Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) human adaptation resulted in distinct lineages with enhanced transmissibility called variants of concern (VOCs). Omicron is the first VOC to evolve distinct globally dominant subvariants. Here we compared their replication in human cell lines and primary airway cultures and measured host responses to infection. We discovered that subvariants BA.4 and BA.5 have improved their suppression of innate immunity when compared with earlier subvariants BA.1 and BA.2. Similarly, more recent subvariants (BA.2.75 and XBB lineages) also triggered reduced innate immune activation. This correlated with increased expression of viral innate antagonists Orf6 and nucleocapsid, reminiscent of VOCs Alpha to Delta. Increased Orf6 levels suppressed host innate responses to infection by decreasing IRF3 and STAT1 signalling measured by transcription factor phosphorylation and nuclear translocation. Our data suggest that convergent evolution of enhanced innate immune antagonist expression is a common pathway of human adaptation and link Omicron subvariant dominance to improved innate immune evasion.
Subject terms: SARS-CoV-2, Virus-host interactions, Innate immunity
SARS-CoV-2 adaptation and evolution led to stronger innate immune suppression by increasing expression of Orf6 in Omicron subvariants.
Main
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants of concern (VOCs) Alpha, Delta and then Omicron became sequentially dominant globally, with each evolving independently from wave 1 early lineage SARS-CoV-2 virus. Sequential lineage replacement suggests evolution of highly advantageous characteristics that effectively improved transmission. Our previous work showed that Alpha1, and also VOCs Beta to Delta2, adapted by enhancing expression of specific innate immune antagonists including Orf6, N and Orf9b, to suppress the host innate immune response initiated on infection. Since the appearance of the Omicron lineage, it is Omicron subvariants that are co-circulating, or being replaced by each other, rather than new, wave 1-derived, VOCs. The selective forces driving SARS-CoV-2 evolution may therefore have switched from being predominantly adaptation-to-host to immune escape from vaccine- and infection-driven memory responses. In fact, the first dominant Omicron subvariants BA.1 and BA.2, BA.4 and BA.5 emerged with each displaying increasing levels of antibody escape, through mutation of spike, threatening vaccine efficacy and increasing hospitalizations3–16. However, like Alpha to Delta, Omicron subvariants are also accumulating mutations beyond spike17,18, suggesting that spike-independent adaptations may also be crucial for Omicron variant dominance. In this Article, we provide evidence that, similar to VOCs Alpha to Delta, Omicron variants also improve innate immune evasion through enhancement of viral protein expression, suggesting that regulation of host responses through adapting viral protein levels is a key feature of SARS-CoV-2 evolution.
Results
To understand phenotypic differences between Omicron subvariants, and the selective forces driving their evolution, we compared replication of, and host responses to, BA.1–BA.5 with Delta, the previously dominant VOC, in Calu-3 human airway epithelial cells (HAEs; Fig. 1). We equalized input dose of each variant by viral envelope (E) gene copies (quantitative reverse transcription polymerase chain reaction, RT–qPCR) as this ensures cells are exposed to equal starting amounts of viral RNA, which is the major viral PAMP activating defensive host innate immune responses1,19. Most importantly, this approach normalizes dose independently of variant-specific differences in cell tropism or entry routes (Fig. 1a and Extended Data Fig. 1a,b)20–22, which we and others have shown impact both titre determination and input equalization by cell-line infectivity measurements such as 50% tissue culture infectious dose (TCID50) or plaque assay (Extended Data Fig. 1c–e). Our approach is particularly relevant for comparing Omicron subvariants because Omicron spike mutations have been shown to alter tropism, increasing cathepsin-dependent endosomal entry and reducing dependence on cell surface TMPRSS2 (refs. 20–23), irrespective of virion spike cleavage efficiency (Extended Data Fig. 1f). Endosomal cathepsins or cell surface TMPRSS2 are required to cleave spike before ACE2-mediated entry24,25. Indeed, in line with previously published data20–22, we have found that Omicron, particularly BA.5, has enhanced entry (cathepsin dependent and E64d sensitive) in TMPRSS2-negative cells such as Hela-ACE2 compared with previous VOCs such as Delta, whereas entry into Calu-3 cells is largely TMPRSS2 dependent (camostat sensitive) (Extended Data Fig. 1a,b), resulting in striking cell type-specific differences between variant titres by TCID50 (Extended Data Fig. 1e).
Infection of Calu-3 cells with 2,000 E gene copies per cell (Fig. 1) or 200 E copies per cell (Extended Data Fig. 1) gave comparable E RNA (RT–qPCR) at 2 h post infection (h.p.i.), consistent with equal input doses (Fig. 1a and Extended Data Fig. 1g). E gene measurements during infection revealed that Omicron isolates BA.1, BA.2, BA.4 and BA.5 replicated similarly, lagging behind Delta in Calu-3 cells (Fig. 1b and Extended Data Fig. 1h–l). BA.4 replicated most slowly initially but caught up with BA.1, BA.2 and BA.5 by 24 h.p.i. (Fig. 1b and Extended Data Fig. 1). Importantly, these replication differences were observed consistently across several experiments (Fig. 1 and Extended Data Figs. 1 and 2). As E gene measurement during infection captures genomic RNA (gRNA) as well as E, S and Orf3 subgenomic RNAs (sgRNAs), we compared the levels of intracellular E RNA with those of Nsp12 and Orf1a (compare Extended Data Fig. 1h,i with Fig. 1b and Extended Data Fig. 1k,l with Extended Data Fig. 1j), which are uniquely encoded within gRNA. Importantly, the ratio of E to Nsp12 was similar until 24 h.p.i. reflecting equivalent levels of E sgRNA synthesis between variants (Extended Data Fig. 1m). Quantification of released virions by measuring E and Nsp12 RNA copies in the supernatant mirrored viral replication (Extended Data Fig. 1n–q). Similar patterns of infection were also seen when quantified by intracellular nucleocapsid (N) staining (Fig. 1c and Extended Data Fig. 1r).
BA.4 and BA.5 trigger less innate immune activation than earliest Omicron subvariants
We next compared the host innate immune response to Omicron subvariant infection of Calu-3 cells. All viral stocks were prepared in human gastrointestinal Caco-2 cells as they are naturally permissive to SARS-CoV-2 replication but do not mount a strong innate response to this infection19,26. We confirmed that viral stocks prepared in Caco-2 cells (the highest viral inoculum for each variant was 2,000 E copies per cell) did not contain measurable interferon (IFN)β and negligible IFNλ1/IFNλ3 (enzyme-linked immunosorbent assay, ELISA) (Extended Data Fig. 2a,b), ensuring differences in innate immune activation in Calu-3 infections were not a result of IFN carryover in the viral stocks.
Strikingly, we found that infection of Calu-3 cells with BA.4 and BA.5 resulted in significantly less innate immune activation compared to BA.1/BA.2, evidenced by lower induction of IFNβ (IFNB) and interferon stimulated genes (ISGs) including inflammatory chemokine CXCL10 and RSAD2, DDX58, IFIT1 and IFIT2 (Fig. 1d and Extended Data Fig. 2c–g) and a trend towards reduced MX1 and MX2 expression (Fig. 1d). Reduced host responses to BA.4 and BA.5 infection were also evident at the level of IFNβ and CXCL10 secretion (Fig. 1e,f). Slower replication of BA.4 probably contributes in part to reduced innate immune activation during Calu-3 infection, but BA.5 replication was similar to BA.1 and BA.2 and nonetheless induced significantly less innate immune responses. Inhibition of IFN-mediated JAK/STAT signalling with ruxolitinib, evidenced by the absence of ISG induction (Extended Data Fig. 2e,f), rescued BA.1 and BA.2 infection in Calu-3 cells to a greater degree than BA.4 or BA.5 (Fig. 1g and Extended Data Fig. 2h–j), suggesting that the greater induction of IFNβ by BA.1 and BA.2 reduced their infectivity. BA.1 to BA.5 showed similar sensitivities to a range of IFN doses used to pre-treat Calu-3 cells (Extended Data Fig. 2k–m). We therefore conclude that the differences in ruxolitinib sensitivity reflect differences in IFN induction after Calu-3 infection and not differences in IFN sensitivity. Infecting Calu-3 cells with lower virus input doses (200 E copies per cell) recapitulated our observation that Delta replicated better than Omicron BA.1–BA.5 (Extended Data Fig. 1j–l), and we again saw reduced innate immune activation by BA.4 and BA.5 compared with BA.1 and BA.2 (Extended Data Fig. 2f,g). At this lower inoculum, BA.4 infectivity was also strongly rescued by ruxolitinib treatment consistent with its slower replication being due to IFN induction (Extended Data Fig. 2i).
