Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Jan 12;103(3):103461. doi: 10.1016/j.psj.2024.103461

Chicken speckle-type POZ protein (SPOP) negatively regulates MyD88/NF-κB signaling pathway mediated proinflammatory cytokine production to promote the replication of Newcastle disease virus

Zhongming Meng *,1, Yanbi Wang *,†,1, Xianya Kong *, Mona Cen *, Zhiqiang Duan *,†,2
PMCID: PMC10844869  PMID: 38290339

Abstract

The speckle-type POZ protein (SPOP) is demonstrated to be a specific adaptor of the cullin-RING-based E3 ubiquitin ligase complex that participates in multiple cellular processes. Up to now, SPOP involved in inflammatory response has attracted more attention, but the association of SPOP with animal virus infection is scarcely reported. In this study, chicken MyD88 (chMyD88), an innate immunity-associated protein, was screened to be an interacting partner of chSPOP using co-immunoprecipitation (Co-IP) combined with liquid chromatography-tandem mass spectrometry methods. This interaction was further confirmed by fluorescence co-localization, Co-IP, and pull-down assays. It was interesting that exogenous recombinant protein HA-chSPOP or endogenous chSPOP alone was mainly located in the nucleus but was translocated to the cytoplasm upon co-expression with chMyD88 or lipopolysaccharide stimulation. In addition, chSPOP reduced chMyD88 expression by ubiquitination in a dose-dependent manner, and the regulation of NF-κB activity by chSPOP was dependent solely on chMyD88. Importantly, chSPOP played a negative regulatory role in the MyD88/NF-κB signaling pathway and the production of proinflammatory cytokines. Moreover, we found that velogenic Newcastle disease virus (NDV) infection changed the subcellular localization of chSPOP and the expression patterns of chSPOP and chMyD88, and overexpression of chSPOP decreased the production of proinflammatory cytokines to enhance velogenic and lentogenic NDV replication, while siRNA-mediated chSPOP knockdown obtained the opposite results, thereby indicating that chSPOP negatively regulated MyD88/NF-κB signaling pathway mediated proinflammatory cytokine production to promote NDV replication. These findings highlight the important role of the SPOP/MyD88/NF-κB signaling pathway in NDV replication and may provide insightful information about NDV pathogenesis.

Key words: speckle-type POZ protein, Newcastle disease virus, signaling pathway, inflammatory response, virus replication

INTRODUCTION

The speckle-type POZ (poxvirus and zinc finger) protein (SPOP) is a member of the POZ family, which was originally identified in 1997 to name for the nuclear speckles it formed and its homology to the POZ domain (Nagai et al., 1997). Soon after its discovery, SPOP is demonstrated to be an adaptor of the cullin-RING-based E3 ubiquitin ligase complex that mediates the ubiquitination and proteasomal degradation of target proteins (Furukawa et al., 2003; Hernández-Muñoz et al., 2005; Kwon et al., 2006). In addition, accumulating evidence has revealed that SPOP also participates in the regulation of multiple cellular processes, such as cancer progression (Gan et al., 2015), cell proliferation and death (Zhi et al., 2016; Geng et al., 2017), skeletal development (Cai et al., 2016), and genomic stability (Wei et al., 2018). In recent years, several studies have found that SPOP is involved in controlling inflammatory response, showing that SPOP triggers the degradation of myeloid differentiation primary response gene 88 (MyD88) to control the systemic inflammation resolution (Guillamot et al., 2019), and disrupts MyD88 self-association to negatively regulate Toll-like receptor (TLR)-induced inflammation (Hu et al., 2021). Meanwhile, a recent study reported that SPOP is a suppressor of NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, which ameliorates diabetic nephropathy through restraining NLRP3 inflammasome (Wang et al., 2022). All these findings expand our understanding of the biological functions of SPOP and provide the potential drug targets by targeting SPOP for certain disease treatment.

Nowadays, the structural feature of SPOP has been clearly clarified. It is demonstrated that SPOP mainly contains 3 functional domains, including an N-terminal meprin and TRAF homology (MATH) domain, a Bric-a-brac-Tramtrack/Broad (BTB)/POZ domain, and a BTB and C-terminal Kelch (BACK) domain (Clark and Burleson, 2020). As to the MATH domain, it primarily selectively recognizes and recruits the substrates by binding their SPOP-binding consensus (SBC) motif, and the BTB/POZ domain is responsible for SPOP's interaction with cullin3 (Cul3) and SPOP's dimerization, which also involves the participation of BACK domain (Yang et al., 2022). Interestingly, the 3 domains of SPOP are completely conservative among human, mammal, and avian species, indicating that the SPOP of different species may have similar functions during evolution (Zapata et al., 2001). Up to now, numerous studies have always focused on the roles of SPOP in tumorigenesis, but the association of SPOP with microbial infection is less reported. Previous studies have shown that SPOP expression is negatively related to Salmonella loads (Wang et al., 2020), and is essential for NF-κB signaling regulation and innate immune response in Salmonella infection in mice (Li et al., 2020). In addition, SPOP can ubiquitinate and degrade HNF1α and nonstructural protein 2Apro to inhibit the replication of hepatitis B virus and enterovirus 71, respectively (Pi et al., 2023; Zang et al., 2023). Moreover, a recent study also reported that zebrafish SPOP negatively regulates MAVS-mediated type I interferon (IFN) responses to enhance the replication of spring viremia of carp virus (Yu et al., 2023), demonstrating the essential role of SPOP in the replication and pathogenicity of the virus. However, the potential functions of SPOP in other human and animal virus infection still remains unclear.

Newcastle disease (ND) is caused by virulent Newcastle disease virus (NDV) infection, which is a highly contagious disease of avian species that usually causes great economic losses to the poultry industry worldwide (Botchway et al., 2022). NDV belongs to the genus Orthoavulavirus in the Paramyxoviridae family, which contains a single-stranded, negative-sense, nonsegmented RNA genome that encodes 6 structural and 2 nonstructural proteins (Duan et al., 2023). At present, NDV has drawn more and more attraction not only because it is a serious threat to poultry farming (Dimitrov et al., 2017), but also because it is used as an oncolytic agent and a model virus to investigate the replication and pathogenesis of other paramyxoviruses (Huang et al., 2020; Gong et al., 2022). Although substantial progress has been made to uncover the pathogenesis of NDV, many unresolved mysteries are still existed. The current evidence suggests that NDV-induced inflammatory response plays a crucial role in the pathogenesis of NDV (Cheng et al., 2014; Qu et al., 2018; Cai et al., 2023). However, more efforts are needed to elucidate the mechanism and function of NDV-induced inflammation. Now that SPOP is related to inflammatory responses, how chicken SPOP (chSPOP) regulates inflammatory response to affect NDV replication is an interesting question. Therefore, the objective of this study was to identify the cellular innate immunity-associated proteins interacting with chSPOP and investigate the role of this interaction in the replication of NDV.

MATERIALS AND METHODS

Cell line, viruses, and antibodies

The chicken embryonic fibroblast cell line (DF-1) was a kind gift from Prof. Xiufan Liu (Yangzhou University, Yangzhou, China). The velogenic NDV strain SS1 (GenBank no. KP742770.1) was isolated and preserved in our laboratory (Duan et al., 2015), and the lentogenic NDV vaccine virus LaSota (GenBank no. AF077761) was purchased from the China Institute of Veterinary Drug Control (Beijing, China). The rabbit polyclonal antibodies against SPOP (DF12106), MyD88 (AF5195), and GAPDH (AF7021), and the mouse monoclonal antibodies against HA tag (T0008), Myc tag (BF8036), Flag tag (T0003), and GFP tag (T0005) were purchased from Affinity Biosciences (Cincinnati, OH). The rabbit polyclonal antibody against Histone H3 was purchased from Proteintech Group, Inc (Chicago, IL).

