAATTTTCTGCTAGTGGAGAACTTGGAAAT-3′) were designed. A silent mutation upstream of the R164K site was introduced into the ssODN to generate a novel FspI restriction site for screening purposes. PCNA^K164R/− A1 and B1 cells were transfected with the synthetic sgRNA, CleanCap Cas9 mRNA (TriLink), and the ssODN using the Neon Transfection System (Invitrogen). Knock-ins were identified in monoclonal populations by PCR amplification using the primer pair (PCNA_Exon5_TIDE_ScrF: 5′-TCTTGTTCCCTGGATGGTGC-3’; PCNA_Exon5_TIDE_ScrR: 5′-ACACGTGCTGAATTTGTATTCCC-3′) followed by FspI (NEB R0135L) restriction enzyme digestion and further confirmed by Sanger sequencing.

Cell proliferation

Cells were plated at 100,000 cells per well (RPE-1) or 125,000 cells per well (293T) in 6-well plates. Cell counts were performed 3-day after seeding using Trypan Blue (Invitrogen T10282) on Countess slides (Invitrogen C10283) using a Countess automated cell counter (Invitrogen C20181).

Cell viability assay

RPE-1 cells were plated at 500 cells (wildtype) or 800 cells (PCNA^K164R) per well in 96-well plates and allowed to recover for 24 h. Stock solutions of each drug were prepared in sterile 1X phosphate-buffered saline (PBS), water or dimethyl sulfoxide (DMSO) as appropriate and further diluted in growth medium. Cells were allowed to grow for 96 h in drug containing medium (methyl methanesulfonate, Acros Organics 156890250, mitomycin C, Sigma M4287, 4-nitroquinoline 1-oxide, Sigma N8141, hydroxyurea, Acros Organics 151680250; aphidicolin, Sigma A0781) and cell viability was measured with the CellTiter-Glo Luminescent Cell Viability Assay (Promega G7572) following manufacturer’s instructions. The viability of drug treated cells was normalized to the average viability of the untreated control cells for each cell line. Plates were imaged using a GloMax Discover Microplate Reader (Promega). Analysis and statistical tests were performed using Microsoft Excel.

Protein extraction, nuclear fractionation and western blotting

For preparation of whole cell extracts, cells were lysed in NETN (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% NP-40 and protease inhibitors) buffer for 10 min at 4°C and then centrifuged at 12,000 rpm for 10 min at 4°C. Cleared lysates were collected and protein concentrations were determined using Bradford protein assay (Bio-Rad 5000006). Lysates were then mixed with SDS loading buffer and denatured at 95°C before fractionation by SDS-PAGE and analyses by Western blot. Nuclear fractions were isolated as previously described⁶⁸. Briefly, extracts were prepared by lysis in Buffer A (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl₂, 0.34 M sucrose, 10% glycerol, 0.1% Triton X-100 and protease inhibitors) for 5 min at 4°C. Insoluble nuclear proteins were isolated by centrifugation at 1300 g at 4°C and chromatin bound proteins were subsequently released by sonication after being resuspended in TSE buffer (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 2 mM EDTA, 0.1% SDS, 0.1% Triton X-100 and protease inhibitors). Remaining insoluble factors were cleared by centrifugation at 17000 g at 4°C. Protein concentrations of nuclear fractions were determined using Bradford protein assay prior to fractionation by SDS-PAGE and Western blot analyses. Primary antibodies were incubated in 5% BLOT-QuickBlocker (G-Biosciences 786-011) as follows: mouse anti-PCNA (Abcam, ab29; 1:3000), rabbit anti-Ubiquityl-PCNA (Lys164) (Cell Signaling, D5C7P, 13439; 1:1000), rabbit anti-RPA32 (S33) (Bethyl, A300-246A; 1:2000), rabbit anti-γH2AX (Bethyl, A300-081A; 1:2000), rabbit anti-H2AX (Bethyl, A300-082A; 1:5000), rabbit anti-p-p53 (S15) (Cell Signaling, 9284S; 1:500), mouse anti-p53 (Santa Cruz, sc-126; 1:2000), rabbit anti-p21 (Santa Cruz, sc-397 clone C19; 1:1000), rabbit anti-FANCD2 (Abcam, ab108928; 1:2000), mouse anti-FANCL (Proteintech, 66639-1-Ig; 1:1,000), rabbit anti-RAD18 (Bethyl, A300-340A; 1:1000), rabbit anti-MCM2 (Cell Signaling, 4007S; 1:1000; BD Biosciences, 610701; 1:1000; Proteintech, 10513-1-AP; 1:1000), mouse anti-GAPDH (GeneTex, GTX627408; 1:10000), mouse anti-Ku86 (Santa Cruz, B-1, sc-5280; 1:500), mouse anti-α-tubulin (Millipore, T9026, clone DM1A; 1:10000), rabbit anti-ORC2 (Thermo Fisher, PA5-110063, 1:1000), rabbit anti-Histone H4 (Abcam, ab10158, 1:200,000). Secondary antibodies were incubated in 5% BLOT-QuickBlocker as follows: goat anti-mouse HRP conjugate (BioRad, 1706516; 1:5000), donkey anti-rabbit HRP conjugate (Amersham, NA9340; 1:5000). Detection was performed using WesternBright Quantum detection kit (K-12042-D20). Quantification was performed using FIJI and Microsoft Excel. Image preparation was performed using Adobe Photoshop.