We next compared Omicron subvariant replication and host responses in primary HAE cultures, which better recapitulate the heterogeneous polarized epithelial layer of the respiratory tract. We have previously reported that HAEs reveal differences in VOC replication that probably reflect host adaptation, which are not always apparent in highly permissive cell lines, such as Calu-3 (refs. 1,2). Concordantly, BA.5 viral replication was higher than BA.2 and BA.4 in differentiated primary bronchial HAEs at 72 h.p.i., while apical viral release over time was comparable (Fig. 1h,i). Despite BA.4 and BA.5 replicating similarly to BA.2 in HAEs, we consistently observed reduced innate activation, measured by ISG induction, after BA.4 and BA.5 infection (IFNB, CXCL10, IFIT1, IFIT2, DDX58 and RSAD2; Fig. 1j). Inhibiting IFN signalling with JAK-inhibitor ruxolitinib suppressed ISG induction (Fig. 1j) and rescued replication of BA.2 to a greater degree than BA.4 and BA.5 (Fig. 1k). Altogether, data in Fig. 1 suggest adaptation to reduce innate immune activation between the earliest (BA.1 and BA.2) and subsequent (BA.4 and BA.5) Omicron subvariants.
SARS-CoV-2, and other respiratory viruses, reportedly replicate more efficiently in nasal and tracheal epithelial cells27, in part due to reduced innate activation and IFN responsiveness at the lower temperatures of the upper airway28–30. To investigate whether lower temperatures reveal further Omicron subvariant adaptation, we compared replication at 32 °C in Calu-3 cells. We found BA.1 to BA.5 all replicated less well than at 37 °C (Extended Data Fig. 3a,b) whereas Delta replication was not as temperature sensitive. As expected29, innate immune activation in response to infection, or to RNA sensing agonist poly(I:C), was largely abolished at 32 °C (measured by IFNB and CXCL10 messenger RNA induction; Extended Data Fig. 3c–e). At 37 °C, we again observed lower innate activation for BA.4 and BA.5 compared with BA.1/BA.2. In HAE, lowering the temperature to 32 °C did not impact viral replication to the same extent as in Calu-3 cells (Extended Data Fig. 3f). However, we observed reduced virus output in apical washes from infected HAE cultures for all Omicron isolates (Extended Data Fig. 3g–i). Infected HAEs at 32 °C also expressed significantly less IFNB and CXCL10 (Extended Data Fig. 3j). Overall, our data suggest that Omicron does not replicate better at 32 °C in lung epithelial cells even in the absence of an innate immune response. However, it is possible that the intra-tissue temperature throughout the airways remains closer to 37 °C than the exhaled breath temperature of 32 °C suggests31.
BA.4 and BA.5 increase Orf6 expression and efficiently antagonize innate immune activation during infection
We next investigated the mechanism underlying differential innate immune activation by Omicron subvariants. IRF3 and STAT1 are key transcription factors responding to intracellular RNA sensing and IFN production, respectively, exemplified here by poly(I:C) treatment (Extended Data Fig. 4a–c). We and others have shown that SARS-CoV-2 activates transcription factors IRF3 and STAT1 downstream of RNA sensing19,32. Consistent with their reduced innate immune triggering, we found Omicron BA.4 and BA.5 infection activated significantly less IRF3 phosphorylation than BA.2 infection (Fig. 2a–c). A similar trend was observed for STAT1 serine 727 phosphorylation, which is essential for full STAT1 transcriptional activity33, but not upstream JAK1-dependent tyrosine 701 phosphorylation (Fig. 2a,d–f). Reduction of STAT1 phosphorylation correlated with reduced STAT1 nuclear translocation during BA.4 and BA.5 infection compared with BA.2, measured by high-content single-cell immunofluorescence imaging of infected nucleocapsid-positive Calu-3 cells (Fig. 2g). These data suggest that BA.4 and BA.5 more effectively prevent intracellular activation of innate sensing pathways. We previously reported that SARS-CoV-2 VOC Alpha evolved enhanced innate immune evasion by increasing expression of key innate antagonists Orf6, Orf9b and N (Extended Data Fig. 4d), which manipulate host cell innate immune pathways1. To investigate whether Omicron subvariants have also independently evolved enhanced innate immune suppression through similar mechanisms during human adaptation, we measured viral innate antagonist protein expression during infection. Strikingly, we found that BA.4, and particularly BA.5, expressed higher levels of Orf6 and N compared with BA.1 and BA.2 (Fig. 2h–l and Extended Data Fig. 4e–k), measured at 48 h.p.i. in Calu-3 cells when E RNA levels were equivalent (Fig. 2m). Unlike previous VOCs1,2, expression of innate immune antagonist Orf9b was not detected for any Omicron isolate, possibly due to Omicron subvariants encoding lineage-specific Orf9b mutations (P10S and ΔENA at positions 27–29) altering antibody binding and precluding detection by immunoblot (Fig. 2n and Extended Data Fig. 4d). Importantly, Orf9b remained readily detectable in Delta-infected cells (Fig. 2n). Upregulation of Orf6 and N expression by BA.5 was validated using a second independent isolate (Extended Data Fig. 4l–n), and was also evident in lysates from infected HAEs (Extended Data Fig. 4o). Blocking IFN signalling with ruxolitinib rescued replication of all Omicron isolates as before (Fig. 1 and Extended Data Fig. 2) and enhanced viral protein detection by immunoblot (Fig. 2h,n and Extended Data Fig. 4e). Importantly, higher levels of BA.4 and BA.5 Orf6 and N remained apparent after ruxolitinib treatment (Fig. 2h,k,l). We previously showed that enhanced levels of Orf6, N and Orf9b protein by Alpha were associated with increased levels of the corresponding sgRNAs1. By contrast, BA.5 Orf6 and N sgRNA levels (normalized to genomic Orf1a) were not enhanced, and were only slightly upregulated during BA.4 infection (Fig. 2o), particularly in comparison with Alpha (Extended Data Fig. 4p,q). No differences were observed in S and Orf3a sgRNAs, which served as controls to rule out a general enhancement of sgRNA synthesis (Fig. 2o). Although Omicron subvariants have synonymous and non-synonymous mutations in Orf6 and N, there are no mutations that distinguish BA.4 and BA.5 from BA.1 and BA.2 that provide a simple explanation for increased Orf6 or N protein levels, including in their transcriptional regulatory sequences (Figs. 1 and 2 and Extended Data Tables 1 and 2). Thus, we hypothesize that BA.4 and BA.5 have either evolved independent mechanisms to increase Orf6 and N protein levels, or that the increase is mediated by changes elsewhere in the genome, which may impact viral translation or protein stability. Further studies are required to pinpoint the adaptations regulating Orf6 and N expression levels.
Extended Data Table 1.
Extended Data Table 2.
Orf6 expression is a major determinant of enhanced innate immune antagonism by emerging VOCs
Orf6 is a multifunctional viral accessory protein that modulates expression of host and viral proteins34,35. Orf6 selectively inhibits host transcription factor nuclear transport to potently antagonize antiviral responses during infection. To probe Orf6 mechanisms, and its contribution to enhanced innate antagonism by the VOCs, we used reverse genetics to introduce two stop codons into the Orf6 coding sequence of both Alpha (Alpha ΔOrf6) and BA.5 (BA.5 ΔOrf6), which we confirmed abolished Orf6 expression during infection (Fig. 3a,b). While Alpha ΔOrf6 replicated similarly to parental wild-type (WT) virus up to 24 h.p.i. (Fig. 3c), we observed enhanced IFNB and CXCL10 expression (Fig. 3d) and protein secretion (Extended Data Fig. 5a) during Alpha ΔOrf6 infection of Calu-3 cells compared with WT virus. Moreover, increased IRF3 nuclear translocation was evident after Alpha ΔOrf6 infection at 24 h.p.i. using single-cell quantitative immunofluorescence microscopy (Fig. 3e and Extended Data Fig. 5b). This suggests an important role for Orf6 in innate immune antagonism during viral replication1,35–37 and is consistent with suppression of IRF3 nuclear transport in Orf6 overexpression studies35,36,38. The reduction in Alpha ΔOrf6 replication at 48 h.p.i., and N and spike protein expression at 24 h.p.i., that was rescued by ruxolitinib treatment, is also consistent with greater IFN-mediated suppression of the Orf6 deletion mutant (Fig. 3a and Extended Data Fig. 5c).