Plasmids construction

The open reading frame (ORF) of chSPOP (GenBank no. XM_423281.8), chicken MyD88 (chMyD88) (GenBank no. NM_001030962.5), Cul3 (chCul3) (GenBank no. XM_422620.8), Rbx1 (chRbx1) (GenBank no. NM_001199250.2), and TRAF6 (chTRAF6) (GenBank no. XM_004941548.5) genes was amplified from cDNA derived from DF-1 cells, and then subcloned into the plasmids pCMV-HA, pET-32a(+), pCMV-Myc, pGEX-6p-1, pEGFP-C1, and pCMV-N-Flag (Beyotime Biotechnology, China) to generate pCMV-HA-chSPOP, pET-32a-chSPOP, pCMV-Myc-chMyD88, pGEX-6p-chMyD88, pEGFP-C1-chCul3, pCMV-N-Flag-chRbx1, and pCMV-Myc-chTRAF6, respectively. The primers used for constructing the above plasmids were shown in Table 1. All the constructed recombinant plasmids were confirmed by PCR, restriction digestion along with DNA sequencing.

Table 1.

Primers used for the construction of recombinant plasmids.

Recombinant plasmids Sense primer (5′→3′) Antisense primer (5′→3′) Restriction sitesa
pCMV-HA-chSPOP TCAGAATTCGGATGTCAAGGGT GCCGAGTC GCTCTCGAGTTAGGATTGCTTCA GTCGCTTACG EcoRⅠ/XhoⅠ
pCMV-Myc-chMyD88 ATGAATTCTAATGGCTACGGTACC CGTGGG AACCTCGAGTCACGGCAGCAAGAG AGATTTTG EcoRⅠ/XhoⅠ
pET-32a-chSPOP TCAGAATTCATGTCAAGGGTGC CGAGTCC ACTCTCGAGTTAGGATTGCTTCAGT CGCTTACG EcoRⅠ/XholⅠ
pGEX-6P-chMyD88 ATGAATTCATGGCTACGGTACCC GTGGGT TACCTCGAGTCACGGCAGCAAGAGAG ATTTTG EcoRⅠ/XhoⅠ
pEGFP-C1-chCul3 TCACTCGAGCTATGTCGAACCTG AGCAAG CAAGGTACCTTATGCTACGTAAGTGTAT ACTTTG XhoⅠ/KpnⅠ
pCMV-N-Flag-chRbx1 ACTGGATCCATGGCGGCCGCGAT GGATGT GCACTCGAGCTAGTGTCCGTACTTTT GGAACTCC BamHⅠ/XhoⅠ
pCMV-Myc-chTRAF6 ATCGTCGACCATGAGCTTGCTACA CAGTGA AATGGTACCTTACGCAGCTCCATCAGT ACTGCG SalⅠ/KpnⅠ
Open in a new tab
a

Restriction sits are given in italics and un-derline.

Cell culture and transfection

DF-1 cells were cultured in Dulbecco's modified Eagle medium (DMEM) (Gibco, CA) containing 10% fetal bovine serum (FBS) (Gibco) at 37°C under an atmosphere with 5% CO2. For plasmid transfection experiments, 4 × 105 DF-1 cells grown to 80% confluence in 6-well plates were transfected with a total of 2.5 μg of the indicated plasmids using the Lipofectamine 3000 (ThermoFisher, Waltham, MA) according to the manufacturer's instructions. Twenty-four hours after transfection, DF-1 cells expressing the tag and recombinant proteins were collected and then used for the subsequent indirect immunofluorescence assay (IFA) or Western blotting experiments as described previously (Duan et al., 2022). For siRNA transfection experiments, DF-1 cells were transfected with the chSPOP siRNA or control siRNA (Li et al., 2020) at a dose of 30 pmol using Lipofectamine RNAiMAX (ThermoFisher, Waltham, MA). Forty-eight hours after transfection, the knockdown efficiency of chSPOP siRNA and the effect of chSPOP knockdown on the expression of chMyD88 and the production of proinflammatory cytokines (IL-1β, IL-6, and TNF-α) were detected as described previously (Li et al., 2020).

Because SPOP can act as an adaptor for the Cul3-Rbx1 E3 ubiquitin ligase complex to reduce the expression of target proteins (Jin et al., 2020; Fan et al., 2022), the expression change of Myc-chMyD88 was detected by Western blotting and quantitative real-time PCR (qRT-PCR) in the existence of HA-chSPOP, GFP-chCul3, and Flag-chRbx1 overexpression, respectively (Li et al., 2020). In addition, to analyze whether the ubiquitin is involved in chMyD88 degradation by chSPOP-chCul3-chRbx1 complex, the plasmids-transfected DF-1 cells were treated with 20 μM MG132 or 0.5% dimethyl sulfoxide (DMSO) (Sigma) at 16 h post-transfection for 8 h and then processed for Western blotting analysis.

Co-immunoprecipitation assay, mass spectrometry, and bioinformatics analysis

4 × 105 DF-1 cells grown in 6-well plates were transfected with 2.5 μg of pCMV-HA and pCMV-HA-chSPOP, respectively. Twenty-four hours after transfection, cells were washed 3 times with phosphate-buffered saline (PBS) and then lysed with IP lysis buffer (Pierce). The supernatants were collected and then incubated with an anti-HA antibody overnight at 4°C. The immune complexes were recovered by adsorption to protein A+G Agarose (Millipore Sigma, St. Louis, MO) for 4 h at 4°C. After 3 washes with IP lysis buffer, the immunoprecipitates were stored at −80°C and then used for liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis.

The LC-MS/MS analysis was carried out by Wuhan GeneCreate Biological Engineering Co, Ltd. (Wuhan, China). In brief, the protein samples were digested with trypsin and then analyzed by LC-MS/MS. The obtained data were further evaluated using MS matching software (MASCOT software) to acquire qualitative identification information for the target polypeptides. It should be noted that all proteins present in the HA tag control group were excluded and only those appearing at least twice in the triplicate samples were reserved for subsequent bioinformatics analysis. Gene ontology (GO) annotation of all identified proteins was determined using the UniProt database (https://www.uniprot.org/). KEGG pathways were analyzed using the KEGG PATHWAY database (https://www.kegg.jp/kegg/pathway.html). The protein-protein interaction (PPI) network and Venn diagram were drawn by STRING Version 11.5 (https://cn.string-db.org/) and Venny 2.1 (http://liuxiaoyuyuan.cn/), respectively.

Verification of protein-protein interactions

To verify the interaction between chSPOP and chMyD88, the Co-immunoprecipitation (Co-IP) and His pull-down assays were performed. The Co-IP experiments were carried out as described above, but the supernatants were incubated with an anti-Myc or anti-HA antibody, and the immunoprecipitates were detected by Western blotting using an anti-HA or anti-Myc antibody, respectively. For His pull-down experiments, the His-chSPOP fusion protein (5 h of induction with 0.1 mM IPTG at 28°C) and GST-chMyD88 fusion protein (4 h of induction with 0.05 mM IPTG at 25°C) were expressed in E. coli BL21(DE3), and soluble His-chSPOP and GST-chMyD88 were purified using Ni-NTA His*Bind Resin (Merck & Co. Rahway, NJ) and Glutathione-Sepharose 4B beads (GE healthcare Arlington Heights, IL), respectively. After washing with transport buffer, His*Bind Resin-bound His-chSPOP was incubated with the purified GST-chMyD88 for 2 h at 4°C. The resins were washed 3 times with transport buffer, and the target protein GST-chMyD88 was and then used for SDS-PAGE followed by Western blotting analysis.