FACS analysis

For flow cytometry analyses of cell cycle distribution, DNA synthesis and origin licensing, RPE-1 and 293T cells were treated as described previously.³⁶ Briefly, cells were treated with methyl methanesulfonate (20 μM) or mitomycin C (20 nM) for 48 h when applicable and incubated with 10 μM EdU (Lumiprobe, 20540) for 30 min before harvesting with trypsin. Cells were then washed with cold 1X PBS and lysed in CSK (10 mM PIPES pH 7.0, 300 mM sucrose, 100 mM NaCl, 3 mM MgCl₂ hexahydrate) with 0.5% Triton X-100, then fixed in PBS with 4% paraformaldehyde (Electron Microscopy Sciences) for 15 min. Cells were labeled with AF647-azide (Life Technologies, A10277) in 100 mM ascorbic acid, 1 mM CuSO₄, and PBS to detect EdU for 30 min at room temperature (RT). Cells were then washed and incubated with anti-MCM2 antibody (BD Biosciences, #610700; 1:200) in 1% bovine albumin serum (BSA) in PBS with 0.1% NP-40 for 1 h at 37°C. Next, cells were washed and labeled with donkey anti-mouse AF488 secondary antibody (Invitrogen, A11029; 1:1000) in 1% BSA in PBS with 0.1% NP-40 for 1 h at 37°C. Lastly, cells were washed and incubated in DAPI (Life Technologies, D1306; 1 μg/mL) and RNAse A (Sigma, R6513; 100 ng/mL) for 1 h at 37°C. Samples were processed on an LSR II (BD Biosciences) flow cytometer and analyzed with FlowJo v10.6.1 and Microsoft Excel.

For flow cytometry analyses of apoptosis, RPE-1 wildtype and PCNA^K164R cells were seeded in 6-well plates at 75,000 cells per well and allowed to proliferate for approximately 72 h. Cells were collected, washed twice with 1X PBS and stained using the APC Annexin V apoptosis detection kit (Biolegend 640932) according to the manufacturer’s instructions. Samples were processed on an LSRII (BD Biosciences) flow cytometer. Apoptotic cells were identified by annexin V staining while cell viability was determined by PI staining. Data was analyzed using FlowJo v10.6.1 and GraphPad Prism 8.

DNA combing

For genome-wide analyses of DNA replication, wildtype and PCNA^K164R RPE-1 and 293T cells were plated at 40% confluency in 10 cm plates 24 h prior to labeling. Cells were incubated with 25 or 100 μM IdU (Sigma C6891) for 30 min, rinsed twice with pre-warmed medium and then incubated with 100 μM or 200 μM CldU (Sigma I7125) for 30 min. Approximately 250,000 cells were embedded in 0.5% agarose plugs (NuSieve GTG Agarose, Lonza, 50080) and digested for 48 h in plug digestion solution (10 mM Tris-HCl, pH 7.5, 1% Sarkosyl, 50 mM EDTA and 2 mg/mL Proteinase K). Plugs were then melted in 50 mM MES pH 5.7 (Calbiochem #475893) and digested overnight with β-agarase (NEB M0392). DNA was then subsequently combed onto commercially available vinyl silane-coated coverslips (Genomic Vision COV-001). Integrity of combed DNA for all samples was quality checked via staining with YOYO-1 (Invitrogen Y3601). Combed coverslips were baked at 60°C for 2–4 h, cooled to RT and stored at −20°C. DNA was denatured in 0.5 M NaOH and 1 M NaCl for 8 min at RT. All antibody staining was performed in 2% BSA in PBS-Triton (0.1%). Primary antibodies included rabbit anti-ssDNA (IBL 18731), mouse anti-BrdU/IdU (BD Biosciences 347580; clone B44) and rat anti-BrdU/CldU (Abcam, ab6326; BU1/75 (ICR1)). Secondary antibodies included goat anti-mouse Cy3.5 (Abcam ab6946), goat anti-rat Cy5 (Abcam ab6565) and goat anti-rabbit BV480 (BD Horizon #564879). Imaging was performed using Genomic Vision EasyScan service. Images were blinded and analyzed using the Genomic Vision FiberStudio software. Data/statistical analyses were performed in Microsoft Excel and GraphPad Prism 8.