Alpha ΔOrf6 also replicated less well than WT in HAE cells (Fig. 3f–h and Extended Data Fig. 5d). IFNB and CXCL10 gene induction, normalized to GAPDH, were similar after Alpha ΔOrf6 and WT infection (Fig. 3i), despite lower E RNA levels for Alpha ΔOrf6, consistent with increased innate immune induction by the deletion virus. Importantly, Alpha ΔOrf6 was more sensitive to ruxolitinib treatment than WT, consistent with the notion that increased IFN induction caused reduced replication of Alpha ΔOrf6 (Fig. 3g,h). To address the role of Orf6 during BA.5 infection, we compared replication of a BA.5 ΔOrf6 mutant with parental BA.5 WT virus. We also generated a BA.5 mutant bearing the Orf6 D61L mutation found in BA.2 and BA.4 that has been proposed to reduce Orf6 function2,32,39 (Fig. 3b,j). Consistent with the SARS-CoV-2 Alpha ΔOrf6 results, BA.5 ΔOrf6 showed a replication defect at 48 h.p.i. compared with BA.5 WT, and triggered significantly enhanced innate immune responses evidenced by enhanced IFNB and ISG induction (Fig. 3k,l). Deletion of Orf6 in BA.5 also increased the degree of infection-induced IRF3 and STAT1 phosphorylation (Fig. 3m–r) and nuclear translocation (Fig. 3s,t). This demonstrates that Orf6 loss enhances IRF3 and STAT1 activation despite similar levels of infection in the first 24 h.p.i., confirming the important role of Orf6 in innate immune suppression and in distinguishing BA.5 from earlier Omicron subvariants. Infection of HAEs confirmed reduced viral replication of BA.5 ΔOrf6 compared with WT BA.5, while viral release remained comparable (Fig. 3u,v and Extended Data Fig. 5e). ISG expression in HAEs was similar between WT and mutant despite lower E RNA levels during BA.5 ΔOrf6 infection, suggesting greater induction of innate immunity in the absence of Orf6 in these cells (Extended Data Fig. 5f). Interestingly, introducing the C-terminal D61L mutation into BA.5 Orf6 resulted in an intermediate innate immune phenotype measured by increased induction of IFNB, CXCL10 and IFIT1 expression by the mutant virus (Fig. 3l). IRF3 phosphorylation and nuclear translocation were equivalent between BA.5 WT and Orf6 D61L (Fig. 3n–s), whereas STAT1 translocation was not antagonized by Orf6 D61L (Fig. 3t), in line with reports of a partial loss of Orf6 function in the D61L mutation2,32,39. These data suggest complex adaptation of Orf6 manipulation of innate immunity during SARS-CoV-2 Omicron lineage adaptation.
Enhanced innate antagonism is a conserved feature of dominant Omicron subvariants
During the course of this study, SARS-CoV-2 has continued to evolve and produce new Omicron subvariants (Fig. 4a and Extended Data Fig. 6a). Omicron subvariants BA.2.75, XBB.1, XBB.1.5 and BQ.1.1 have acquired increased ACE2 binding and enhanced adaptive immune evasion40–43. To test whether enhanced innate immune antagonism is consistently associated with globally successful subvariants, we compared BA.2.75, XBB.1, XBB.1.5 and BQ.1.1 isolates with BA.2 and BA.5 (Fig. 4). We equalized virus dose by Nsp12 RNA copies (RT–qPCR), a measurement of gRNA, rather than E RNA copies, due to accumulation of mutations in the E gene of later Omicron subvariants, including in the region detected by our RT–qPCR assay. We found that all Omicron subvariants retained an enhanced dependence on cathepsin, here measured in A549 cells expressing ACE2 and TMPRSS2 (Extended Data Fig. 6b). BA.2.75, XBB.1 (two independent isolates) and XBB.1.5, derived from the parental BA.2 lineage41,43, replicated comparably to earlier BA.2 and BA.5 in Calu-3 and HAEs (Fig. 4b–e and Extended Data Fig. 6c–h). BQ.1.1, which has arisen from BA.5 (ref. 43), displayed some reduction of replication in epithelial cells (Fig. 4d,e and Extended Data Fig. 6e,h). Similar to BA.5, we found that all subsequent Omicron subvariants tested triggered significantly less IFNB and CXCL10 expression than BA.2 at 24 h.p.i. (Fig. 4f). All Omicron subvariants derived from BA.2 (BA.2.75, XBB.1 and XBB.1.5) showed reduced rescue by ruxolitinib treatment, as well as reduced induction of, or sensitivity to, IFN, similar to BA.5 (Fig. 4g and Extended Data Fig. 6i). Strikingly, like BA.5, enhanced innate immune evasion by these more recent subvariants was accompanied by increased Orf6 expression for the majority of isolates (Fig. 4h,i). Reduced BQ.1.1 replication in Calu-3 cells (Fig. 4d and Extended Data Fig. 6e) prevented Orf6 and N detection in the absence of ruxolitinib (Fig. 4h). Reduced innate activation by recent Omicron subvariants also correlated with reduced IRF3 phosphorylation compared with BA.2, and reduction of STAT1 serine phosphorylation was principally observed for XBB.1 and XBB.1.5 variants (Fig. 4j–l and Extended Data Fig. 6j–l). Together these data are consistent with a trend for ongoing Omicron evolution enhancing Orf6 expression as it adapts to the human population leading to reduced innate immune responses, detectable at the level of IFN and ISG expression, and at the level of transcription factor phosphorylation and nuclear translocation. This study considering Omicron variants is very reminiscent of our previous observation of enhanced expression of key innate immune antagonists Orf6, N and Orf9b in VOCs Alpha to Delta suggesting a common evolutionary trajectory to combatting human innate immunity to enhance transmission1,2.
Discussion
We propose a model in which the earliest host innate immune responses make an important contribution to SARS-CoV-2 transmission by influencing whether interactions with the first few cells in the airway establish a productive infection. In this model, viruses with enhanced ability to evade or antagonize innate immunity, for example, through increased Orf6 and N expression, will transmit with greater frequency because they are better at avoiding inducing, or better at shutting down, the host responses that suppress this earliest replication. This model is supported by longitudinal nasal sampling of SARS-CoV-2-infected patients shortly after confirmation of infection, which revealed pronounced and early upregulation of an innate immune response in epithelial cells that rapidly declines after symptom onset44.
How early viral manipulation of the host innate immune response influences disease is less clear. We hypothesize that, once infection of the airway is irrevocably established, innate immune suppression that permits greater levels of viral replication may in turn lead to increased disease, simply due to greater viral burden and greater inflammatory responses. Concordantly, higher baseline antiviral gene expression and more potent innate induction in the nasal epithelium of children are associated with less severe infection outcomes compared with adults45. Like others, we assume this is explained by reduced viral loads reducing disease and early IFN protecting against transmission, with late IFN responses contributing to disease46. Similarly, inborn errors of innate antiviral mechanisms and IFN autoantibodies are associated with severe coronavirus disease 2019 (COVID-19)47–51, assumed to be explained by greater viral loads driving increased inflammatory disease. Furthermore, clinical trials of JAK/STAT inhibitors reduced COVID-19 mortality after hospitalization52. Considering an unrelated virus, simian immunodeficiency virus in macaques, may be relevant. Here transmission efficiency and subsequent disease are also influenced by IFN at the site of infection53. In all these examples, early IFN is beneficial, reducing transmission, but late IFN is bad, increasing symptoms. Human SARS-CoV-2 challenge studies are expected to help us understand the effect of these dynamics and innate immune contributions to transmission and disease by permitting sampling before exposure and during the earliest timepoints post infection with careful assessment of disease in a highly controlled environment54,55.