Dual-luciferase reporter assay

DF-1 cells were inoculated into 12-well plates at a concentration of 1 × 105 cells per well. The cells were transfected with fluorescent luciferase reporter plasmid pNF-κB-luc and control plasmid pRL-TK combined with chSPOP overexpression vector or siRNA as indicated. Twenty-four hours after transfection, 100 ng/mL lipopolysaccharide (LPS) (Sigma) was added to the cells, and cell extracts were harvested at 4 h after treatment. The firefly luciferase and Renilla luciferase activities were detected using the Promega luciferase assay kit according to the manufacturer's instructions. The relative luciferase activities were calculated by dividing Renilla luciferase values by internal control firefly luciferase values.

Virus infection experiments

DF-1 cells cultured in 6-well plates were transfected with chSPOP overexpression vector or siRNA and then infected with NDV strains SS1 and LaSota (1 μg/mL TPCK-trypsin was added during LaSota infection) at a multiplicity of infection (MOI) of 1, respectively. Cells were collected at 6, 12, and 24 h postinfection (hpi), and the transcription levels of chSPOP, chMyD88, IL-1β, IL-6, and TNF-α were detected using quantitative real-time PCR (qRT-PCR) as described previously (Li et al., 2020). Meanwhile, the effect of NDV infection on the subcellular localization of chSPOP and the expression of chSPOP and chMyD88 was examined by IFA and Western blotting at the indicated times, respectively. In addition, the culture supernatants of NDV-infected cells transfected with chSPOP overexpression vector or siRNA were collected at the indicated time points (6, 12, 24, 36, 48, and 60 hpi), and the virus titers were titrated using 50% tissue culture infective doses (TCID50) in DF-1 cells as described previously (Reed and Muench, 1938).

Statistical analysis

Each experiment was repeated at least 3 times. Fold changes in protein levels (Western blotting), mRNA levels (qRT-PCR), reporter assay activity, and cytokine content between differently samples were compared by ANOVA test using the statistical program Statistica (Statsoft, Tulsa, OK). All data were analyzed with GraphPad Prism software version 5.0 (GraphPad Software Inc., La Jolla, CA). In all analysis, a P-value <0.05 was considered statistically significant. P-values are indicated by asterisks (*P < 0.05, **P < 0.01, ***P < 0.001).

RESULTS

Screening and bioinformatics analysis of cellular proteins interacting with chSPOP

To investigate whether the HA tag and the recombinant protein HA-chSPOP were normally expressed in DF-1 cells, the plasmid-transfected cells were detected by IFA and Western blotting, respectively. The results of the IFA analysis showed that the HA tag was mainly located in the cytoplasm, while the recombinant protein HA-chSPOP had localization both in the nucleus and cytoplasm, especially in the nucleus (Figure 1A), which was consistent with the previous finding (Hu et al., 2021). Meanwhile, the distributed test results of HA and HA-chSPOP in the nuclear and cytoplasmic fractions were consistent with the above fluorescence observation (Figure 1B), indicating that the HA and HA-chSPOP proteins had correct expression in plasmid-transfected cells.

Figure 1.

Figure 1

Open in a new tab

Characterization of the HA tag and HA-chSPOP expression in DF-1 cells. (A) The immunofluorescence detection of HA tag and HA-chSPOP in plasmid-transfected cells. (B) Western blotting analysis of HA tag and HA-chSPOP in the nuclear and cytoplasmic fractions of plasmid-transfected cells.

The potential cellular proteins interacting with chSPOP were further investigated using Co-IP combined with LC-MS/MS methods. The results showed that a total of 114 proteins interacted with HA and 218 proteins interacted with HA-chSPOP (Supplemental Tables 1 and 2). However, only 139 cellular proteins (Supplemental Table 3) were found to interact with chSPOP using Venn analysis (Figure 2A). GO enrichment analysis of the cellular proteins interacting with chSPOP showed that the most significantly enriched molecular functions were enzymatic activity, nucleotide binding, and ATP binding (Figure 2B). As for the biological process enrichment, they were mainly involved in the biosynthetic and metabolic process, signaling pathway, and translation, while for the cellular component enrichment, most of the cellular proteins were located in the cytoplasm, nucleus, and cell membrane (Figure 2B). Then, KEGG pathway enrichment analysis was performed to obtain more information about the biological pathways in which the cellular proteins may be involved. As shown in Figure 2C, in addition to ‘unknown’ proteins, the other cellular proteins were largely enriched in metabolic, biosynthesis, ribosome structure, and endocytosis signaling pathways. The String database was then used to understand how chSPOP interacts with these cellular proteins. The results revealed that there were complex and strong PPI networks among chSPOP and cellular proteins, of which chSPOP might have direct interactions with chicken YWHAG, DUSP7, H2AFY, MYD88, CAPRIN1, CUL3, BMI1, and PTEN (Figure 2D).

Figure 2.

Figure 2

Open in a new tab

Bioinformatics analysis of cellular proteins interacting with chSPOP. (A) The differential Venn maps of cellular proteins interacting with HA tag and HA-chSPOP. (B) Gene ontology analysis of cellular proteins interacting with chSPOP. (C) KEGG pathway analysis of cellular proteins interacting with chSPOP. (D) The PPI network diagram of cellular proteins interacting with chSPOP.

Verification of the interaction between chSPOP and chMyD88

Because MyD88 plays a crucial role in meditating microorganism-triggered innate immune responses (Saikh, 2021), it was selected for the subsequent experiments. The IFA results showed that the recombinant protein HA-chSPOP alone was localized in the nucleus and the cytoplasm, whereas the recombinant protein Myc-chMyD88 alone was only present in the cytoplasm (Figure 3A). However, when the plasmids pCMV-HA-chSPOP and pCMV-Myc-chMyD88 were co-transfected into DF-1 cells, the recombinant proteins HA-chSPOP and Myc-chMyD88 had the obvious cytoplasmic colocalization (Figure 3B). In addition, the results of the Co-IP experiment exhibited that the recombinant protein HA-chSPOP rather than the HA tag could be immunoprecipitated with Myc-chMyD88 when using an anti-Myc antibody, and the inverted Co-IP experiment obtained the same results (Figure 3C). Meanwhile, an in vitro pull-down experiment using the purified recombinant proteins revealed that GST-tagged chMyD88 (GST-chMyD88) was readily precipitated by His-tagged chSPOP (His-chSPOP) but not by the His tag (Figure 3D), thereby demonstrating the direct interaction between chSPOP and chMyD88.

Figure 3.