Immunostaining

For immunofluorescent staining of 53BP1 nuclear bodies and Cyclin A, wildtype and PCNA^K164R RPE-1 and 293T cells were seeded onto fibronectin (Sigma F4759) coated coverslips at 100,000 cells per coverslip and allowed to recover for 24 h. Cells were then treated with 300 nM APH (Sigma A0781) for 24 h. After, cells were washed with PBS containing 0.9 mM CaCl₂ and 0.49 mM MgCl₂ (PBS-Ca²⁺/Mg²⁺) and fixed in PBS-Ca²⁺/Mg²⁺ with 3.7% formaldehyde (Fisher Scientific F79-500) for 10 min at RT. Next, cells were washed twice with PBS-Ca²⁺/Mg²⁺, permeabilized with 0.1% Triton X-100 for 5 min at RT, and subsequently blocked in ABDIL (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2% BSA, 0.2% Fish Gelatin, 0.1% NaN₃) for 1 h at RT. Coverslips were incubated with rabbit anti-53BP1 (Abcam, ab36823; 1:500) and mouse anti-Cyclin-A (Santa Cruz; sc-271682 clone B8; 1:200) primary antibodies overnight at 4°C. Next day, coverslips were washed with PBS-Ca²⁺/Mg²⁺ containing 0.1% Tween 20 and incubated with Alexa Fluor 488 donkey anti-rabbit (Invitrogen, A21206; 1:1000) and Alexa Fluor 594 goat anti-mouse (Invitrogen, A11032; 1:000) secondary antibodies for 1 h at RT. Lastly, coverslips were washed, stained with DAPI (Life Technologies, D1306; 1 μg/mL), and mounted on microscope slides with Vectashield anti-fade reagent (Vector Laboratories, H1000). Between 30 and 40 fields per coverslip were imaged on a Zeiss Spinning Disc confocal. Images were scored using FIJI and statistical analyses were performed in GraphPad Prism 8.

For immunofluorescent staining of FANCD2 and EdU foci, wildtype and PCNA^K164R RPE-1 and 293T lines were seeded onto fibronectin coated coverslips and treated with 300 or 450 nM APH when applicable. Cells were then washed with PBS and incubated with 20 μM EdU for 30 min before fixation with 10% formalin. Fixed cells on coverslips were then subjected to a Click-Chemistry Reaction (20 μM Biotin-Azide, 10 mM sodium ascorbate, and 2 mM CuSO₄ in PBS) at RT for 1 h. After, coverslips were washed with PBS and incubated with rabbit anti-FANCD2 (Abcam, ab108928; 1:250) and mouse anti-phospho-Histone H3 (S10) (Cell Signaling; 9706S; 1:200) primary antibodies in PBS containing 0.3% Triton X-100 and 1% BSA at 4°C overnight. The next day, coverslips were washed with PBS and incubated with Alexa Fluor 488 Streptavidin (Thermo Fisher, S32354; 1:100), Alexa Fluor 350 anti-mouse (Thermo Fisher, A11045; 1:100) and Alexa Fluor anti-rabbit (Thermo Fisher, A31632; 1:1000) secondary antibodies at RT for 1 h. Lastly, coverslips were washed with PBS and mounted on microscope slides with Prolong Gold anti-fade reagent (Thermo Fisher, P36931). EdU and FANCD2 foci were scored using a Zeiss Axio Imager A1 fluorescent microscope and EVOS FL imaging system (ThermoFisher AMF43000). Between 300 and 400 cells per cell line were scored in a blinded manner per experiment. Statistical analyses were performed in GraphPad Prism 8.

For immunofluorescent staining of anaphases, wildtype and PCNA^K164R RPE-1 cells were seeded onto coverslips at 200,000 cells per coverslip and allowed to recover for 24 h. Cells were then treated with 300 nM APH for 24 h. After, cells were washed with PBS and fixed with 10% formalin for 15 min. Fixed cells on coverslips were then washed with PBS, stained with DAPI and mounted on microscope slides with Vectashield anti-fade reagent (Vector Laboratories H1000). Between 200 and 300 anaphases per cell line were scored per experiment in a blinded manner using the EVOS FL imaging system (ThermoFisher AMF43000). Statistical analyses were performed in GraphPad Prism 8.

Proximity ligation assay

For immunofluorescent staining of PCNA/FANCD2 PLA and EdU foci, wildtype, PCNA^K164R and PCNA^K164 RPE-1 cells were seeded onto coverslips and treated with 300 nM APH. Cells were then incubated with 20 μM EdU for 30 min. Cells were then pre-extracted with ice-cold 0.5% Triton X-100 in 1x PBS for 15 min on ice, fixed with ice-cold methanol with 5% glacial acetic acid for 15 min on ice, and permeabilized with 0.1% Triton X-100 in 1x PBS for 10 min at room temp. PLA staining was peformed using a Duolink In Situ Red Starter Kit (Millipore Sigma, DUO92101) Coverslips were washed twice in 1x PBS at room temp and blocked with Duoilink Blocking Solution (DUO82007) at 37°C for 1 h. Coverslips were then incubated with mouse anti-PCNA (Abcam, ab29; 1:250) and rabbit anti-FANCD2 (Abcam, ab108928; 1:250) diluted in Duolink Antibody Diluent (DUO82008) at 4°C overnight. After two 5 min washes in 1x Duolink Wash Buffer A at room temp, coverslips were incubated with anti-mouse minus (DUO92004) and anti-rabbit plus (DUO92002) PLA probes at 37°C for 1 h. After two 5 min washes in 1x Duolink Wash Buffer A at room temp, coverslips were incubated with ligation buffer containing ligase (DUO92008) for 30 min at 37°C. After two 5 min washes in 1x Duolink Wash Buffer A at room temp, coverslips were incubated with amplification buffer with polymerase (DUO92008) for 100 min at 37°C. Coverslips were next washed twice for 10 min in 1x Duolink Wash Buffer B, once for 1 min in 0.01x Duolink Wash Buffer B, and once for 1 min in 1x PBS. Coverslips were then subjected to a Click-Chemistry Reaction (20 μM Biotin-Azide, 10 mM sodium ascorbate, and 2 mM CuSO₄ in PBS) at room temp for 1 h. After one 5 min wash in 1x PBS at room temp, coverslips were incubated with rat anti-phospho-Histone H3 (S10) (Active Motif, 61623; 1:200) diluted in 0.3% Triton X-100 and 1% BSA in 1x PBS at 4°C overnight. Next, coverslips were washed once for 5 min in 1x PBS and then incubated with Alexa Fluor 488 Streptavidin (Thermo Fisher, S32354; 1:100) and Alexa Fluor 350 anti-rat (Invitrogen, A21093; 1:250) diluted in 0.3% Triton X-100 and 1% BSA in 1x PBS at room temp for 1 h. Lastly, coverslips were washed twice for 5 min with 1x PBS and mounted on microscope slides with Prolong Gold anti-fade reagent (Thermo Fisher, P36931) or Vectashield anti-fade reagent (Vector Laboratories, H1000). Foci were scored in a blinded manner using a Zeiss Axio Imager A1 fluorescent microscope or EVOS M5000 imaging system (ThermoFisher, A40486). Statistical analyses were performed in GraphPad Prism 9.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analyses

Statistical details of experiments including the statistical test used, value of n, what n represents, dispersion and precision measures (e.g., average, standard deviation), as well as how significance was defined is indicated in each figure and corresponding figure legend. The software used for statistical analysis of each type of experiment is indicated in the corresponding Method Details sections.