We have focused on changes in expression of N and Orf6 but we expect that other viral genes contribute to evasion of innate immunity and adaptation to humans. In contrast to common cold coronaviruses, SARS-CoV-2 and its relatives encode a broad range of accessory genes56,57 that antagonize innate immunity and probably contribute to effective transmission between species. Our data suggest that upregulation of Orf6 expression is a central feature of SARS-CoV-2 adaptation to humans. Our observations using Orf6-deletion viruses confirm Orf6 to be a potent viral innate immune antagonist, as reported by others32,34,35,39, and are consistent with a model in which, like Alpha, Omicron subvariant enhancement of Orf6 expression contributes to the reduced innate immune response to infection compared with earlier Omicron viruses. Orf6 upregulation by BA.5 may, in part, explain increased pathogenicity in vivo3,4. This notion is supported by ΔOrf6 SARS-CoV-2 infection of transgenic mice or hamsters, where the Orf6 mutant causes less severe disease and there is quicker recovery from infection, despite comparable viral loads in nose and lungs32,58. Expression of accessory and structural proteins as sgRNAs during SARS-CoV-2 replication provides an elegant mechanism to selectively regulate their abundance during adaptation to host, as the level of each sgRNA and thus protein can be independently adjusted by mutation, as we found for VOCs Alpha to Delta1,2.
The earliest Omicron subvariants BA.1 and BA.2 outcompeted Delta despite not enhancing innate immune antagonism, explained by extensive antibody escape1–14 and improved spike function/stability59,60. This suggests that adaptive immunity was the strongest selection force for Omicron emergence and global dominance. We hypothesize that the acquisition of enhanced innate immune suppression by Omicron lineage variants after their initial emergence required selection for improved transmission and dominance. Thus, innate immune escape may be the second dominant selective force the virus experiences after escape from neutralizing antibodies in a population with pre-existing immunity from prior infection and vaccination. We propose that evolving to better manage host innate immunity for improved transmission is a central feature of species-specific host adaptation for all emerging viruses. Intriguingly, SARS-CoV-2 continues to jump species barriers and has been detected infecting 34 different animal species so far61, illustrating its remarkable capacity to universally antagonize species specific innate immune responses. SARS-CoV-2 will be a fantastic model to further dissect species barriers to zoonotic spillovers and understand how viruses adapt to new species.
We propose that adaptation in spike and beyond also contributes to enhanced replication in human cells1,2. This may be important for outpacing early innate responses during transmission particularly in environments with a mix of permissive and non-permissive cells such as the upper human airways in which ACE2 is expressed only on ciliated cells62. Indeed, we have found that SARS-CoV-2 replicates more slowly in primary HAE cultures than in Calu-3 cells and that HAEs better recapitulate VOC replication advantages1,2. Primary HAEs complement more tractable monoculture models, such as Calu-3 that allow mechanistic studies. We propose that linking VOC genotype to phenotype in multiple models will be essential for effective prediction of novel variant behaviour. Moreover, understanding how adaptive changes in spike, leading to altered viral tropism, influence innate immune responses also warrants further study.
This study adds to the body of evidence for innate immunity being a key barrier that must be overcome by all pandemic zoonotic viruses, particularly in the absence of immune memory in an exposure-naive species. This has also been elegantly demonstrated recently for influenza virus where avian, but not human influenza virus, is efficiently restricted by human BTN3A3 (ref. 63), which like MX1 (ref. 64) can be overcome by adaptation to the human host. Innate immune evasion has also been linked to the single pandemic human immunodeficiency virus-1 lineage65. Our findings herein have broad implications for understanding zoonotic pathogen emergence because they reveal molecular details of how SARS-CoV-2 Omicron subvariants have achieved dominance, unexpectedly by increasing specific protein expression rather than adapting by protein coding mutation. Crucially, they suggest that improvements in innate immune evasion can continue to enhance transmission, even after establishment in humans. We hypothesize an inevitable ongoing trajectory of adaptation towards escape from the innate immune mechanisms that are the gatekeepers of transmission success.
Methods
Cell culture
Calu-3 cells were purchased from AddexBio (C0016001), Caco-2 cells were a kind gift from Dalan Bailey (Pirbright Institute), Hela-ACE2 cells were a gift from James E. Voss66 and A459 cells expressing ACE2 and TMPRSS2 were previously described22. Cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% heat-inactivated foetal bovine serum (FBS, Labtech) and 100 U ml−1 penicillin–streptomycin. Cells were passaged at 80–90% confluence. For infections, Calu-3 and Caco-2 cells were seeded at 2 × 105 cells ml−1 and Hela-ACE2 cells at 1 × 105 cells ml−1 and grown to 60–80% confluence for experiments1,19. Primary normal (healthy) bronchial epithelial (NHBE-A) cells from two independent donors were cultured for five to seven passages and differentiated at an air–liquid interface as previously described1. After 21–24 days of differentiation, cells were used in infection experiments. Experiments were performed without blinding or randomization.
Viruses
SARS-CoV-2 lineages Alpha (B.1.1.7), Delta (B.1.617.2)21 and Omicron (lineage B.1.1.529.1/BA.1, lineage B.1.1.529.2/BA.2, lineage BA.2.75 (BA.2.75.3) lineage BQ.1.1 (BQ.1.1.1), lineage XBB.1) isolates were a gift from Wendy Barclay (Imperial College London, United Kingdom). Omicron BA.4 (lineage B.1.1.529.4), BA.5 (lineage B.1.1.529.5), BQ.1.1 (B) (BQ.1.1.15) and lineage XBB.1.5 (XBB.1.5.13) were a gift from Alex Sigal and Khadija Khan (Africa Health Research Institute, Durban, South Africa)7,14. SARS-CoV-2 BA.5 (B) (SARS-CoV-2/Norway/20365/2022) was obtained from the Norwegian Institute of Public Health, Oslo, Norway. Omicron isolate identity was confirmed by full genome sequencing and assigned by Nextclade v.2.14.1 (https://clades.nextstrain.org)67,68. Alpha Orf6 deletion virus (Alpha ΔOrf6) was achieved by mutation of the first two methionines: M1L (A27216T) and M19L (A27200T). Reverse genetics-derived viruses were generated as previously described69,70. In brief, to generate the WT SARS-CoV-2 Alpha variant, a set of overlapping viral genomic complementary DNA fragments were chemically synthesized (GENEWIZ). The cDNA fragment representing the 5′ terminus of the viral genome contained the bacteriophage T7 RNA polymerase promoter and the fragment representing the 3′ terminus contained the T7 RNA polymerase termination sequences. These fragments were then assembled into a full-length Alpha cDNA genome using the transformation-associated recombination (TAR) in yeast method69. To generate the Alpha virus carrying the ATG codon changes (M1L and M19L) in its Orf6 gene (to generate Alpha ΔOrf6), the relevant cDNA fragments were chemically synthesized (ThermoFisher) and the mutant viral genome assembled using TAR in yeast as described above. We similarly generated WT BA.5, BA.5 ΔOrf6 (carrying M1L and M19L changes), and BA.5 Orf6 D61L (generated by introducing the GAT → CTC nucleotide change found in BA.2) using TAR in yeast except that the assembled cDNA genomes were placed under the control of the human cytomegalovirus promoter and the relevant termination sequences. The assembled WT and Orf6 null mutant genomes were transfected into BHK-hACE2-N cells stably expressing the SARS-CoV-2 N and the human ACE2 gene for virus rescue71. The rescued viruses were passaged once (P1 stock) in Vero.E6 cells and their full genomes sequenced using Oxford Nanopore as previously described72. For Alpha and BA.5 the RG-derived viruses are referred to as WT, ΔOrf6 or Orf6 D61L to differentiate them from the clinically isolated viruses used in all other experiments. All viruses were propagated by infecting Caco-2 cells in DMEM culture medium supplemented with 1% FBS and 100 U ml−1 penicillin–streptomycin at 37 °C as previously described1,19. Virus was collected at 72 h.p.i. and clarified by centrifugation at 2,100g for 15 min at 4 °C to remove any cellular debris. Virus stocks were aliquoted and stored at −80 °C. Virus stocks were quantified by extracting RNA from 100 μl of supernatant with 1 μg ml−1 carrier RNA using Qiagen RNeasy clean-up RNA protocol, before measuring viral E RNA copies ml−1 by RT–qPCR1,19. For experiments including Omicron subvariants XBB.1 and BQ.1.1, stocks and viral replication were quantified using Nsp12 RNA copies due to accumulation of mutations in the E gene of these variants, including in the region detected by our RT–qPCR assay. Virus titres were determined by TCID50 in Hela-ACE2 cells. A total of 104 cells were seeded in 96-well plates in 100 μl. The next day, seven tenfold serial dilutions of each virus stock or supernatant were prepared and 50 µl was added to the cells in quadruplicate. Cytopathic effect (CPE) was scored at 48–72 h.p.i. TCID50 ml−1 was calculated using the Reed and Muench method, and an Excel spreadsheet created by B. D. Lindenbach was used for calculating TCID50 ml−1 values73.