Figure 3

Open in a new tab

Verification of the interaction between chSPOP and chMyD88. (A) The subcellular localization and Western blotting detection of HA-chSPOP and Myc-chMyD88 in plasmid-transfected cells. (B) The fluorescence co-localization analysis of HA-chSPOP and Myc-chMyD88 in plasmid co-transfected cells. (C–D) Identification of the interaction between chSPOP and chMyD88 by Co-IP and pull-down assays, respectively.

chSPOP reduces chMyD88 expression by ubiquitination at the translational level

To understand whether the expression of chMyD88 is controlled by chSPOP-chCul3-chRbx1 E3 ubiquitin ligase complex, the expression change of Myc-chMyD88 was detected in the existence of HA-chSPOP, GFP-chCul3, and Flag-chRbx1 overexpression. As shown in Figure 4A, the exogenous recombinant protein HA-chSPOP efficiently reduced the expression level of Myc-chMyD88 in a dose-dependent manner in the existence of chSPOP-chCul3-chRbx1. However, the decreased expression of Myc-chMyD88 was inhibited when cells were treated with the ubiquitin inhibitor MG132 (Figure 4B), suggesting that chSPOP could ubiquitinate and degrade chMyD88. The effect of chSPOP knockdown on the expression of chMyD88 was then examined. The results showed that the specific siRNA-mediated knockdown of endogenous chSPOP obviously reduced the expression of chSPOP (P < 0.01) (Figure 4C). Meanwhile, chSPOP siRNA-transfected cells were treated for 3 h with 10 μg/mL cycloheximide (CHX, Sigma) before detection to exclude the newly synthesized chMyD88 protein. As expected, the knockdown of endogenous chSPOP in the presence of CHX caused an increase in the abundance of chMyD88 at different time points (Figure 4D). To further explore whether chSPOP reduces the expression of chMyD88 at the transcriptional level, the mRNA level of chMyD88 in HA-chSPOP overexpression or chSPOP knockdown cells was detected by qRT-PCR. The results showed that the mRNA level of chMyD88 gene remained unchanged in both cases (Figures 4E and 4F), indicating that chSPOP mainly decreased chMyD88 expression by ubiquitination at the translational level rather than the transcriptional level.

Figure 4.

Figure 4

Figure 4

Open in a new tab

chSPOP reduces chMyD88 expression by ubiquitination at the translational level. (A) Western blotting analysis of Myc-chMyD88 in DF-1 cells co-transfected with GFP-chCul3, Flag-chRbx1, and increasing doses of HA-chSPOP (0, 0.5, 1.0, 2.0 μg). (B) Western blotting analysis of Myc-chMyD88 in DF1 cells co-transfected with GFP-chCul3, Flag-chRbx1, HA-chSPOP and treated with DMSO or 20 μM MG132 for 8 h (**P < 0.01). (C) The expression detection of endogenous chSPOP in chSPOP siRNA-transfected cells (**P < 0.01). (D) Western blotting analysis of endogenous chMyD88 expression in DF-1 cells transfected with chSPOP siRNA and treated with 10 μg/mL CHX for 3 h (**P < 0.01, ***P < 0.001). (E–F) The relative transcriptional levels of chSPOP and chMyD88 genes were assessed by qRT-PCR (**P < 0.01, ***P < 0.001).

chSPOP negatively regulates MyD88/NF-κB signaling pathway-mediated proinflammatory cytokine production

To identify the relationship among chSPOP, chMyD88, and NF-κB, the luciferase assays were performed to evaluate the effect of chSPOP on NF-κB signaling downstream of chMyD88. As shown in Figures 5A and 5B, the overexpression of exogenous HA-chSPOP significantly reduced NF-κB activity (P < 0.01), while knockdown of endogenous chSPOP by RNAi obviously enhanced NF-κB activity (P < 0.01), suggesting that chSPOP negatively regulated LPS-induced NF-κB reporter activation. Because TRAF6 is the downstream of MyD88 in the NF-κB signaling pathway (Cohen and Strickson, 2017), we then investigated whether the pathway regulated by chSPOP was dependent solely on chMyD88. The results of luciferase reporter assays showed that chSPOP overexpression significantly inhibited chMyD88- rather than chTRAF6-mediated NF-κB activation upon LPS stimulation (P < 0.01) (Figures 5C and 5D).

Figure 5.

Figure 5

Open in a new tab

chSPOP negatively regulates NF-κB activity by specially targeting chMyD88. (A–B) The relative luciferase activity of NF-κB reporter in DF-1 cells overexpressing chSPOP or inhibiting chSPOP, respectively (**P < 0.01). (C–D) The luciferase activity driven by NF-κB promoter in DF-1 cells co-transfected with chSPOP and chMyD88 or chTRAF6, respectively (**P < 0.01, ***P < 0.001).

To further evaluate the effect of chSPOP on proinflammatory responses in DF-1 cells, the subcellular localization of chSPOP and the expression of proinflammatory cytokines (IL-1β, IL-6, and TNF-α as the indicators) in LPS-treated cells were detected. We found that endogenous chSPOP was located both in the nucleus and cytoplasm in the mock group (Figure 6A), which was consistent with the localization of exogenous HA-chSPOP expressed by recombinant plasmid (Figure 3A). However, the chSPOP protein was mainly localized in the cytoplasm, and only a small amount of chSPOP was detected in the nucleus when cells were treated with LPS (Figure 6A). Meanwhile, the results of nuclear and cytoplasmic fractions detected by Western blotting showed that the nuclear level of chSPOP was gradually decreased, whereas the cytoplasmic chSPOP level was increased by degrees accompanied by the decreased pattern of chMyD88 (Figure 6B), suggesting that chSPOP could reduce the expression chMyD88 in the cytoplasm. In addition, the decreased expression levels of IL-1β, IL-6, and TNF-α were obviously observed in LPS-challenged cells in the HA-chSPOP overexpression group (Figures 6C and 6D). On the contrary, the LPS-challenge of chSPOP-knockdown cells caused the greater expression of IL-1β, IL-6, and TNF-α (Figures 6E and 6F). Therefore, these results indicated a negative regulatory effect of chSPOP on the MyD88/NF-κB signaling pathway and the production of proinflammatory cytokines.

Figure 6.

Figure 6

Open in a new tab

chSPOP negatively regulates MyD88/NF-κB signaling pathway mediated proinflammatory cytokine production. (A) The subcellular localization of endogenous chSPOP upon LPS stimulation. (B) Cell fractionation and Western blotting analysis of chSPOP and chMyD88 in DF-1 cells stimulated with LPS (**P < 0.01, ***P < 0.001). (C–D) The mRNA and protein levels of IL-1β, IL-6, and TNF-α in DF-1 cells and cell supernatants respectively, with overexpressed HA-chSPOP and stimulated with LPS (**P < 0.01). (E–F) The mRNA and protein levels of IL-1β, IL-6, and TNF-α in DF-1 cells transfected with chSPOP siRNA and stimulated with LPS (**P < 0.01).

Velogenic NDV infection changes the subcellular localization of chSPOP and the expression feature of chSPOP and chMyD88

The effect of NDV infection on the subcellular localization of chSPOP and the expression of chSPOP and chMyD88 was then investigated. The results of IFA indicated that the velogenic NDV strain SS1 infection obviously caused the localization of chSPOP from the nucleus to the cytoplasm at 6, 12, and 24 hpi when compared to that of the Mock group, while the lentogenic NDV strain LaSota infection did not significantly change the localization of chSPOP (Figure 7A). However, NDV SS1 infection resulted in decreased and increased transcription level of chSPOP and chMyD88 genes at 6 and 12 hpi, respectively (P < 0.05), which was obviously changed at 24 hpi (P < 0.01) (Figure 7B). By contrast, NDV LaSota infection only caused slight drop and rise of chSPOP and chMyD88 genes at 24 hpi (P < 0.05), respectively (Figure 7B). In addition, the protein levels of chSPOP and chMyD88 examined by Western blotting were basically consistent with their transcriptional levels (Figures 7C and 7D). Moreover, in comparison to the LaSota infection group, the transcription levels of proinflammatory cytokine-related genes IL-1β, IL-6, and TNF-α were significantly increased to varying degrees in the SS1 infection group at different time points (Figure 7E). Thus, these results suggested that velogenic NDV infection could change the subcellular localization of chSPOP and the expression feature of chSPOP and chMyD88, and cause more significant inflammatory responses than lentogenic NDV infection.