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
α-tubulin (Clone DM1A)	Sigma	T9026 RRID:AB_477593
γH2AX	Bethyl	A300-081A RRID:AB_203288
53BP1	Abcam	ab36823 RRID:AB_722497
CldU (BU1/75) (ICR1)	Abcam	ab6326 RRID:AB_305426
Cyclin-A (Clone B8)	Santa Cruz	sc-271682 RRID:AB_10709300
Donkey anti-mouse AF488	Invitrogen	A11029 RRID:AB_2534088
Donkey anti-rabbit AF488	Invtrogen	A21206 RRID:AB_2535792
FANCD2	Abcam	ab108928 RRID:AB_10862535
FANCL	Proteintech	66639-1-Ig RRID:AB_2881998
GAPDH	GeneTex	GTX627408 RRID:AB_11174761
Goat anti-mouse HRP conjugate	BioRad	1706516 RRID:AB_11125547
Goat anti-mouse IgG H&L (Cy3.5)	Abcam	ab6946 RRID:AB_955045
Goat anti-mouse AF350	Invitrogen	A11045 RRID:AB_14275
Goat anti-mouse AF594	Invitrogen	A11032 RRID:AB_2534091
Goat anti-rabbit IgG (BV480)	BD Horizon	564879 RRID:AB_2738997
Goat anti-rabbit AF594	Thermo Fisher	A31632 RRID:AB_2813889
Goat anti-rat IgG H&L (Cy5)	Abcam	ab6565 RRID:AB_955063
Goat anti-rat IgG H + L AF350	Invitrogen	A21093 RRID:AB_10563602
Histone H2AX	Bethyl	A300-082A RRID:AB_203287
Histone H4	Abcam	ab10158 RRID:AB_296888
Ku86 (Clone B-1)	Santa Cruz	sc-5280 RRID:AB_672929
IdU (Clone B44)	BD Bioscience	BD347580 RRID:AB_10015219
MCM2 (BM28)	BD Biosciences	610701 RRID:AB_398024
MCM2	Cell Signaling	4007 RRID:AB_2142134
MCM2	Proteintech	10513-1-AP RRID:AB_2142131
ORC2	Thermo Fisher	PA5-110063 RRID:AB_2855474
p21 (clone 19)	Santa Cruz	sc-397 RRID:AB_632126
p53	Santa Cruz	sc-126 RRID:AB_628082
p-p53 (S15)	Cell Signaling	9284 RRID:AB_331464
p-Histone H3 (S10)	Cell Signaling	9706 RRID:AB_331748
p-Histon H3 (S10)	Active Motif	61623 RRID:AB_2793707
PCNA	Abcam	ab29 RRID:AB_303394
RAD18	Bethyl	A301-340A RRID:AB_937974
RPA32 (S33)	Bethyl	A300-246A RRID:AB_2180847
ssDNA	Genomic Vision	IBL18731 RRID:AB_2341405
Streptavidin AF488	Thermo Fisher	S32354 RRID:AB_2315383
ubiquityl-PCNA (Lys164)	Cell Signaling	13439 RRID:AB_2798219
Vinculin	Abcam	ab18058 RRID:AB_444215
Chemicals, peptides, and recombinant proteins
4-nitroquinoline 1-oxide (4NQO)	Sigma	N8141
16% paraformaldehyde (MeOH free)	Electron Microscopy Sciences	15710
AF647-azide	Life Technologies	A10277
Aphidicolin	Sigma	A0781
Biotin-azide	Cayman Chemical	13040
BLOT-QuickBlocker	G-Biosciences	786–001
Bovine serum albumin	Sigma	A3059
CldU	Sigma	I7125
Copper sulfate	Thermo Fisher	197722500
DAPI	Life Technologies	D1306
DMEM	Gibco	11995
DMEM/F12	Gibco	11320
EcoRI	New England Biolabs	R3101
EdU	Lumiprobe	20540
Fetal Bovine Serum	Sigma	F4135
Fibronectin	Sigma	F4759
Formaldehyde, 37%	Fisher Scientific	F79-500
Formalin	RPI	F10800–500.0
FspI	New England Biolabs	R0135
Hydroxyurea	Acros Organics	151680250
IdU	Sigma	C6891
Methyl methanesulfonate	Acros Organics	156890250
Mitomycin C	Sigma	M4287
MES, Free Acid, ULTROL Grade	Millipore	475893
NuSieve GTG Agarose	Lonza	50080
Penicillin-Streptomycin	Gibco	15140
Prolong Gold	Thermo Fisher	P36931
RNase A	Sigma	R6513
Sodium ascorbate	Sigma	A4034
TseI	New England Biolabs	R0591
Vectashield	Vector Laboratories	H-1000
YOYO-1	Invitrogen	&3601
Critical commercial assays
APC Annexin V Apoptosis Detection Kit	Biolegend	640932
CellTiter-Glo	Promega	G7572
Duolink In Situ Red Starter Kit	Millipore Sigma	DUO92101
EasyScan Service	Genomic Vision	https://store.genomicvision.com/services/77-easyscan.html
WesternBright Quantum Detection Kit	Advansta	K-12042-D20
Experimental models: Cell lines
hTERT RPE-1	ATCC	CRL-4000 RRID:CVCL_4388
293T	ATCC	CRL-3216 RRID:CVCL_0063
Oligonucleotides
PCNA exon 5 gRNA: 5′-ATACGTGCAAATTCACCAGA-3′	Integrated DNA Technologies	N/A
PCNA screen FW: 5′-TGGCGCTAGTATTTGAAGCA-3′	Integrated DNA Technologies	N/A
PCNA screen RV: 5′-ACTTGGGATCCAATTCTGTCTACT-3′	Integrated DNA Technologies	N/A
PCNA sequencing: 5′-AGGTGTTGCCTTTTAAGAAAGTGAGG-3′	Integrated DNA Technologies	N/A
PCNA reversion sgRNA: 5′-GUAAUUUCUUGUGCAAGAGA-3′	Synthego Corporation	N/A
PCNA ssODN: 5′-GCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGCGCAAAAGACGGAGTGAAATTTTCTGCTAGTGGAGAACTTGGAAAT-3′	Integrated DNA Technologies	N/A
PCNA_Exon5_TIDE_ScrF: 5′-TCTTGTTCCCTGGATGGTGC-3′	Integrated DNA Technologies	N/A
PCNA_Exon5_TIDE_ScrR: 5′-ACACGTGCTGAATTTGTATTCCC-3′	Integrated DNA Technologies	N/A
RAD18 exon 2 gRNA: 5′-AGACAATAGATGATTTGCTG-3′	Integrated DNA Technologies	N/A
RAD18 screen FW: 5′-GTAGTACCATGCCGAAAGCAC-3′	Integrated DNA Technologies	N/A
Additional oligonucleotide information is in Table S1	N/A	N/A
Recombinant DNA
hSpCas9(BB)-2A-GFP (PX458)	Addgene	48138 RRID:Addgene481318
Software and algorithms
Adobe Photoshop	Adobe	https://www.adobe.com/products/photoshop.html; RRID:SCR_014199
FIJI	ImageJ	https://imagej.net/software/fiji/; RRID:SCR_00228 5
FlowJo	BD Biosciences	https://www.flowjo.com/solutions/flowjo; RRID:SCR_008520
FiberStudio	Genomic Vision	http://www.genomicvision.com/products/molecular-combing-platform/software/
GraphPad Prism	GraphPad Software	https://www.graphpad.com; RRID: SCR_002798
Microsoft Excel	Microsoft	https://www.microsoft.com/en-gb/; RRID: SCR_016137
TIDE	Brinkman et al.45	https://tide.nki.nl/
Other
Countess Automated Cell Counter	Invitrogen	C20181
Countess Slides	Invitrogen	C10283
DNA combing coverslips	Genomic Vision	COV-001
EVOS FL Imaging System	Thermo Fisher	AMF43000
EVOS M5000 Imaging System	Thermo Fisher	A40486
GloMax Discover Microplate Reader	Promega	GM3000
LSR II Flow Cytometer	BD Biosciences	N/A
Molecular Combing System	Genomic Vision	MCS-001
Neon Transfection System	Invitrogen	MPK5000
Zeiss Azio Imager A1 Microscope	Zeiss	N/A
Zeiss Spinning Disk Confocal Microscope	Zeiss	N/A

Highlights.

• PCNA K164 ubiquitination promotes mitotic DNA synthesis in non-transformed human cells

• Robust FANCD2 ubiquitination, chromatin association, and foci formation rely on PCNA K164

• PCNA and FANCD2 association in G2/M-phase nuclei requires PCNA ubiquitination at K164

INCLUSION AND DIVERSITY

We support inclusive, diverse, and equitable conduct of research.