To generate SARS-CoV-2 lineage frequency plots for BA.1 (B.1.1.529.1), BA.2 (B.1.1.529.2), BA.4 (B.1.1.529.4), BA.5 (B.1.1.529.5), BA.2.75 (B.1.1.529.2.75), BQ.1.1 (B.1.1.529.5.3.1.1.1.1.1.1), XBB.1 and XBB.1.5 (Fig. 4a and Extended Data Fig. 6a), the number of samples sequenced per week worldwide over all time was extracted for each variant on 5 August 2023 from CoV-Spectrum (cov-spectrum.org)74 using genomic data from the Global Initiative on Sharing All Influenza Data (GSAID)75.
Virus culture and infection
For infections, inoculum was calculated using E copies per cell quantified by RT–qPCR. Cells were inoculated with indicated variants for 2 h at 37 °C, subsequently washed with phosphate-buffered saline (PBS), and fresh DMEM culture medium supplemented with 1% FBS and 100 U ml−1 penicillin–streptomycin was added. At the indicated timepoints, cells were collected for analysis. For primary HAE infections, virus was added to the apical side for 2–3 h at 37 °C. Supernatant was then removed, and cells were washed twice with PBS. All liquid was removed from the apical side, and basal medium was replaced with fresh Pneumacult ALI medium for the duration of the experiment. Virus release was measured at the indicated timepoints by extracting viral RNA from apical PBS washes. For poly(I:C) (Sigma) stimulations, cells were transfected with poly(I:C) using Lipofectamine2000 (InvitroGen) in Opti-Mem (Thermo) for the indicated times. For IFN-sensitivity assays, cells were pre-treated with indicated concentrations or recombinant human IFNβ (Peprotech) for 18 h before infection. Cytokines were maintained throughout the experiment. For inhibition assays, cells were pre-treated with 5 μM ruxolitinib (Cambridge Bioscience), 25 μM camostat (Apexbio), 25 μM E64d (Focus Biomolecules) or dimethyl sulfoxide control for 2–3 h before SARS-CoV-2 infection. Inhibitors were maintained throughout the infection.
RT–qPCR of host and viral gene expression in infected cells
Infected cells were lysed in RLT (Qiagen) supplemented with 0.1% β-mercaptoethanol (Sigma). RNA extractions were performed according to the manufacturer’s instructions using RNeasy Micro Kits (Qiagen) including on-column DNAse I treatment (Qiagen). cDNA was synthesized using SuperScript IV (Thermo) with random hexamer primers (Thermo). RT–qPCR was performed using Fast SYBR Green Master Mix (Thermo) for host gene expression and sgRNA expression or TaqMan Master mix (Thermo Fisher Scientific) for viral RNA quantification, and reactions were performed on the QuantStudio 5 Real-Time PCR systems (Thermo Fisher Scientific). Viral E RNA copies were determined as described previously1,19. Viral sgRNAs were detected using the same forward primer against the leader sequence paired with a sgRNA specific reverse primer1,76,77. Using the 2−ΔΔCt method, sgRNA levels were normalized to GAPDH to account for differences in RNA loading and then normalized to the level of Orf1a gRNA quantified in the same way for each variant to account for differences in the level of infection. Host gene expression was determined using the 2−ΔΔCt method and normalized to GAPDH expression. The following probes and primers were used:
GAPDH forward: 5′-ACATCGCTCAGACACCATG-3′, reverse: 5′-TGTAGTTGAGGTCAATGAAGGG-3′; IFNB forward: 5′-GCTTGGATTCCTACAAAGAAGCA-3′, reverse: 5′-ATAGATGGTCAATGCGGCGTC-3′; CXCL10 forward: 5′-TGGCATTCAAGGAGTACCTC-3′, reverse: 5′-TTGTAGCAATGATCTCAACACG-3′; IFIT1 forward: 5′-CCTCCTTGGGTTCGTCTACA-3′, reverse: 5′-GGCTGATATCTGGGTGCCTA-3′; IFIT2 forward: 5′-CAGCTGAGAATTGCACTGCAA-3′, reverse: 5′-CGTAGGCTGCTCTCCAAGGA-3′; MX1 forward: 5′-ATCCTGGGATTTTGGGGCTT-3′, reverse: 5′-CCGCTTGTCGCTGGTGTCG-3′; MX2 forward: 5′-CAGCCACCACCAGGAAAC-3′, reverse 5′-TTCTGCTCGTACTGGCTGTACAG-3′, RSAD2 forward: 5′-CTGTCCGCTGGAAAGTG-3′, reverse: 5′-GCTTCTTCTACACCAACATCC-3′; DDX58 forward: 5′-CTGGACCCTACCTACATCCTG-3′, reverse: 5′-GGCATCCAAAAAGCCACGG-3′. SARS-CoV-2 E Sarbeco forward: 5′- CGTTAATAGTTAATAGCGTACTTCTTTTTC-3′; SARS-CoV-2 E Sarbeco Probe1: 5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-TAMRA-3′; SARS-CoV-2 E Sarbeco reverse 5′-ATATTGCAGCAGTACGCACACA-3′; SARS-CoV-2 Nsp12 forward: 5′-GAGTGAAATGGTCATGTGTGG-3′; SARS-CoV-2 Nsp12 reverse: 5′-CATTGGCCGTGACAGCTTGAC-3′; SARS-CoV-2 Nsp12 Probe: 5′-CTCATCAGGAGATGCCACAACTGCTTATGCTAATAG-3′; 5′ Leader forward: 5′-ACCAACCAACTTTCGATCTCTTGT-3′; Orf1a reverse: 5′-CCTCCACGGAGTCTCCAAAG-3′; Orf6 reverse: GAGGTTTATGATGTAATCAAGATTC; N reverse: 5′-CCAGTTGAATCTGAGGGTCCAC-3′; Orf3a reverse: 5′-GCAGTAGCGCGAACAAAAT-3′; S reverse: 5′-GTCAGGGTAATAAACACCACGTG-3′.
Flow cytometry
Adherent cells were trypsinized and fixed in 4% formaldehyde before intracellular staining for SARS-CoV-2 nucleocapsid (N) protein. For N detection, cells were permeabilized for 15 min with Intracellular Staining Perm Wash Buffer (BioLegend) and subsequently incubated with 1 μg ml−1 CR3009 SARS-CoV-2 cross-reactive antibody (a gift from Laura McCoy) for 30 min at room temperature. Primary antibodies were detected by incubation with secondary AlexaFluor 488-Donkey-anti-Human IgG (Jackson Labs). All samples were acquired on a BD Fortessa X20 or LSR II using BD FACSDiva software. Data were analysed using FlowJo v10.6.2 (Tree Star). Gating strategy is shown in Extended Data Fig. 7.
Cytokine secretion
Secreted mediators were detected in cell culture supernatants by ELISA. IFNβ, IFNλ1/IFNλ3 and CXCL10 were measured using Human IFN-β Quantikine ELISA Kit, Human IL-29/IL-28B (IFNλ1/IFNλ3) DuoSet ELISA or Human CXCL10/IP-10 DuoSet ELISA reagents (Bio-Techne R&D Systems) according to the manufacturer’s instructions.
Western blotting
For detection of N, Orf6, Orf9b, spike and β-actin expression, whole-cell protein lysates were extracted with RIPA buffer, and then separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis, transferred onto nitrocellulose and blocked in PBS with 0.05% Tween 20 and 5% skimmed milk. Membranes were probed with rabbit-anti-SARS spike (Invitrogen, PA1-411-1165, 1:1,000), mouse-anti-SARS-CoV-2 spike (GeneTex, 1A9, 1:1,000), rabbit-anti-Orf6 (Abnova, PAB31757, 1:1,000), rabbit-anti-Orf9b (ProSci, 9191, 1:1,000), CR3009 SARS-CoV cross-reactive human-anti-N antibody (a gift from Laura McCoy, UCL, 1:1,000), rabbit-anti-phospho-STAT1 (Ser727; Cell Signaling, cat. no. 9177, 1:1,000), rabbit-anti-phospho-STAT1 (Tyr701; Cell Signaling, cat. no. 9167, clone 58D6, 1:1,000), rabbit-anti-STAT1 (Cell Signaling, cat. no. 9172, 1:1,000), rabbit-anti-IRF3 (Cell Signaling, cat. no. 4302, 1:1,000), rabbit-anti-phospho-IRF3 (Cell Signaling, cat. no. 29047, clone D6O1M, 1:1,000) and rabbit-anti-β-actin (A2066, Sigma, 1:2,500), followed by IRDye 800CW or 680RD secondary antibodies (Abcam, goat anti-rabbit, goat anti-mouse or goat anti-human, 1:10,000). Blots were imaged using an Odyssey Infrared Imager (LI-COR Biosciences) and analysed with Image Studio Lite software. Quantifications were performed to loading controls run on the same membrane as the protein of interest. For virion blots, live virus normalized by equal total E copies was purified across a 25% sucrose cushion and concentrated by centrifugation (2 h 16,500g, 4 °C).