Figure 7.

Figure 7

Open in a new tab

Velogenic NDV infection changes the subcellular localization of chSPOP and the expression feature of chSPOP and chMyD88. (A) The subcellular localization of endogenous chSPOP in DF-1 cells infected with velogenic NDV SS1 and lentogenic NDV LaSota at an MOI of 1. (B–D) The mRNA and protein levels of chSPOP and chMyD88 in DF-1 cells infected with NDV at different time points (*P < 0.05, **P < 0.01, ***P < 0.001). (E) The mRNA levels of IL-1β, IL-6, and TNF-α in DF-1 cells infected with NDV (*P < 0.05, **P < 0.01, ***P < 0.001).

Overexpression or knockdown of chSPOP affects NDV replication

To further investigate the role of chSPOP in the replication of NDV, the effect of chSPOP overexpression or knockdown on the NDV replication was evaluated. As shown in Figures 8A and 8B, the transcription levels of IL-1β, IL-6, and TNF-α genes were obviously decreased in the HA-chSPOP group infected with SS1 rather than LaSota at 6, 12, and 24 hpi. On the contrary, when chSPOP gene was knocked down by specific chSPOP siRNA, the transcription levels of IL-1β, IL-6, and TNF-α genes were significantly increased in the chSPOP siRNA group infected with SS1 and LaSota, but this change was more obvious in the SS1 infection group (Figures 8C and 8D). Corresponding to that, the virus titers of SS1 and LaSota in the HA-chSPOP group were obviously higher than that in the HA group from 12 to 60 hpi (Figure 8E), whereas the opposite results were observed in the chSPOP siRNA group compared to that in the control siRNA group when cells infected with SS1 and LaSota (Figure 8F). Together, these results suggested that chSPOP negatively regulated MyD88/NF-κB signaling pathway-mediated proinflammatory cytokine production to enhance NDV replication.

Figure 8.

Figure 8

Open in a new tab

Overexpression or knockdown of chSPOP affects NDV replication. (A–D) The mRNA levels of IL-1β, IL-6, and TNF-α in HA-chSPOP overexpression or chSPOP knockdown DF-1 cells infected with SS1 and LaSota, respectively (*P < 0.05, **P < 0.01, ***P < 0.001). (E–F) The growth curve of SS1 and LaSota in DF-1 cells overexpressing chSPOP or interfering with chSPOP expression, respectively (*P < 0.05, **P < 0.01, ***P < 0.001).

DISCUSSION

Nowadays, PPI studies have been fundamental to understand the potential function of target proteins participating in numerous important biological processes, such as transcription, post-translational modification, cell cycle, and so on (Low et al., 2021). As to SPOP, it has been reported to play essential roles in regulating cell proliferation, skeletal development, genomic stability, tumorigenesis, and inflammatory response (Cai et al., 2016; Zhi et al., 2016; Geng et al., 2017; Wei et al., 2018; Guillamot et al., 2019; Zhang et al., 2023). For example, the E3 ubiquitin ligase consisting of SPOP and Cul3 ubiquitinates the polycomb group protein BMI1 to cause stable X chromosome inactivation (Hernández-Muñoz et al., 2005), and the interaction of SPOP with PTEN and DUSP7 promotes the invasion/migration and metastasis of renal cell carcinoma (Ding et al., 2018; Diop et al., 2023). In addition, SPOP also recognizes and triggers ubiquitin-dependent degradation of CAPRIN1 to enhance cancer cell survival (Shi et al., 2019). Moreover, SPOP promotes the ubiquitination, degradation, and self-association of MyD88 to suppress the innate immune response (Li et al, 2020; Hu et al., 2021). In this study, cellular proteins, including chicken Cul3, PTEN, BMI1, DUSP7, CAPRIN1, and MyD88, were also screened to interact with chSPOP by using Co-IP combined with LC-MS/MS methods, suggesting that this method was feasible and reliable. It was worth noting that the other cellular proteins interacting with chSPOP were also involved in the biological processes of biosynthetic and metabolic, translation, nucleosome assembly, DNA repair, mRNA splicing and rRNA processing, and immune response. These findings expanded our knowledge of the biological functions of chSPOP, which were also helpful for understanding and studying the potential functions of SPOP in other species.

Innate immunity is the first line of host defense to resist microbial infection. At present, studies have demonstrated that TLRs can endow the ability of cells to recognize pathogen-associated molecular patterns (Remick et al., 2023). In particular, MyD88 is identified as an essential adaptor protein for almost all TLR-dependent signaling pathways, which initiates downstream NF-κB signaling events to produce proinflammatory cytokines and type I IFNs (Saikh, 2021). In recent years, Hu et al. (2021) have revealed that human SPOP negatively regulates TLR-induced inflammation response by disrupting MyD88 self-association. In addition, human SPOP is found to polyubiquitinate and degrade MyD88, which adds the complexity of the MyD88/NF-κB signaling pathway in innate immune response (Li et al., 2020). In this study, we found that chMyD88 was screened to be an interact partner of chSPOP, and this interaction was confirmed by subsequent fluorescence co-localization, Co-IP, and pull-down assays. It was interesting that exogenous HA-chSPOP or endogenous chSPOP alone was mainly located in the nucleus but was translocated to the cytoplasm upon co-expression with chMyD88, LPS stimulation, or velogenic NDV infection, which suggested the cytoplasmic function of chSPOP in innate immunity. However, it was unknown how chSPOP is translocated from the nucleus to the cytoplasm, thus further studies are required to address this point. In addition, it was of note that chSPOP could ubiquitinate and degrade chMyD88 expression in a dose-dependent manner, and the manipulation of the NF-κB signaling pathway by chSPOP was dependent solely on chMyD88, demonstrating that chSPOP affected the immune response by specifically targeting chMyD88.

The association of the SPOP/MyD88/NF-κB signaling pathway with immune response has been less reported. A previous study showed that chSPOP expression is related to immunoglobulin A production and bacterial loads in chickens infected with Salmonella (Wang et al., 2020). Meanwhile, another study found that SPOP negatively regulates the MyD88/NF-κB pathway, and SPOP-deficient mice are more susceptible to Salmonella typhimurium infection (Li et al., 2020). Recently, it was reported that a traditional Chinese medicine Zuojinwan can inhibit neuroinflammation and improve neuroinflammation-induced depression-like behaviors through the SPOP/MyD88/NF-κB pathway (Tao et al., 2023). However, the potential function of the SPOP/MyD88/NF-κB signaling pathway in virus infection remains enigmatic. In the present study, we found for the first time that velogenic NDV infection changed the expression patterns of chSPOP and chMyD88, and overexpression of chSPOP reduced the production of proinflammatory cytokines and enhanced velogenic and lentogenic NDV replication, while chSPOP knockdown obtained the opposite results, thereby indicating that chSPOP could negatively regulate MyD88/NF-κB signaling pathway mediated proinflammatory cytokine production to promote the replication of NDV. Up to now, in addition to embryo culture of NDV, cell culture is still one of the effective methods for the proliferation of NDV, which can be used for the subsequent virus concentration and inactivation to produce ND vaccine (Hu et al., 2022). One thing to note was that overexpression of chSPOP raised 2 to 8 times higher proliferation rates of SS1 and LaSota than that in the HA overexpression cells in the growth curve assay. Therefore, DF-1 cells stably expressing chSPOP might be useful for the rapid NDV proliferation and the ND live or inactivated vaccine preparation in the future.

A previous study has reported that NDV utilizes the eIF2α/CHOP/BCl-2/JNK and IRE1α/XBP1/JNK signaling pathways to promote cell apoptosis and inflammation, which supports the proliferation of NDV (Li et al., 2019). Meanwhile, NDV viral RNA can induce IL-1β expression via the NLRP3/caspase-1 inflammasome (Gao et al., 2020), and NDV also induce autophagy to promote the inflammatory cytokines expression through NLRP3/Caspase-1 inflammasomes and p38/MAPK pathway, which is beneficial for NDV replication (Cai et al., 2023). Here, we similarly observed that virulent NDV SS1 infection reduced the expression of chSPOP and induced more proinflammatory cytokine production than lentogenic NDV LaSota infection, which were also consistent with the previous findings (Liu et al., 2012; Kang et al., 2016; Wang et al., 2023). It is well-known that velogenic NDV strains usually causes a more intense inflammatory response and high levels of virus replication, which lead to more severe pathology than low virulence NDV in chicken lung and immune organs (Rue et al., 2011; Xiang et al., 2018; Rabiei et al., 2021). Thus, we speculated that one of the reasons for the host intense inflammatory response induced by velogenic NDV possibly through hijacking and utilizing the SPOP/MyD88/NF-κB signaling pathway. In addition, it has been demonstrated that host inflammatory response is a double-edged sword in infection, showing that it enhances host immune defense and eliminates pathogens, but in turn, excessively aggressive inflammation leads to serious tissue damage (Alam et al., 2015; Altmann, 2019; Tandel et al., 2022). Because velogenic NDV has the ability of high virus titer and severe pathological damage in chicken immune organs, more efforts are needed to elucidate the relationship of this phenomenon with the SPOP/MyD88/NF-κB signaling pathway.

In summary, the current study demonstrated that chSPOP was involved in complex biological processes via interacting with numerous cellular proteins, and chMyD88 was an important interact partner of chSPOP participating in the innate immune response. In addition, chSPOP could specifically target and ubiquitinate chMyD88 to reduce its expression at the translational level, and negatively regulate MyD88/NF-κB signaling pathway-mediated proinflammatory cytokine production to promote NDV replication.

Acknowledgments

AUTHOR CONTRIBUTIONS

Zhongming Meng and Yanbi Wang carried out most of the experiments, wrote the manuscript, and should be considered primary authors. Xianya Kong and Mona Cen helped with the experiment. Zhiqiang Duan critically revised the manuscript and the experiment design. All the authors read and approved the final version of the manuscript.

ACKNOWLEDGMENTS

This study was financially supported by the National Natural Science Foundation of China (grant no. 32360870, 31960698 and 31760732); the High-Level Innovative Talent Project of Guizhou Province (grant no. QWRLBF-2022-3); by the Cultivation Project of Guizhou University (grant no. GDPY-2021-14); and by the Joint Project of Local Poultry Industry in Guizhou Province (grant no. QCN-2020-175).

DISCLOSURES

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled “Chicken speckle-type POZ protein (SPOP) negatively regulates MyD88/NF-κB signaling pathway mediated proinflammatory cytokine production to promote the replication of Newcastle disease virus.”

Footnotes

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.103461.

Appendix. Supplementary materials

mmc1.xlsx (68.4KB, xlsx)
mmc2.xlsx (119KB, xlsx)
mmc3.xlsx (22.2KB, xlsx)