Immunofluorescence staining and image analysis
Infected cells were fixed using 4% paraformaldehyde/formaldehyde for 1 h at room temperature and subsequently washed with PBS. A blocking step was carried out for 35 h at room temperature with 10% goat serum/1% bovine serum albumin/0.001 Triton X-100 in PBS. Double-stranded RNA (dsRNA) and nucleocapsid detection were performed by primary incubation with rabbit-anti-IRF3 antibody (sc-33641, Santa Cruz, 1:100), rabbit-anti-STAT1 (Cell Signaling, cat. no. 14994, clone D1K9Y, 1:100), mouse-anti-dsRNA (MABE1134, Millipore, 1:100) and CR3009 SARS-CoV cross-reactive human-anti-N antibodies (1:1,000) for 18 h and washed thoroughly in PBS. Primary antibodies detection occurred using secondary anti-rabbit-AlexaFluor-488, anti-mouse-AlexaFluor-568 and anti-human-Alexa647 conjugates (Jackson ImmunoResearch, 1:500) for 1 h. All cells were labelled with Hoechst33342 (H3570, Thermo Fisher, 1:5,000). Images were acquired using the WiScan Hermes 7-Colour High-Content Imaging System (IDEA Bio-Medical) at magnification 10×/0.4 numerical aperture. Four-channel automated acquisition was carried out sequentially. Images were acquired across a well area density resulting in 31 fields of view per well and ~20,000 cells. Images were pre-processed by applying a batch rolling ball background correction in FIJI ImageJ software package78 before quantification. IRF3 and STAT1 translocation analysis was carried out using the Athena Image analysis software (IDEA Bio-Medical) and data post-processed in Python. For dsRNA, infected cell populations were determined by thresholding of populations with more than two segmented dsRNA punctae. For transcription factor translocation analysis, infected populations were determined by presence of segmented nucleocapsid signal within the cell.
Image pre-processing was carried out using a custom macro applying a 30-pixel rolling ball background subtraction to all channels. Single-cell automated image analysis was carried out using the Athena image analysis software ‘Nuclear Translocation Assay’79 (IDEA-BioMedical). Within the Athena software, nuclei were segmented using the Hoechst33342 channel, and dsRNA/N channels were segmented as ‘cytoplasmic granules’ thresholded according to the mock infected population to identify infected cells. The cellular periphery was segmented by STAT1/IRF3 channels. The raw single-cell data were processed in a Python 3 script using the Pandas Data analysis library (https://pandas.pydata.org). In short, the mean nuclear:cytoplasmic ratio was calculated from the raw data. The data were ‘top and tail’ filtered, dropping the lowest and highest percentile for the following metrics: cell area, nuclear area, mean nuclear intensity and mean cytoplasmic intensity (STAT1/IRF3). The data were filtered into ‘infected cells’ by the presence of segmented cytoplasmic granules (dsRNA/N) or ‘bystander cells’ for their absence. The filtered data were then randomly sampled in the same Python environment. ImageJ macro and Python post-processing pipelines are available upon request.
Statistical analysis
Statistical analysis was performed using GraphPad Prism9, and details of statistical tests used are indicated. Data distribution was assumed to be normal unless stated differently, but this was not formally tested. No statistical methods were used to pre-determine sample sizes, but our sample sizes are similar to those reported in previous publications1,19. Data collection and analysis were not performed blind to the conditions of the experiments.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Supplementary information
Source data
Acknowledgements
This work was funded by Wellcome Investigator Awards 223065 to C.J. and 220863 to G.J.T. G.J.T. and C.J. were also funded by MRC/UKRI G2P-UK and G2P2 National Virology consortia (MR/W005611/1 and MR/Y004205/1) and the UCL COVID-19 fund. R.R. is supported by a Marie Skłodowska-Curie Individual Fellowships no. 896014. P.B. received funding from the European Research Council (ERC-Stg no. 639429), the Rosetrees Trust (M362-F1; M553), the NIHR GOSH BRC and the CF Trust (SRC006; SRC020). M.V.X.W. is supported by a Wellcome Trust Early Career Award Fellowship (227004/Z/23/Z), the NIHR Biomedical Research Centre at UCLH and IDEA Bio-Medical. The work at the CVR was funded by G2P-UK National Virology Consortium funded by the MRC (MR/W005611/1) and MRC grants (MC_UU12014/2 and MC_UU_00034/9) and the Wellcome Trust (206369/Z/17/Z). We are grateful to W. Barclay (Imperial College London, United Kingdom), A. Sigal and K. Khan (AHRI, South Africa) and the Norwegian Institute of Public Health for provision of virus isolates and D. Bailey (Pirbright Institute, United Kingdom), L. McCoy (University College London, United Kingdom) and J. Voss (Scripps Institute, United States) for reagents. We thank J. Evans (University College London, United Kingdom) for their assistance at the UCL Rayne flow cytometry core facility.
Extended data
Author contributions
A.-K.R., L.G.T., G.J.T. and C.J. conceptualized the study. A.-K.R, L.G.T., V.M.C., W.F., G.D.L., G.J.T. and C.J. designed experiments. A.-K.R., L.G.T., M.X.V.W., D.M., G.D., N.B., V.M.C., W.F. and G.D.L. performed experiments. A.-K.R., L.G.T., M.X.V.W., G.J.T. and C.J. analysed data. A.-K.R., R.R., W.F., G.D.L., V.M.C., J.L.E.T., P.B., M.P. and A.H.P. generated and provided reagents. A.-K.R., L.G.T., D.M., A.H.P., M.P., G.J.T. and C.J. prepared and edited the paper. P.B., M.P., A.H.P., G.J.T. and C.J. coordinated and supervised the study.
Peer review
Peer review information
Nature Microbiology thanks Xing-Yi Ge, Natalia Sampaio, Xiangxi Wang and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.
Data availability
All data generated or analysed during this study are included in this paper (and its Supplementary Information files). No datapoints were excluded. Representative microscopy images can be accessed through FigShare via 10.6084/m9.figshare.24781893.v180. SARS-CoV-2 variant sequence counts were extracted from CoV-Spectrum (cov-spectrum.org)74 using genomic data from GISAID75. Source data are provided with this paper.
Code availability
The ImageJ macro and Python post-processing pipelines are available at https://github.com/MattVXWhelan/Reuschl_et_al_Nature_Micro.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Clare Jolly, Greg J. Towers.
Contributor Information
Ann-Kathrin Reuschl, Email: a.reuschl@ucl.ac.uk.
Clare Jolly, Email: c.jolly@ucl.ac.uk.
Greg J. Towers, Email: g.towers@ucl.ac.uk
Extended data
is available for this paper at 10.1038/s41564-023-01588-4.
Supplementary information
The online version contains supplementary material available at 10.1038/s41564-023-01588-4.
References
- 1.Thorne LG, et al. Evolution of enhanced innate immune evasion by SARS-CoV-2. Nature. 2022;602:487–495. doi: 10.1038/s41586-021-04352-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bouhaddou M, et al. SARS-CoV-2 variants evolve convergent strategies to remodel the host response. Cell. 2023;186:4597–4614.e26. doi: 10.1016/j.cell.2023.08.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hansen CH, et al. Risk of reinfection, vaccine protection, and severity of infection with the BA.5 omicron subvariant: a nation-wide population-based study in Denmark. Lancet Infect. Dis. 2023;23:167–176. doi: 10.1016/S1473-3099(22)00595-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wolter N, et al. Early assessment of the clinical severity of the SARS-CoV-2 omicron variant in South Africa: a data linkage study. Lancet. 2022;399:437–446. doi: 10.1016/S0140-6736(22)00017-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Viana R, et al. Rapid epidemic expansion of the SARS-CoV-2 Omicron variant in southern Africa. Nature. 2022;603:679–686. doi: 10.1038/s41586-022-04411-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Pulliam JRC, et al. Increased risk of SARS-CoV-2 reinfection associated with emergence of Omicron in South Africa. Science. 2022;376:eabn4947. doi: 10.1126/science.abn4947. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Tegally H, et al. Emergence of SARS-CoV-2 Omicron lineages BA.4 and BA.5 in South Africa. Nat. Med. 2022;28:1785–1790. doi: 10.1038/s41591-022-01911-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cao Y, et al. BA.2.12.1, BA.4 and BA.5 escape antibodies elicited by Omicron infection. Nature. 2022;608:593–602. doi: 10.1038/s41586-022-04980-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gruell H, et al. SARS-CoV-2 Omicron sublineages exhibit distinct antibody escape patterns. Cell Host Microbe. 2022;30:1231–1241.e6. doi: 10.1016/j.chom.2022.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Wang Q, et al. Antibody evasion by SARS-CoV-2 Omicron subvariants BA.2.12.1, BA.4 and BA.5. Nature. 2022;608:603–608. doi: 10.1038/s41586-022-05053-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tuekprakhon A, et al. Antibody escape of SARS-CoV-2 Omicron BA.4 and BA.5 from vaccine and BA.1 serum. Cell. 2022;185:2422–2433.e13. doi: 10.1016/j.cell.2022.06.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Willett, B. J. et al. Distinct antigenic properties of the SARS-CoV-2 Omicron lineages BA.4 and BA.5. Preprint at bioRxiv10.1101/2022.05.25.493397 (2022).
- 13.Kimura I, et al. Virological characteristics of the SARS-CoV-2 Omicron BA.2 subvariants, including BA.4 and BA.5. Cell. 2022;185:3992–4007.e16. doi: 10.1016/j.cell.2022.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Khan K, et al. Omicron BA.4/BA.5 escape neutralizing immunity elicited by BA.1 infection. Nat. Commun. 2022;13:4686. doi: 10.1038/s41467-022-32396-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Steel, K., Fordham, E. & Bracher, M. Coronavirus (COVID-19) Infection Survey, UK. Office for National Statisticshttps://www.ons.gov.uk/peoplepopulationandcommunity/healthandsocialcare/conditionsanddiseases/bulletins/coronaviruscovid19infectionsurveypilot/8july2022 (2022).
- 16.Hachmann NP, et al. Neutralization escape by SARS-CoV-2 Omicron subvariants BA.2.12.1, BA.4, and BA.5. N. Engl. J. Med. 2022;387:86–88. doi: 10.1056/NEJMc2206576. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Chen D-Y, et al. Spike and nsp6 are key determinants of SARS-CoV-2 Omicron BA.1 attenuation. Nature. 2023;615:143–150. doi: 10.1038/s41586-023-05697-2. [DOI] [PubMed] [Google Scholar]
- 18.Hossain A, Akter S, Rashid AA, Khair S, Alam ASMRU. Unique mutations in SARS-CoV-2 Omicron subvariants’ non-spike proteins: potential impacts on viral pathogenesis and host immune evasion. Microb. Pathog. 2022;170:105699. doi: 10.1016/j.micpath.2022.105699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Thorne LG, et al. SARS-CoV-2 sensing by RIG-I and MDA5 links epithelial infection to macrophage inflammation. EMBO J. 2021;40:e107826. doi: 10.15252/embj.2021107826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Meng B, et al. Altered TMPRSS2 usage by SARS-CoV-2 Omicron impacts infectivity and fusogenicity. Nature. 2022;603:706–714. doi: 10.1038/s41586-022-04474-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Peacock TP, et al. The altered entry pathway and antigenic distance of the SARS-CoV-2 Omicron variant map to separate domains of spike protein. bioRxiv. 2022 doi: 10.1101/2021.12.31.474653. [DOI] [Google Scholar]
- 22.Willett BJ, et al. SARS-CoV-2 Omicron is an immune escape variant with an altered cell entry pathway. Nat. Microbiol. 2022;7:1161–1179. doi: 10.1038/s41564-022-01143-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mesner D, et al. SARS-CoV-2 evolution influences GBP and IFITM sensitivity. Proc. Natl Acad. Sci. USA. 2023;120:e2212577120. doi: 10.1073/pnas.2212577120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hoffmann M, Kleine-Weber H, Pöhlmann S. A multibasic cleavage site in the spike protein of SARS-CoV-2 is essential for infection of human lung cells. Mol. Cell. 2020;78:779–784.e5. doi: 10.1016/j.molcel.2020.04.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hoffmann M, et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell. 2020;181:271–280.e8. doi: 10.1016/j.cell.2020.02.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Stanifer ML, et al. Critical role of type III interferon in controlling SARS-CoV-2 infection in human intestinal epithelial cells. Cell Rep. 2020;32:107863. doi: 10.1016/j.celrep.2020.107863. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.V’kovski P, et al. Disparate temperature-dependent virus–host dynamics for SARS-CoV-2 and SARS-CoV in the human respiratory epithelium. PLoS Biol. 2021;19:e3001158. doi: 10.1371/journal.pbio.3001158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Foxman EF, Storer JA, Vanaja K, Levchenko A, Iwasaki A. Two interferon-independent double-stranded RNA-induced host defense strategies suppress the common cold virus at warm temperature. Proc. Natl Acad. Sci. USA. 2016;113:8496–8501. doi: 10.1073/pnas.1601942113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Foxman EF, et al. Temperature-dependent innate defense against the common cold virus limits viral replication at warm temperature in mouse airway cells. Proc. Natl Acad. Sci. USA. 2015;112:827–832. doi: 10.1073/pnas.1411030112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Huang D, et al. Cold exposure impairs extracellular vesicle swarm–mediated nasal antiviral immunity. J. Allergy Clin. Immunol. 2023;151:509–525.e8. doi: 10.1016/j.jaci.2022.09.037. [DOI] [PubMed] [Google Scholar]
- 31.Khosravi M, et al. A distinct difference between air and mucosal temperatures in human respiratory tract. Front. Med. 2021;8:650637. doi: 10.3389/fmed.2021.650637. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kehrer T, et al. Impact of SARS-CoV-2 ORF6 and its variant polymorphisms on host responses and viral pathogenesis. Cell Host Microbe. 2023;31:1668–1684. doi: 10.1016/j.chom.2023.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sadzak I, et al. Recruitment of Stat1 to chromatin is required for interferon-induced serine phosphorylation of Stat1 transactivation domain. Proc. Natl Acad. Sci. USA. 2008;105:8944–8949. doi: 10.1073/pnas.0801794105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kimura I, Konno Y, Sauter D, Nakagawa S, Sato K. Sarbecovirus ORF6 proteins hamper the induction of interferon signaling by blocking mRNA nuclear export. Cell Rep. 2021;34:108916. doi: 10.1016/j.celrep.2021.108916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Miorin L, et al. SARS-CoV-2 Orf6 hijacks Nup98 to block STAT nuclear import and antagonize interferon signaling. Proc. Natl Acad. Sci. USA. 2020;117:28344–28354. doi: 10.1073/pnas.2016650117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Lei X, et al. Activation and evasion of type I interferon responses by SARS-CoV-2. Nat. Commun. 2020;11:3810. doi: 10.1038/s41467-020-17665-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kimura I, et al. Sarbecovirus ORF6 proteins hamper induction of interferon signaling. Cell Rep. 2021;34:108916. doi: 10.1016/j.celrep.2021.108916. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Addetia A, et al. SARS-CoV-2 ORF6 disrupts bidirectional nucleocytoplasmic transport through interactions with Rae1 and Nup98. mBio. 2021;12:e00065–21. doi: 10.1128/mBio.00065-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Gori Savellini G, Anichini G, Cusi MG. SARS-CoV-2 omicron sub-lineages differentially modulate interferon response in human lung epithelial cells. Virus Res. 2023;332:199134. doi: 10.1016/j.virusres.2023.199134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Saito A, et al. Virological characteristics of the SARS-CoV-2 Omicron BA.2.75 variant. Cell Host Microbe. 2022;30:1540–1555.e15. doi: 10.1016/j.chom.2022.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Tamura T, et al. Virological characteristics of the SARS-CoV-2 XBB variant derived from recombination of two Omicron subvariants. Nat. Commun. 2023;14:2800. doi: 10.1038/s41467-023-38435-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Uriu K, et al. Enhanced transmissibility, infectivity, and immune resistance of the SARS-CoV-2 omicron XBB.1.5 variant. Lancet Infect. Dis. 2023;23:280–281. doi: 10.1016/S1473-3099(23)00051-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ito J, et al. Convergent evolution of SARS-CoV-2 Omicron subvariants leading to the emergence of BQ.1.1 variant. Nat. Commun. 2023;14:2671. doi: 10.1038/s41467-023-38188-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Cheemarla NR, et al. Dynamic innate immune response determines susceptibility to SARS-CoV-2 infection and early replication kinetics. J. Exp. Med. 2021;218:e20210583. doi: 10.1084/jem.20210583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Loske J, et al. Pre-activated antiviral innate immunity in the upper airways controls early SARS-CoV-2 infection in children. Nat. Biotechnol. 2022;40:319–324. doi: 10.1038/s41587-021-01037-9. [DOI] [PubMed] [Google Scholar]
- 46.Park A, Iwasaki A. Type I and type III interferons—induction, signaling, evasion, and application to combat COVID-19. Cell Host Microbe. 2020;27:870–878. doi: 10.1016/j.chom.2020.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Zhang Q, et al. Inborn errors of type I IFN immunity in patients with life-threatening COVID-19. Science. 2020;370:eabd4570. doi: 10.1126/science.abd4570. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Bastard P, et al. Autoantibodies against type I IFNs in patients with life-threatening COVID-19. Science. 2020;370:eabd4585. doi: 10.1126/science.abd4585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Pairo-Castineira E, et al. Genetic mechanisms of critical illness in COVID-19. Nature. 2021;591:92–98. doi: 10.1038/s41586-020-03065-y. [DOI] [PubMed] [Google Scholar]
- 50.Zhang Q, Bastard P. Human genetic and immunological determinants of critical COVID-19 pneumonia. Nature. 2022;603:587–598. doi: 10.1038/s41586-022-04447-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Wickenhagen A, et al. A prenylated dsRNA sensor protects against severe COVID-19. Science. 2021;374:eabj3624. doi: 10.1126/science.abj3624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Selvaraj V, et al. Baricitinib in hospitalised patients with COVID-19: a meta-analysis of randomised controlled trials. eClinicalMedicine. 2022;49:101489. doi: 10.1016/j.eclinm.2022.101489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Sandler NG, et al. Type I interferon responses in rhesus macaques prevent SIV infection and slow disease progression. Nature. 2014;511:601–605. doi: 10.1038/nature13554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Killingley B, et al. Safety, tolerability and viral kinetics during SARS-CoV-2 human challenge in young adults. Nat. Med. 2022;28:1031–1041. doi: 10.1038/s41591-022-01780-9. [DOI] [PubMed] [Google Scholar]
- 55.Rosenheim J, et al. SARS-CoV-2 human challenge reveals single-gene blood transcriptional biomarkers that discriminate early and late phases of acute respiratory viral infections. medRxiv. 2023 doi: 10.1101/2023.06.01.23290819. [DOI] [Google Scholar]
- 56.Brant AC, Tian W, Majerciak V, Yang W, Zheng Z-M. SARS-CoV-2: from its discovery to genome structure, transcription, and replication. Cell Biosci. 2021;11:136. doi: 10.1186/s13578-021-00643-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Pagani I, Ghezzi S, Alberti S, Poli G, Vicenzi E. Origin and evolution of SARS-CoV-2. Eur. Phys. J. 2023;138:157. doi: 10.1140/epjp/s13360-023-03719-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Silvas JA, et al. Contribution of SARS-CoV-2 accessory proteins to viral pathogenicity in K18 human ACE2 transgenic mice. J. Virol. 2021 doi: 10.1128/jvi.00402-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Chin AWH, Lai AMY, Peiris M, Man Poon LL. Increased stability of SARS-CoV-2 omicron variant over ancestral strain. Emerg. Infect. Dis. 2022;28:1515–1517. doi: 10.3201/eid2807.220428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Hirose R, et al. Differences in environmental stability among SARS-CoV-2 variants of concern: both omicron BA.1 and BA.2 have higher stability. Clin. Microbiol. Infect. 2022;28:1486–1491. doi: 10.1016/j.cmi.2022.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.SARS-ANI VIS. Complexity Science Hubhttps://vis.csh.ac.at/sars-ani/ (2022).
- 62.Lee IT, et al. ACE2 localizes to the respiratory cilia and is not increased by ACE inhibitors or ARBs. Nat. Commun. 2020;11:1–14. doi: 10.1038/s41467-020-19145-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Pinto RM, et al. BTN3A3 evasion promotes the zoonotic potential of influenza A viruses. Nature. 2023;619:338–347. doi: 10.1038/s41586-023-06261-8. [DOI] [PubMed] [Google Scholar]
- 64.Riegger D, et al. The nucleoprotein of newly emerged H7N9 influenza A virus harbors a unique motif conferring resistance to antiviral human MxA. J. Virol. 2014 doi: 10.1128/jvi.02406-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Zuliani-Alvarez L, et al. Evasion of cGAS and TRIM5 defines pandemic HIV. Nat. Microbiol. 2022;7:1762–1776. doi: 10.1038/s41564-022-01247-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Rogers TF, et al. Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model. Science. 2020;369:956–963. doi: 10.1126/science.abc7520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Hadfield J, et al. Nextstrain: real-time tracking of pathogen evolution. Bioinformatics. 2018;34:4121–4123. doi: 10.1093/bioinformatics/bty407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Aksamentov I, Roemer C, Hodcroft E, Neher R. Nextclade: clade assignment, mutation calling and quality control for viral genomes. J. Open Source Softw. 2021;6:3773. doi: 10.21105/joss.03773. [DOI] [Google Scholar]
- 69.Zhou J, et al. Mutations that adapt SARS-CoV-2 to mink or ferret do not increase fitness in the human airway. Cell Rep. 2022;38:110344. doi: 10.1016/j.celrep.2022.110344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Thi Nhu Thao T, et al. Rapid reconstruction of SARS-CoV-2 using a synthetic genomics platform. Nature. 2020;582:561–565. doi: 10.1038/s41586-020-2294-9. [DOI] [PubMed] [Google Scholar]
- 71.Rihn SJ, et al. A plasmid DNA-launched SARS-CoV-2 reverse genetics system and coronavirus toolkit for COVID-19 research. PLoS Biol. 2021;19:e3001091. doi: 10.1371/journal.pbio.3001091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.da Silva Filipe A, et al. Genomic epidemiology reveals multiple introductions of SARS-CoV-2 from mainland Europe into Scotland. Nat. Microbiol. 2021;6:112–122. doi: 10.1038/s41564-020-00838-z. [DOI] [PubMed] [Google Scholar]
- 73.Lindenbach BD. Measuring HCV infectivity produced in cell culture and in vivo. Hepat. C. 2009;510:329–336. doi: 10.1007/978-1-59745-394-3_24. [DOI] [PubMed] [Google Scholar]
- 74.Chen C, et al. CoV-Spectrum: analysis of globally shared SARS-CoV-2 data to identify and characterize new variants. Bioinformatics. 2022;38:1735–1737. doi: 10.1093/bioinformatics/btab856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Elbe S, Buckland-Merrett G. Data, disease and diplomacy: GISAID’s innovative contribution to global health. Glob. Chall. 2017;1:33–46. doi: 10.1002/gch2.1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Parker MD, et al. Altered subgenomic RNA abundance provides unique insight into SARS-CoV-2 B.1.1.7/Alpha variant infections. Commun. Biol. 2022;5:666. doi: 10.1038/s42003-022-03565-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Meredith LW, et al. Rapid implementation of SARS-CoV-2 sequencing to investigate cases of health-care associated COVID-19: a prospective genomic surveillance study. Lancet Infect. Dis. 2020;20:1263–1271. doi: 10.1016/S1473-3099(20)30562-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Schindelin J, et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Cytoplasm to nuclear translocation assay. IDEA Bio-Medicalhttps://idea-bio.com/all-applications/application-nuclear-translocation/
- 80.Reuschl, A.-K. Evolution of enhanced innate immune suppression by SARS-CoV-2 Omicron subvariants. figshare10.6084/m9.figshare.24781893.v1 (2023). [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All data generated or analysed during this study are included in this paper (and its Supplementary Information files). No datapoints were excluded. Representative microscopy images can be accessed through FigShare via 10.6084/m9.figshare.24781893.v180. SARS-CoV-2 variant sequence counts were extracted from CoV-Spectrum (cov-spectrum.org)74 using genomic data from GISAID75. Source data are provided with this paper.
The ImageJ macro and Python post-processing pipelines are available at https://github.com/MattVXWhelan/Reuschl_et_al_Nature_Micro.