REFERENCES

  1. Alam M., Costales M., Cavanaugh C., Williams K. Extracellular adenosine generation in the regulation of pro-inflammatory responses and pathogen colonization. Biomolecules. 2015;5:775–792. doi: 10.3390/biom5020775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Altmann D. T-cell immunology of the lung: maintaining the balance between host defence and immune pathology. Immunology. 2019;156:1–2. doi: 10.1111/imm.13029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Botchway P.K., Amuzu-Aweh E.N., Naazie A., Aning G.K., Otsyina H.R., Saelao P., Wang Y., Zhou H., Walugembe M., Dekkers J., Lamont S.J., Gallardo R.A., Kelly T.R., Bunn D., Kayang B.B. Host response to successive challenges with lentogenic and velogenic Newcastle disease virus in local chickens of Ghana. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.102138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cai H., Liu A. Spop promotes skeletal development and homeostasis by positively regulating Ihh signaling. Proc. Natl. Acad. Sci. U S A. 2016;113:14751–14756. doi: 10.1073/pnas.1612520114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cai J., Wang S., Du H., Fan L., Yuan W., Xu Q., Ren J., Lin Q., Xiang B., Ding C., Ren T., Chen L. NDV-induced autophagy enhances inflammation through NLRP3/Caspase-1 inflammasomes and the p38/MAPK pathway. Vet. Res. 2023;54:43. doi: 10.1186/s13567-023-01174-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cheng J., Sun Y., Zhang X., Zhang F., Zhang S., Yu S., Qiu X., Tan L., Song C., Gao S., Wu Y., Ding C. Toll-like receptor 3 inhibits Newcastle disease virus replication through activation of pro-inflammatory cytokines and the type-1 interferon pathway. Arch. Virol. 2014;159:2937–2948. doi: 10.1007/s00705-014-2148-6. [DOI] [PubMed] [Google Scholar]
  7. Clark A., Burleson M. SPOP and cancer: a systematic review. Am. J. Cancer. Res. 2020;10:704–726. [PMC free article] [PubMed] [Google Scholar]
  8. Cohen P., Strickson S. The role of hybrid ubiquitin chains in the MyD88 and other innate immune signalling pathways. Cell. Death. Differ. 2017;24:1153–1159. doi: 10.1038/cdd.2017.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dimitrov K., Afonso C., Yu Q., Miller P. Newcastle disease vaccines-A solved problem or a continuous challenge? Vet. Microbiol. 2017;206:126–136. doi: 10.1016/j.vetmic.2016.12.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ding M., Lu X., Wang C., Zhao Q., Ge J., Xia Q., Wang J., Zen K., Zhang C.Y., Zhang C. The E2F1-miR-520/372/373-SPOP axis modulates progression of renal carcinoma. Cancer. Res. 2018;78:6771–6784. doi: 10.1158/0008-5472.CAN-18-1662. [DOI] [PubMed] [Google Scholar]
  11. Diop A., Pietrangeli P., Nardella C., Pennacchietti V., Pagano L., Toto A., Di Felice M., Di Matteo S., Marcocci L., Malagrinò F., Gianni S. Biophysical characterization of the binding mechanism between the MATH domain of SPOP and its physiological partners. Int. J. Mol. Sci. 2023;24:10138. doi: 10.3390/ijms241210138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Duan Z., Xing J., Shi H., Wang Y., Zhao C. The matrix protein of Newcastle disease virus inhibits inflammatory response through IRAK4/TRAF6/TAK1/NF-κB signaling pathway. Int. J. Biol. Macromol. 2022;218:295–309. doi: 10.1016/j.ijbiomac.2022.07.132. [DOI] [PubMed] [Google Scholar]
  13. Duan Z., Zhang Q., Liu M., Hu Z. Multifunctionality of matrix protein in the replication and pathogenesis of Newcastle disease virus: a review. Int. J. Biol. Macromol. 2023;249 doi: 10.1016/j.ijbiomac.2023.126089. [DOI] [PubMed] [Google Scholar]
  14. Duan Z., Ji X., Xu H., Zhao J., Ruan Y., Chen J. Identification of a genotype VIId Newcastle disease virus isolated from Sansui sheldrake ducks in Guizhou Province, China. Genome. Announc. 2015;3 doi: 10.1128/genomeA.00161-15. e00161-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fan Y., Hou T., Dan W., Zhu Y., Liu B., Wei Y., Wang Z., Gao Y., Zeng J., Li L. ERK1/2 inhibits Cullin 3/SPOP-mediated PrLZ ubiquitination and degradation to modulate prostate cancer progression. Cell. Death. Differ. 2022;29:1611–1624. doi: 10.1038/s41418-022-00951-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Furukawa M., He Y.J., Borchers C., Xiong Y. Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat. Cell. Biol. 2003;5:1001–1007. doi: 10.1038/ncb1056. [DOI] [PubMed] [Google Scholar]
  17. Gan W., Dai X., Lunardi A., Li Z., Inuzuka H., Liu P., Varmeh S., Zhang J., Cheng L., Sun Y., Asara J.M., Beck A.H., Huang J., Pandolfi P.P., Wei W. SPOP promotes ubiquitination and degradation of the ERG oncoprotein to suppress prostate cancer progression. Mol. Cell. 2015;59:917–930. doi: 10.1016/j.molcel.2015.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gao P., Chen L., Fan L., Ren J., Du H., Sun M., Li Y., Xie P., Lin Q., Liao M., Xu C., Ning Z., Ding C., Xiang B., Ren T. Newcastle disease virus RNA-induced IL-1β expression via the NLRP3/caspase-1 inflammasome. Vet. Res. 2020;51:53. doi: 10.1186/s13567-020-00774-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Geng C., Kaochar S., Li M., Rajapakshe K., Fiskus W., Dong J., Foley C., Dong B., Zhang L., Kwon O.J., Shah S.S., Bolaki M., Xin L., Ittmann M., O'Malley B.W., Coarfa C., Mitsiades N. SPOP regulates prostate epithelial cell proliferation and promotes ubiquitination and turnover of c-MYC oncoprotein. Oncogene. 2017;36:4767–4777. doi: 10.1038/onc.2017.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gong Y., Tang N., Liu P., Sun Y., Lu S., Liu W., Tan L., Song C., Qiu X., Liao Y., Yu S., Liu X., Lin S.H., Ding C. Newcastle disease virus degrades SIRT3 via PINK1-PRKN-dependent mitophagy to reprogram energy metabolism in infected cells. Autophagy. 2022;18:1503–1521. doi: 10.1080/15548627.2021.1990515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Guillamot M., Ouazia D., olgalev I., Yeung S.T., Kourtis N., Dai Y., Corrigan K., Zea-Redondo L., Saraf A., Florens L., Washburn M.P., Tikhonova A.N., Malumbres M., Gong Y., Tsirigos A., Park C., Barbieri C., Khanna K.M., Busino L., Aifantis I. The E3 ubiquitin ligase SPOP controls resolution of systemic inflammation by triggering MYD88 degradation. Nat. Immunol. 2019;20:1196–1207. doi: 10.1038/s41590-019-0454-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hernández-Muñoz I., Lund A.H., van der Stoop P., Boutsma E., Muijrers I., Verhoeven E., Nusinow D.A., Panning B., Marahrens Y., van Lohuizen M. Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase. Proc. Natl. Acad. Sci. U S A. 2005;102:7635–7640. doi: 10.1073/pnas.0408918102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hu Y.H., Wang Y., Wang F., Dong Y.M., Jiang W.L., Wang Y.P., Zhong X., Ma L.X. SPOP negatively regulates Toll-like receptor-induced inflammation by disrupting MyD88 self-association. Cell. Mol. Immunol. 2021;18:1708–1717. doi: 10.1038/s41423-020-0411-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hu Z., He X., Deng J., Hu J., Liu X. Current situation and future direction of Newcastle disease vaccines. Vet. Res. 2022;53:99. doi: 10.1186/s13567-022-01118-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Huang Z., Liu M., Huang Y. Oncolytic therapy and gene therapy for cancer: recent advances in antitumor effects of Newcastle disease virus. Discov. Med. 2020;30:39–48. [PubMed] [Google Scholar]
  26. Jin X., Shi Q., Li Q., Zhou L., Wang J., Jiang L., Zhao X., Feng K., Lin T., Lin Z., Zhuang H., Yang J., Hu C., Zhang L., Shen L., Lu Y., Zhu J., Wang H., Qi H., Meng X., Xi Y., Pan J., Fang S., Tian H., Zhou C., Zhang P., Gao K., Zhao S.M., Li Y., Gong Z., Wang C. CRL3-SPOP ubiquitin ligase complex suppresses the growth of diffuse large B-cell lymphoma by negatively regulating the MyD88/NF-κB signaling. Leukemia. 2020;34:1305–1314. doi: 10.1038/s41375-019-0661-z. [DOI] [PubMed] [Google Scholar]
  27. Kang Y., Feng M., Zhao X., Dai X., Xiang B., Gao P., Li Y., Li Y., Ren T. Newcastle disease virus infection in chicken embryonic fibroblasts but not duck embryonic fibroblasts is associated with elevated host innate immune response. Virol. J. 2016;13:41. doi: 10.1186/s12985-016-0499-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kwon J.E., La M., Oh K.H., Oh Y.M., Kim G.R., Seol J.H., Baek S.H., Chiba T., Tanaka K., Bang O.S., Joe C..O., Chung C.H. BTB domain-containing speckle-type POZ protein (SPOP) serves as an adaptor of Daxx for ubiquitination by Cul3-based ubiquitin ligase. J. Biol. Chem. 2006;281:12664–12672. doi: 10.1074/jbc.M600204200. [DOI] [PubMed] [Google Scholar]
  29. Li Q., Wang F., Wang Q., Zhang N., Zheng J., Zheng M., Liu R., Cui H., Wen J., Zhao G. SPOP promotes ubiquitination and degradation of MyD88 to suppress the innate immune response. PLoS Pathog. 2020;16 doi: 10.1371/journal.ppat.1008188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li Y., Jiang W., Niu Q., Sun Y., Meng C., Tan L., Song C., Qiu X., Liao Y., Ding C. eIF2α-CHOP-BCl-2/JNK and IRE1α-XBP1/JNK signaling promote apoptosis and inflammation and support the proliferation of Newcastle disease virus. Cell. Death. Dis. 2019;10:891. doi: 10.1038/s41419-019-2128-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Liu W.Q., Tian M.X., Wang Y.P., Zhao Y., Zou N.L., Zhao F.F., Cao S.J., Wen X.T., Liu P., Huang Y. The different expression of immune-related cytokine genes in response to velogenic and lentogenic Newcastle disease viruses infection in chicken peripheral blood. Mol. Biol. Rep. 2012;39:3611–3618. doi: 10.1007/s11033-011-1135-1. [DOI] [PubMed] [Google Scholar]
  32. Low T.Y., Syafruddin S.E., Mohtar M.A., Vellaichamy A., Rahman N.S., Pung Y.F., Tan C.S.H. Recent progress in mass spectrometry-based strategies for elucidating protein-protein interactions. Cell. Mol. Life. Sci. 2021;78:5325–5339. doi: 10.1007/s00018-021-03856-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Nagai Y., Kojima T., Muro Y., Hachiya T., Nishizawa Y., Wakabayashi T., Hagiwara M. Identification of a novel nuclear speckle-type protein. SPOP. FEBS. Lett. 1997;418:23–26. doi: 10.1016/s0014-5793(97)01340-9. [DOI] [PubMed] [Google Scholar]
  34. Pi Y., Li Y., Yan Q., Luo H., Zhou P., Chang W., Gong D., Hu Y., Wang K., Tang N., Huang A., Chen Y. SPOP inhibits HBV transcription and replication by ubiquitination and degradation of HNF1α. J. Med. Virol. 2023;95:e29254. doi: 10.1002/jmv.29254. [DOI] [PubMed] [Google Scholar]
  35. Qu Y., Zhan Y., Yang S., Ren S., Qiu X., Rehamn Z.U., Tan L., Sun Y., Meng C., Song C., Yu S., Ding C. Newcastle disease virus infection triggers HMGB1 release to promote the inflammatory response. Virology. 2018;525:19–31. doi: 10.1016/j.virol.2018.09.001. [DOI] [PubMed] [Google Scholar]
  36. Rabiei M., Low W.Y., Ren Y., Cahyono M.I., Doan P.T.K., Dharmayanti I., Grande E.D., Hemmatzadeh F. Indicators of the molecular pathogenesis of virulent Newcastle disease virus in chickens revealed by transcriptomic profiling of spleen. Sci. Rep. 2021;11:17570. doi: 10.1038/s41598-021-96929-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Reed L.J., Muench H. A simple method of estimating fifty percent endpoints. Am. J. Epidemiol. 1938;27:493–497. [Google Scholar]
  38. Remick B.C., Gaidt M.M., Vance R.E. Effector-triggered immunity. Annu. Rev. Immunol. 2023;41:453–481. doi: 10.1146/annurev-immunol-101721-031732. [DOI] [PubMed] [Google Scholar]
  39. Rue C.A., Susta L., Cornax I., Brown C.C., Kapczynski D.R., Suarez D.L., King D.J., Miller P.J., Afonso C.L. Virulent Newcastle disease virus elicits a strong innate immune response in chickens. J. Gen. Virol. 2011;92:931–939. doi: 10.1099/vir.0.025486-0. [DOI] [PubMed] [Google Scholar]
  40. Saikh K.U. MyD88 and beyond: a perspective on MyD88-targeted therapeutic approach for modulation of host immunity. Immunol. Res. 2021;69:117–128. doi: 10.1007/s12026-021-09188-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Shi Q., Zhu Y., Ma J., Chang K., Ding D., Bai Y., Gao K., Zhang P., Mo R., Feng K., Zhao X., Zhang L., Sun H., Jiao D., Chen Y., Sun Y., Zhao S.M., Huang H., Li Y., Ren S., Wang C. Prostate cancer-associated SPOP mutations enhance cancer cell survival and docetaxel resistance by upregulating Caprin1-dependent stress granule assembly. Mol. Cancer. 2019;18:170. doi: 10.1186/s12943-019-1096-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Tandel N., Negi S., Tyagi R.K. NKB cells: a double-edged sword against inflammatory diseases. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.972435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tao W., Su K., Huang Y., Lu Z., Wang Y., Yang L., Zhang G., Liu W. Zuojinwan ameliorates CUMS-induced depressive-like behavior through inducing ubiquitination of MyD88 via SPOP/MyD88/NF-κB pathway. J. Ethnopharmacol. 2023;312 doi: 10.1016/j.jep.2023.116487. [DOI] [PubMed] [Google Scholar]
  44. Wang B., Dai Z., Gao Q., Liu Y., Gu G., Zheng H. Spop ameliorates diabetic nephropathy through restraining NLRP3 inflammasome. Biochem. Biophys. Res. Commun. 2022;594:131–138. doi: 10.1016/j.bbrc.2021.12.068. [DOI] [PubMed] [Google Scholar]
  45. Wang F., Li Q., Wang Q., Zheng M., Wen J., Zhao G. Association of SPOP expression with the immune response to salmonella infection in chickens. Animals. 2020;10:307. doi: 10.3390/ani10020307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wang L., Xue Z., Wang J., Jian Y., Lu H., Ma H., Wang S., Zeng W., Zhang T. Targeted knockout of Mx in the DF-1 chicken fibroblast cell line impairs immune response against Newcastle disease virus. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wei X., Fried J., Li Y., Hu L., Gao M., Zhang S., Xu B. Functional roles of speckle-type Poz (SPOP) protein in genomic stability. J. Cancer. 2018;9:3257–3262. doi: 10.7150/jca.25930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xiang B., Zhu W., Li Y., Gao P., Liang J., Liu D., Ding C., Liao M., Kang Y., Ren T. Immune responses of mature chicken bone-marrow-derived dendritic cells infected with Newcastle disease virus strains with differing pathogenicity. Arch. Virol. 2018;163:1407–1417. doi: 10.1007/s00705-018-3745-6. [DOI] [PubMed] [Google Scholar]
  49. Yang X., Zhu Q. SPOP in cancer: phenomena, mechanisms and its role in therapeutic implications. Genes. 2022;13:2051. doi: 10.3390/genes13112051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yu G.Q., Chen M.J., Wang Y.J., Liu Y.Q., Zuo M.Z., Zhang Z.H., Li G.X., Liu B.Z., Li M. Zebrafish spop promotes ubiquitination and degradation of mavs to suppress antiviral response via the lysosomal pathway. Int. J. Biol. Macromol. 2023;256 doi: 10.1016/j.ijbiomac.2023.128451. [DOI] [PubMed] [Google Scholar]
  51. Zang L., Yang X., Chen Y., Huang F., Yuan Y., Chen X., Zuo Y., Miao Y., Gu J., Guo H., Xia W., Peng Y., Tang M., Huang Z., Wang Y., Ma J., Jiang J., Zhou W., Zheng H., Shi W. Ubiquitin E3 ligase SPOP is a host negative regulator of enterovirus 71-encoded 2A protease. J. Virol. 2023;97 doi: 10.1128/jvi.00786-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zapata J.M., Pawlowski K., Haas E., Ware C.F., Godzik A., Reed J.C. A diverse family of proteins containing tumor necrosis factor receptor-associated factor domains. J. Biol. Chem. 2001;276:24242–24252. doi: 10.1074/jbc.M100354200. [DOI] [PubMed] [Google Scholar]
  53. Zhang H., Jin X., Huang H. Deregulation of SPOP in cancer. Cancer. Res. 2023;83:489–499. doi: 10.1158/0008-5472.CAN-22-2801. [DOI] [PubMed] [Google Scholar]
  54. Zhi X., Tao J., Zhang L., Tao R., Ma L., Qin J. Silencing speckle-type POZ protein by promoter hypermethylation decreases cell apoptosis through upregulating Hedgehog signaling pathway in colorectal cancer. Cell. Death. Dis. 2016;7:e2569. doi: 10.1038/cddis.2016.435. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.xlsx (68.4KB, xlsx)
mmc2.xlsx (119KB, xlsx)
mmc3.xlsx (22.2KB, xlsx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES