NorA efflux pump mediates Staphylococcus aureus response to Pseudomonas aeruginosa pyocyanin toxicity

ABSTRACT

Endogenous transporters protect Staphylococcus aureus against antibiotics and also contribute to bacterial defense from environmental toxins. We evaluated the effect of overexpression of four efflux pumps, NorA, NorB, NorC, and Tet38, on S. aureus survival following exposure to pyocyanin (PYO) of Pseudomonas aeruginosa, using a well diffusion assay. We measured the PYO-created inhibition zone and found that only an overexpression of NorA reduced S. aureus susceptibility to pyocyanin killing. The MIC_PYO of the NorA overexpressor increased threefold compared to that of wild-type RN6390 and was reduced 2.5-fold with reserpine, suggesting that increased NorA efflux caused PYO resistance. The PYO-created inhibition zone of a ΔnorA mutant was consistently larger than that of a plasmid-borne NorA overexpressor. PYO also produced a modest increase in norA expression (1.8-fold at 0.25 µg/mL PYO) that gradually decreased with increasing PYO concentrations. Well diffusion assays carried out using P. aeruginosa showed that ΔnorA mutant was less susceptible to killing by PYO-deficient mutants PA14_phzM and PA14_phzS than to killing by PA14. NorA overexpression led to reduced killing by all tested P. aeruginosa. We evaluated the NorA–PYO interaction using a collection of 22 clinical isolates from adult and pediatric cystic fibrosis (CF) patients, which included both S. aureus (CF-SA) and P. aeruginosa (CF-PA). We found that when isolated alone, CF-PA and CF-SA expressed varying levels of PYO and norA transcripts, but all four CF-PA/CF-SA pairs isolated concurrently from CF patients produced a low level of PYO and low norA transcript levels, respectively, suggesting a partial adaptation of the two bacteria in circumstances of persistent co-colonization.

INTRODUCTION

Staphylococcus aureus and Pseudomonas aeruginosa are two of the most common human pathogens that are isolated from both the sputum of cystic fibrosis (CF) patients as well as chronically infected wounds such as diabetic foot ulcers, burns, and surgical wounds (1–3). The interactions of S. aureus and P. aeruginosa have been extensively studied in models of CF lung infection (1, 4). Epidemiologic tracking reveals a temporal relationship wherein early colonization by S. aureus is followed by a later occupation by P. aeruginosa (5). The competition between the two pathogens resulted in a rapid takeover by P. aeruginosa with an exclusion of S. aureus in the CF lung (6–8). P. aeruginosa is known to secrete exoproducts that inhibit S. aureus growth and generate the formation of small colony variants (SCVs). Conversely, the protein A (Spa) of S. aureus interferes with specific P. aeruginosa clinical isolate biofilm formation and inhibited phagocytosis by host neutrophils. Both of these events are facilitated by binding to P. aeruginosa cell surface structures (9). Despite the antagonistic interactions known to occur between S. aureus and P. aeruginosa (10–12), during co-habitation, each pathogen contributes independently and cumulatively to the severity of disease (13, 14).

Important extracellular virulence factors produced by P. aeruginosa include pigments called phenazines, which are known to affect disease progression (15). Pyocyanin (PYO) is a major phenazine pigment synthesized by 95% of P. aeruginosa strains. PYO is known to affect various organ systems such as the respiratory, cardiovascular, urological, and central nervous systems due to its ability to induce oxidative stress by increasing the intracellular levels of reactive oxygen species (ROS) (16, 17). In the lung, PYO can also cause epithelial dysfunction by disrupting ciliary beating, which is necessary for mucus clearance, thereby contributing to additional harm from P. aeruginosa colonization within the lung (18).

PYO has a dose-dependent bactericidal activity against many Gram-positive and Gram-negative bacteria including S. aureus and E. coli. The biosynthesis of PYO requires the products of two genes, phzM and phzS. The enzyme PhzM first converts phenazine-1-carboxylic acid (PCA) to 5-methylphenazine-1- carboxylic acid (5-Me-PCA), followed by the conversion of 5-Me-PCA to PYO, by the enzyme PhzS (19, 20). The color of PYO pigment varies depending on pH as well as redox state, turning PYO blue when in its oxidized form (pH>pKa), colorless in monovalent reduced form, or red in divalent reduced form (pH<pKa). The unique redox potential of PYO allows this pigment to accept a single electron to become reduced and then passes the electron to oxygen (O₂) to increase the level of O₂⁻ and H₂O₂ in the bacterial cells. This production of ROS by PYO results in bactericidal activity of both respiring S. aureus as well as S. aureus SCVs (15, 21).

PYO exists as a zwitterion at blood pH (7.35–7.45), allowing it to cross the cell membrane and toxically accumulate in the cytoplasm. The defense mechanisms deployed by S. aureus to survive pyocyanin are not well understood. Sakhtah et al. reported that P. aeruginosa expressed the RND-type efflux pump MexGHI-OpmD to transport the natural phenazine 5-Me-PCA across the cell membrane, demonstrating an efflux-based self-resistance system in P. aeruginosa (20). Nevertheless, efflux as a mechanism of protection from PYO is not fully understood.

To further investigate the role of efflux in protection, we studied S. aureus efflux pumps and transporters to identify candidates that could counter the growth inhibition effect of PYO. We found the most promising candidate to be the S. aureus NorA efflux pump, a 12-transmembrane segment and chromosomally encoded MDR efflux pump of the major facilitator superfamily (MFS) of transporters. As a key drug/H⁺ antiporter, NorA facilitates the active efflux of fluoroquinolones such as norfloxacin and ciprofloxacin from S. aureus cells in exchange for protons and conferring low-level resistance to quinolones (22, 23). When overexpressed, NorA extrudes other structurally unrelated compounds such as cetrimide, ethidium bromide, tetraphenylphosphonium, rhodamine, acridine, and biocides. The direct relationship between P. aeruginosa and S. aureus NorA expression and the resultant impact not only on S. aureus survival but also on antibiotic resistance has not previously been fully investigated. Further research, however, may highlight a critical challenge in antimicrobial resistance.

In this study, we used a well diffusion assay combined with MIC testing and a PYO chloroform extraction technique (24, 25) to demonstrate that PYO produced by P. aeruginosa inhibited the growth of S. aureus wild-type RN6390 and a ΔnorA mutant. This growth inhibition effect was reduced when NorA was overexpressed from a plasmid in host RN6390. The toxicity of PYO against S. aureus was dose dependent, and we observed an induction effect of PYO on the transcription of norA albeit at a modest level. Most notably, PYO-deficient mutants phzM and phzS of P. aeruginosa PA14 were less effective in ΔnorA mutant killing when compared to that of PA14, which confirmed the relationship between NorA and PYO.

In evaluating a correlation between S. aureus NorA overexpression against P. aeruginosa PYO production in CF isolates, we found that the CF-associated P. aeruginosa (CF-PA) strains that were concurrently cultured with CF-associated S. aureus (CF-SA) strains produced much less PYO while the CF-SA of each pair expressed a low level of norA transcripts. This phenomenon could partially explain an adaptive mechanism that allows the two pathogens to coexist in some CF patients.

RESULTS

PYO inhibited S. aureus growth

The growth inhibition activity of PYO against the wild-type S. aureus strain RN6390 was assessed using a previously described well diffusion technique in which zones of inhibition were measured around agar wells containing increasing concentrations of PYO within a lawn of S. aureus RN6390 spread on Luria-Bertani (LB) agar plates (24, 26). The results indicated that PYO inhibited the growth of RN6390 in a dose-dependent manner, with inhibition zones ranging from 12 to 44 mm at PYO concentrations ranging from 2 to 10 µg/mL (Fig. 1A). The difference in diameter between the inhibition zones caused by PYO at 5 and 7 µg/mL was minor.

Fig 1.

Dose-dependent inhibition effect of PYO on the growth of S. aureus RN6390. The experiments were done in triplicate with three independent biological samples. (A) PYO-created zones of inhibition against a lawn of RN6390. PYO concentrations in micrograms per milliliter and zones of inhibition in millimeters. (B) Growth of RN6390 on LB agar containing PYO at concentrations 2, 5, 7, and 10 µg/mL. A total of 10⁶ CFU of RN6390 were spread on a series of PYO-supplemented LB plates. The RN6390 CFU decreased in function of increasing PYO concentrations. PYO-created zones of inhibition on a lawn of RN6390 were inversely correlated with an RN6390 growth in PYO-incorporated LB plates. The error bars indicate the mean ± standard deviation (SD). The differences in diameters of inhibition zones and CFU data at PYO concentrations of 2, 5, and 10 µg/mL were statistically significant, as determined by a one-way analysis of variance with Tukey’s multiple comparisons (P < 0.0001). The differences in diameters of inhibition zones and CFU data at PYO concentrations of 5 and 7 µg/mL were not statistically significant. To facilitate the comparison between the diameters of the inhibition zones with the CFU per milliliter represented in (C), the diameters of the inhibition zones were shown in centimeters only in (C).

To validate the well diffusion method, we modified a previously described growth assay (27). A series of PYO-incorporated LB plates were prepared with PYO concentrations ranging from 2 to 10 µg/mL. A total of 10⁶ CFU of RN6390 (6-log₁₀) per plate were spread evenly and incubated at 37°C for 16 hours. The number of surviving bacteria from the initial 10⁶ CFU per plate was counted and compared with the diameter of the PYO-created inhibition zone of the well diffusion assay at the same PYO concentration (Fig. 1B and C).

We determined the CFU of RN6390 at each PYO concentration and found an inverse correlation between RN6390 CFU (6-log₁₀ to 0) and the diameter of the inhibition zones (12 to 40 mm) (Fig. 1C, Pearson correlation, r = −0.97; P < 0.0001). The number of RN6390 exposed to PYO at 2, 5, 7, and 10 µg/mL was ~10⁶ (too numerous to count (TNTC)), 473, 300, and 0 bacteria, respectively (Fig. 1B and C). The differences between the number of RN6390 exposed to PYO at 5 and 10 µg/mL or at 7 and 10 µg/mL were statistically significant, as determined by an ordinary one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons (P < 0.0001).

We also determined the MIC of PYO (MIC_PYO) of RN6390 using the broth microdilution technique that showed a value of 8 µg/mL.

NorA efflux pump affected S. aureus susceptibility to PYO

Overexpression of norA reduced S. aureus susceptibility to PYO

To determine if the four previously identified S. aureus efflux pumps norA, norB, norC, and tet38 could affect the toxicity of PYO (28–30), we carried out the well diffusion assay using a series of efflux pump plasmid-encoded overexpressors and a range of PYO concentrations from 5 to 20 µg/mL. Figure 2A shows dose-dependent anti-staphylococcal activity of PYO against RN6390(pLI50-norA), RN6390(pLI50-norB), RN6390(pLI50-norC), and RN6390(pLI50-tet38) (ANOVA, P < 0.0001).

Fig 2.

Dose-dependent inhibition effect of PYO on the growth of S. aureus RN6390, NorA, NorB, NorC, and Tet38 overexpressors. The experiments were done in triplicate with three independent biological samples. (A) Diameters (in millimeters) of the zones of inhibition of RN6390(pLI50), RN6390(pLI50-norA), RN6390(pLI50-norB), RN6390(pLI50-norC), and RN6390(pLI50-tet38) in function of PYO concentrations at 5, 10, and 20 µg/mL. The error bars represent the mean ± SD. The differences in diameters of the inhibition zones between RN6390(pLI50) and RN6390(pLI50-norA) at 5 and 10 µg/mL of PYO were statistically significant as determined by a one-way ANOVA with Tukey’s multiple comparisons (P < 0.0001). (B) MIC_PYO of RN6390(pLI50), RN6390(pLI50-norA), RN6390(pLI50-norB), RN6390(pLI50-norC), and RN6390(pLI50-tet38) ±reserpine at 40 µg/mL. The experiments were done in triplicate with three independent biological samples. The error bars represent the mean ± SD. (C) Relative transcript levels of norA, norB, norC, and tet38 of RN6390 following exposure to PYO at concentrations 0 to 10 µg/mL for 1 hour. The relative transcript level of efflux pumps was expressed as the fold change (FC) in the pump transcripts of bacteria exposed versus non-exposed to PYO. The assays were repeated three times with three different biological samples. The error bars represent the means of FC ± standard error of the mean (SEM) for each assay.

At 5 µg/mL of PYO, the norA overexpressor, however, showed a threefold reduction in the inhibition zone (6 mm) compared to that of RN6390(pLI50) (19.6 mm). At 10 µg/mL of PYO, the diameter reduction was 1.42-fold between RN6390(pLI50-norA) (20.6 mm) and RN6390(pLI50) (29.3 mm). The diameter of RN6390(pLI50-norA) was significantly decreased compared to RN6390(pLI50) at 5 µg/mL of PYO (ANOVA, P < 0.0001).

In contrast, overexpression of norC and tet38 from pLI50 constructs in RN6390 did not affect the PYO zone of inhibition (Fig. 2A). At both 5 µg/mL and 10 µg/mL of PYO, RN6390(pLI50-norB) exhibited slightly reductions in diameters compared to those of RN6390 (17.3 mm versus 19.6 mm and 25.3 mm versus 29.3 mm, respectively).

To determine if the effect of norA overexpression on PYO resistance was a function of efflux activity, we directly determined the MIC of PYO (MIC_PYO) in the presence and absence of reserpine, a known efflux inhibitor. MIC_PYO of RN6390(pLI50-norA) was threefold higher than that of RN6390(pLI50) (24 µg/mL versus 8 µg/mL) but was reduced 2.5-fold (9 µg/mL) when reserpine (40 µg/mL) was added (Fig. 2B). MIC_PYO of RN6390(pLI50-norB) was 1.6-fold higher than that of RN6390(pLI50) (13 µg/mL versus 8 µg/mL) and was reduced 1.6-fold (8 µg/mL) in the presence of reserpine at 40 µg/mL (Fig. 2B). These data indicated that NorB had a smaller effect on reducing PYO toxicity against RN6390 in comparison to NorA.

To determine the effect of PYO on the transcript levels of norA, norB, norC, and tet38, we measured the relative efflux pump gene transcript levels [fold change (FC)] following 1-hour exposure of RN6390 to a range of PYO concentrations (0.25–10 µg/mL) versus non-exposed. norA transcript levels increased (1.8-fold) at low-level PYO (0.25 µg/mL) (Fig. 2C; P < 0.0001), but the induction effect of PYO on norA subsequently decreased with increasing PYO concentrations (Fig. 2C; P < 0.0001). While we also observed an induction with tet38 transcript levels, norB and norC transcript levels declined in a dose-dependent manner, with a more substantial reduction of norC transcripts (Fig. 2C).

Lack of NorA efflux pump increased S. aureus susceptibility to PYO

We carried out the well diffusion assay using RN6390, the ΔnorA mutant SA-K1758 (31, 32), and the norA overexpressor RN6390(pLI50-norA) to test the impact of the NorA efflux pump on RN6390 susceptibility to PYO. The parent strain of SA-K1758 was the S. aureus NCTC8325-4, a S. aureus strain related to RN6390 (Table 1), and showed data similar to those of RN6390. To maintain the homogeneity of our assays, RN6390 and SA-K1758 were transformed with plasmid pLI50, and the transformants RN6390(pLI50), SA-K1758(pLI50), and RN6390(pLI50-norA) were grown in the presence of chloramphenicol at 10 µg/mL (Cm10) to maintain selection pressure on the plasmid. PYO at concentrations 2.5, 5, 10, 15, and 20 µg/mL were deposited in wells made on a lawn of RN6390(pLI50), SA-K1758(pLI50), and RN6390(pLI50-norA) on LB plates supplemented with Cm10. After 24 hours of incubation at 37°C, we measured the diameter of the inhibition zones (in millimeters) for each transformant. RN6390 and mutant SA-K1758 showed similar zones of inhibition throughout the range of PYO concentrations (Fig. 3A).

TABLE 1.

Bacterial strains, plasmids, and primers used in this study

Strains, plasmids, primers	Genotypes or relevant characteristic(s)	Reference or source
S. aureus
NCTC8325-4	Laboratory strain cured of known prophage	(33)
RN6390	Wild type, related to NCTC8325-4, rsbU−	(34)
SA-K1758	NCTC8325-4, norA deletion (DnorA)	(32)
Newman	Laboratory strain, high level of clumping factor	(35)
RN6390 (pLI50-norA)	norA overexpressor, CmR	(31)
RN6390 (pLI50-norB)	norB overexpressor, CmR	(29)
RN6390 (pLI50-norC)	norC overexpressor, CmR	(30)
RN6390 (pLI50-tet38)	tet38 overexpressor, CmR	(34)
P. aeruginosa
PAO1	Reference strain, derivative of PAO	(36)
PA14	Reference strain, virulent burn wound isolate	(36)
PA14 phzM	Transposon insertion phzM mutant	(37)
PA14 phzS	Transposon insertion phzS mutant	(37)
Plasmid
pLI50	Shuttle plasmid E. coli—S. aureus, CmR
Primers for real-time RT-PCR assays
gmk	Forward 5′TCAGGACCATCTGGAGTAGGTAAAG 3′
	Reverse 3′CAAATGCGTGAAGGTGAAGTTGATG 5′
norA	Forward 5′TGGCCACAATTTTTCGGTAT 3′
	Reverse 3′CTTTGGCTACATGTCAGCGA 5′
norB	Forward 5′CTCGGATGCAAGAAACCAAT 3′
	Reverse 3′GCTTCTGCATTAGGTGGAGC 5′
norC	Forward 5′ACGTCAGCGTGCCTTAAGTT 3′
	Reverse 3′TTACTCATCAAAGGGACGCC 5′
tet38	Forward 5′ATCGTAGTATTTACGTTGCC 3′
	Reverse 3′GGCTTAATTCTAGTGGCAAC 5′

Fig 3.

Dose-dependent inhibition effect of PYO on the growth of S. aureus RN6390, ΔnorA mutant SA-K1758, and the norA overexpressor. The experiments were done in triplicate with three independent biological samples. (A) Diameters (in millimeters) of the zones of inhibition of RN6390(pLI50), SA-K1758(pLI50), and RN6390(pLI50-norA) in function of PYO concentrations in micrograms per milliliter. The error bars represent the mean ± SD. The differences in diameters of inhibition zones between RN6390(pLI50) and RN6390(pLI50-norA) and between SA-K1758(pLI50) and RN6390(pLI50-norA) at 2.5, 5, 10, and 15 µg/mL of PYO were statistically significant as determined by a one-way ANOVA with Tukey’s multiple comparisons (P < 0.0001). (B) Illustration of the corresponding PYO-created inhibition zones at increasing concentrations from 2.5 µg/mL to 20 µg/mL.

In contrast, at 5 µg/mL of PYO, RN6390(pLI50-norA) showed an inhibition zone approximately threefold smaller than those of RN6390 and SA-K1758 with plasmid pLI50 (6 mm versus 20.6 and 21.6 mm, respectively). While increasing PYO concentrations, RN6390(pLI50-norA) exhibited significantly larger zone of inhibition (Fig. 3A, 20.6, 22.6, and 33 mm at 10, 15, and 20 µg/mL, respectively; ANOVA, P < 0.0001), but the impact was lower than that of RN6390 (29.3, 32.6, and 36.6 mm) and SA-K1758 (30.6, 33.3, and 37.3 mm) (Fig. 3A and B).

P. aeruginosa PA14 PYO-deficient mutants were less effective in the killing of S. aureus norA mutant

P. aeruginosa wild-type strains PAO1 and PA14 and PA14_phzM, and PA14_phzS mutants in genes essential for PYO synthesis were compared for their ability to inhibit S. aureus growth (36–38). We performed a well diffusion assay by exposing S. aureus SA-K1758(pLI50) and RN6390(pLI50-norA) to P. aeruginosa PAO1, PA14, PA14_phzM, and PA14_phzS for 24 hours at 37°C. The diameters of the inhibition zones produced by mutants PA14_phzM and PA14_phzS were smaller (20 mm) compared to those produced by PAO1 and PA14 (28 and 26 mm, respectively). RN6390(pLI50-norA) also exhibited smaller inhibition diameters (16 mm for PA14_phzM and PA14_phzS and 18 mm for PAO1 and PA14) (Fig. 4A), suggesting that norA may also have protective effects on P. aeruginosa exotoxins other than PYO.

Fig 4.

NorA efflux pump reduced S. aureus susceptibility to killing by PYO extracted from P. aeruginosa. All assays were done in triplicate with three independent biological samples. (A) Zones of inhibition produced by P. aeruginosa PAO1, PA14, and mutants PA14_phzM and PA14_phzS at OD₆₀₀ ~1.2 against S. aureus norA mutant SA-K1758(pLI50) and norA overexpressor RN6390(pLI50-norA). (B) PYO extracted from P. aeruginosa PAO1, PA14, PA14_phzM, and PA14_phzS at OD₆₀₀ ~1.2. A solution of HCl at 0.2 M was used to extract PYO from a mixture of bacterial supernatant and chloroform (red color under acidic condition). Failure to produce PYO by mutants was evidenced by a lack of color in the extracted PYO solutions of PA14_phzM and PA14_phzS. (C) The relative norA transcript levels of CF-associated S. aureus collected from patient sputum and throat samples (CF-SA). Strain Newman was used as a reference, and the housekeeping gene gmk served as an internal control. Co-culture CF-SA are in boldface. The error bars represent the mean ± SEM from three independent experiments. (D) Effects of PYO extracted from P. aeruginosa on two CF-SA isolates. CF-SA-1 (no increase in norA transcript) and CF-SA-2 (19-fold increase in norA transcript) (data shown in C) were exposed to PYO extracted from PAO1, PA14, PA14_phzM, and PA14_phzS in a well diffusion assay.

To demonstrate that the growth inhibition exercised by P. aeruginosa correlated with PYO secreted by the bacteria, we extracted PYO from the supernatants of PAO1, PA14, PA14_phzM, and PA14_phzS at the same optical density (OD₆₀₀ ~1.2) (25, 39). From a culture of 10 mL at OD₆₀₀ ~1.2, the PYO production was 4.6 µg/mL for PAO1, 10.4 µg/mL for PA14, and 0.02 µg/mL for PA14_phzM and PA14_phzS (Fig. 4B). PYO (10 µg/mL) produced by PA14 was tested on RN6390 and was found to cause a zone of inhibition similar to that of commercial PYO at the same concentration (both inhibition zones showed a diameter of 33 mm). P. aeruginosa PAO1 caused a similar inhibition zone as that of PA14 on a lawn of RN6390 despite produced half the level of PYO (Fig. 4A and B). These findings suggested that PAO1 produced anti-staphylococcal exoproducts in addition to PYO which also interacted with the NorA efflux pump of RN6390.

CF-S. aureus norA expression patterns

We then sought to assess the clinical impact of norA by testing patient samples. We collected sputum and throat swabs from 18 patients with CF, ranging in age from 2 to 65 years of age. The majority of the patients were on highly effective Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) modulator therapy (n = 14, 78%), and half of the patients were prescribed chronic antibiotics (Table 2). To evaluate norA transcript levels in CF S. aureus and the association of a norA expression on susceptibility P. aeruginosa PYO, we carried out real-time Reverse Transcription Polymerase Chain Reaction (RT-PCR) assays using RNA extracted from 13 CF-associated S. aureus from patient samples (CF-SA) and the S. aureus wild-type reference strain Newman, a strain commonly used as a reference in studies of clinical and CF S. aureus (4, 35, 40, 41) (Table 1).

TABLE 2.

Clinical characteristics of CF patients who provided sputum and throat swab samples for analysis

CF patient characteristics
Age, years, average (min, max)	34 (2, 65)
Female, n (%)	8 (44)
Male, n (%)	10 (56)
FEV1, percent predicted, mean (SD)	74 (32)
On CFTR modulator, n (%)	14 (78)
On chronic antibiotics, n (%)	9 (50)

Out of 13 CF-SA isolated from CF patients, nine CF-SA were isolated alone, and four were co-isolated with P. aeruginosa (CF-PA). We compared the norA transcript levels of the nine CF-SA isolated alone from CF patients with the norA transcript of Newman (Fig. 4C). Five out of nine CF-SA (CF-SA-2, CF-SA-3, CF-SA-4, CF-SA-12, and CF-SA-13) showed a significant increase in the norA transcripts level (17.9-fold, 6.6-fold, 3.98-fold, 8.03-fold, and 5.49-fold, respectively) when compared to the norA transcript levels of Newman (Fig. 4C; ANOVA, P < 0.0001). The remaining four out of nine CF-SA isolated alone (CF-SA-1, CF-SA-8, CF-SA-9, and CF-SA-10) showed a non-significant increase or decrease in norA transcript levels (1.16-fold, 0.74-fold, 1.84-fold, and 0.55-fold, respectively) relative to Newman (Fig. 4C).

We exposed CF-SA-1 (1.16-fold increase in norA transcript) and CF-SA-2 (17.9-fold increase in norA transcript) to 100 µL of each of the PYO solutions extracted from PAO1, PA14, PA14_phzM, and PA14_phzS. CF-SA-1 exhibited a 22-mm diameter, and CF-SA-2 exhibited a 16-mm diameter of the zone of inhibition when exposed to PYO_PA14 (Fig. 4D). PYO_PAO1 created a smaller inhibitory zone for CF-SA-1 (10 mm) and no inhibitory zone for CF-SA-2. In contrast, CF-SA-1 and CF-SA-2 exposed to PYO_phzM and PYO_phzS yielded no inhibition zones (Fig. 4D). These data showed that overexpression of norA in S. aureus clinical isolates is also associated with reduced toxicity of PYO secreted by P. aeruginosa.

We then compared the MIC_PYO of the 9 CF-SA isolated alone with the MIC_PYO of Newman. We found an increase of fourfold in the MIC_PYO of CF-SA-2 (64 versus 16 µg/mL); an increase of twofold in the MIC_PYO of CF-SA-3, CF-SA-4, CF-SA-12, and CF-SA-13 (32 versus 16 µg/mL); and no change in the MIC_PYO of CF-SA-1, CF-SA-8, CF-SA-9, and CF-SA-10 that showed a low levels of norA transcripts (MIC_PYO = 16 µg/mL). These data provided correlation in clinical isolates that higher expression of norA contributes to protection from PYO (Table 3).

TABLE 3.

CF S. aureus and P. aeruginosa clinical strains used in this study^c

Strains	Co-cultures	Characteristics	MICs of CF-SA (µg/mL)
			NOR	CIP	TETRA	PYO
S. aureus
Newman		MSSA	0.5	0.5	0.06	16
CF-SA-1a	−	MSSA	8	8	0.5	16
CF-SA-2	−	MSSA	>128	>128	0.5	64
CF-SA-3	−	MSSA	8	16	0.5	32
CF-SA-4	−	MSSA	>128	32	16	32
CF-SA-5b	+ CF PA-3	MSSA	32	8	0.5	16
CF-SA-6b	+ CF PA-4	MRSA	4	8	0.5	16
CF-SA-7b	+ CF PA-5	MRSA	4	8	0.5	16
CF-SA-8	−	MSSA	4	16	0.5	16
CF-SA-9	−	MSSA	4	8	0.5	16
CF-SA-10	−	MSSA	32	16	0.5	16
CF-SA-11b	+ CF PA-9	MSSA	2	1	0.5	16
CF-SA-12	+ S. agalactiae	MSSA	>128	>128	4	32
CF-SA-13	−	MRSA	>128	>128	0.5	32
P. aeruginosa
CF-PA-1	−	Mucoid
CF-PA-2	−	Rare PA
CF-PA-3b	+ CF-SA-5
CF-PA-4b	+ CF-SA-6	Moderate mucoid
CF-PA-5b	+ CF-SA-7	Slow growth
CF-PA-6	−
CF-PA-7b	+ Spingobacterium
CF-PA-8b	+ Achromobacter

^a CF, cystic fibrosis; NOR, norfloxacin; CIP, ciprofloxacin; TETRA, tetracycline; PYO, pyocyanin; SA, S. aureus; PA, P. aeruginosa.

^b Co-culture of SA/PA, SA/other bacteria, or PA/other bacteria. All isolates were collected from patient sputum or throat samples.

^c Isolates from mono- or co-cultures were collected from 18 patient sputum or throat samples.

We then compared the norA transcript levels of the four CF-SA co-isolated with CF-PA (CF-SA-5, CF-SA-6, CF-SA-7, and CF-SA-11) with the norA transcripts of Newman and found a low level of norA transcripts for the four isolates (0.61-fold, 1.33-fold, 1.6-fold, and 2.12-fold, respectively). The MIC_PYO of the four CF-SA co-isolated with CF-PA remained at the same level as that of Newman (MIC_PYO = 16 µg/mL; Table 3).

CF-PA of the co-isolated pairs CF-SA/CF-PA produced low levels of PYO

We evaluated the PYO production of the nine CF-PA collected from patient sputum and throat samples (Fig. 5A). Four CF-PA were isolated together in the same patient samples with CF-SA (CF-SA-5/CF-PA-3, CF-SA-6/CF-PA-4, CF-SA-7/CF-PA-5, and CF-SA-11/CF-PA-9), four CF-PA were isolated alone (CF-PA-1, CF-PA-2, CF-PA-6, and CF-PA-7), and CF-PA-8 was isolated together with Achromobacter sp. All CF-PA were grown to OD₆₀₀ ~1.2, and PYO was extracted from 10-mL culture. Four CF-PA isolated alone (CF-PA-1, CF-PA-2, CF-PA-6, and CF-PA-7) produced 3.86 µg/mL, 8.16 µg/mL, 1.43 µg/mL, and 0.45 µg/mL of PYO, respectively, while the other four co-isolated CF-PA (CF-PA-3, CF-PA-4, CF-PA-5, and CF-PA-9) produced reduced concentrations of PYO: 0.33 µg/mL, 0.85 µg/mL, 0.05 µg/mL, and 0.06 µg/mL, respectively. The CF-PA-8 co-isolated with a Achromobacter sp. produced 2.86 µg/mL.

Fig 5.

CF-SA exposed to PYO extracted from CF-PA. Co-culture bacteria are in boldface. (A) PYO (in micrograms per milliliter, blue color) extracted from CF-PA. (B) PYO extracted from CF-PA isolated alone were tested on S. aureus Newman. PYO extracted from CF-PA co-isolated were tested on the paired CF-SA. All assays were done in triplicate with three independent biological samples. Error bars in the graph represent the mean ± SD of the PYO extracted from CF-PA isolates.

The corresponding originally co-cultured CF-SA were exposed to 100 µL of the PYO solution extracted from the CF-PA of the pair. The reference Newman strain was exposed to monoculture CF-PA strains (Fig. 5B). Newman exposed to CF-PA-1, CF-PA-2, CF-PA-6, CF-PA-7, and CF-PA-8 exhibited a zone of inhibition with diameter proportionate to the level of PYO produced by the CF-PA, with CF-PA-2 producing the largest diameter among the monoculture CF-PA isolates. The pairs CF-SA-5/CF-PA-3 and CF-SA-6/CF-PA-4 exhibited a slight zone of inhibition, and the pairs CF-SA-7/CF-PA-5 and CF-SA-11/CF-PA-9 showed virtually no inhibition zone (Fig. 5B).

These data taken together showed that the co-isolated pairs CF-SA and CF-PA, respectively, exhibited relatively low norA transcript levels and PYO production. This phenomenon suggested a partial adaptation of the two bacteria to persist and co-colonize the CF lung habitat, but a larger collection of CF isolates is needed to conclude if this pattern as an adaptive mechanism for the co-existence of both species in the CF lung is true.

DISCUSSION

S. aureus resides in various non-living and living environments that range from untreated water, soil, and solid surfaces to external mucous membranes which line the nasal cavity and cover the skin of humans and animals (42, 43). In cystic fibrosis, S. aureus is one of the most isolated pathogens from the airways of CF patients and can reside in the thick mucus for extended period of times. During this time, S. aureus deploys various measures to adapt to the hostile habitat, to resist against host defense and antibiotic treatment, and to compete with coinfecting pathogens such as P. aeruginosa (4, 7, 40, 41).

One of the most efficient S. aureus responses to changes in the environment includes the use of transmembrane efflux pumps for transporting structurally diverse compounds, including salts, vitamins, fatty acids, sugars, amino acids, and antibiotics and toxic metabolites. These efflux pumps allow S. aureus to adapt and survive in difficult conditions by effectively scavenging for nutrient sources in addition to providing protection against antibiotics (44, 45).

We hypothesized that S. aureus also uses efflux pumps in response to anti-staphylococcal exoproducts of P. aeruginosa such as PYO. We tested four previously discovered S. aureus efflux pumps of the MFS of transporters, NorA, NorB, NorC, and Tet38 (28–30), for their ability to reduce staphylococcal susceptibility to killing by PYO when overexpressed. Only S. aureus overexpressing NorA showed a clear and consistent resistance to PYO phenotype.

S. aureus NorA efflux pump has been found to confer resistance to hydrophilic fluoroquinolones such as norfloxacin and ciprofloxacin as well as several other structurally unrelated compounds (46). Recent studies on NorA have uncovered important characteristics of this efflux pump such as new functional sites that were critical to substrate binding and drug transport (46). By comparative analyses, Ferreira et al. found that norA was present in 61 out of 63 Staphylococcus species and the function of NorA in drug transport was conserved in staphylococci (47). These reports highlighted the importance of NorA in S. aureus fluoroquinolone resistance and suggested its importance in S. aureus environmental adaptation beyond exposure to antibiotics.

CF patients harbor complex polymicrobial communities, with S. aureus as the most prevalent pathogen detected in the lung of pediatric CF patients. As these individuals age, P. aeruginosa becomes the most prevalent bacterium in adult CF patients (5, 7, 48, 49). S. aureus and P. aeruginosa co-habitation provides an environment for S. aureus to encounter anti-staphylococcal exoproducts of P. aeruginosa such as HQNO, LasA protease, and natural phenazines such as PYO, a redox active exotoxin produced by 95% of P. aeruginosa and secreted into the local environment by a type II secretion system (21, 50). The sputum of P. aeruginosa-infected CF patients has been found to contain a level of PYO up to 130 µM (~270 µg/mL), which contributed to pulmonary tissue damage associated with chronic lung infections (16, 38, 51). Due to its low molecular weight and zwitterionic status, PYO can easily permeate the cell membrane. As a result, this P. aeruginosa pigment efficiently killed S. aureus through a PYO-mediated increase of the intracellular concentration of superoxide O₂⁻ and hydrogen peroxide H₂O₂, both toxic to the bacterial cells (6, 21). Thus, the main cause of S. aureus toxicity is an accumulation of intracellular PYO leading to an increase of toxic ROS.

Exploring a possible efflux mechanism by which S. aureus is able to adapt and counter PYO toxicity was the main focus of this study. We carried out experiments using commercially available PYO followed by PYO extracted from P. aeruginosa references PAO1 and PA14 (25). We included PA14 isogenic mutants phzM and phzS of a non-redundant library of PA14 transposon insertion as negative controls of P. aeruginosa PYO production (37).

Our study demonstrated that NorA overexpressed in RN6390 reduced the growth inhibition effects of PYO and of P. aeruginosa PAO1, PA14, mutant PA14_phzM, and mutant PA14_phzS. In contrast, the ΔnorA mutant SA-K1758 became more susceptible and exhibited a zone of inhibition twofold larger than that of the norA overexpressor when exposed to PAO1 and PA14. Interestingly, SA-K1758 exhibited a noticeable smaller zone of inhibition when exposed to PYO mutants PA14_phzM or PA14_phzS. PYO extracted showed that PA14 produced the highest level of PYO followed by PAO1, while the mutants showed no evidence of PYO expression. The smaller zones of inhibition produced by mutants PA14_phzM and PA14_phzS indicated other exoproducts secreted by the mutants also carried anti-staphylococcal activity. Notably, the efflux inhibitor reserpine reduced the protection of norA overexpression, supporting the concept that efflux activity of NorA provides protection against PYO. Furthermore, the reduced inhibition zone formed when the NorA overexpressor was exposed to mutant PA14_phzM or PA14_phzS compared to that of PA14 indicated that NorA also provided a limited protection against other exoproducts of the mutants in the absence of PYO production.

To assess the ability of PYO to induce expression of S. aureus efflux pumps, we carried out real-time RT-PCRs which showed a modest induction effect on norA expression that diminished with increasing PYO concentration, a dose-dependent diminution effect also seen for the transcript levels of norB, norC, and tet38. These data suggested that an overproduction of NorA in S. aureus was the cumulative result of other factors, likely regulatory mutations, in addition to an exposure to PYO during bacterial competition with P. aeruginosa.

We observed the norA transcript level of the 13 CF-SA (nine isolated alone and four co-isolated with CF-PA) and extracted PYO from the nine CF-PA (five isolated alone and four co-isolated with CF-SA). CF-SA-2 from monoculture showed the highest level of norA transcripts with a 17.9-fold increase in relative expression compared to that of the reference strain Newman and that norA transcript levels were associated with a fourfold increase in the MIC_PYO of CF-SA-2 compared to that of Newman. This phenomenon could be due to mutations in genes regulating norA expression possibly due to extensive antibiotic exposure generating a notably high MIC (MIC_NOR = MIC_CIP > 128 µg/mL). Exposure of CF-SA-2 to PYO extracted from PA14 (PYO_PA14) yielded a reduced zone of inhibition, suggesting a protection in association with norA overexpression and protection against PYO_PA14 toxicity.

The four CF-SA isolates from co-cultures with CF-PA isolates showed a small increase or a basal level of norA transcripts (FC ≤1.84), and the associated CF-PA isolates exhibited a low-level production of PYO. The MICs of norfloxacin and ciprofloxacin of the CF-SA of the pairs were at a low-level resistance, except CF-SA-5 with an MIC_NOR of 32 µg/mL. The MIC_PYO of the four CF-SA co-isolated with CF-PA remained the same as the MIC_PYO of Newman (Table 3). A larger collection of CF isolates is needed to determine if this pattern as an adaptive mechanism allowing co-existence of both species in CF lung is generalizable (12, 14, 21).

Our findings demonstrate that NorA directly reduces the toxicity of PYO suggesting that PYO itself may be a substrate of NorA, further expanding its substrate profile to compounds that may provide an adaptive advantage in polymicrobial environments as well as on exposure to antibiotics.

MATERIALS AND METHODS

Bacterial strains and growth conditions

Bacterial strains, plasmids, and primers used in this study are listed in Table 1.

Chloramphenicol, pyocyanin, norfloxacin, ciprofloxacin, tetracycline, reserpine, and chloroform were purchased from Sigma-Aldrich (St. Louis, MO).

S. aureus containing plasmids pLI50, pLI50-norA, pLI50-norB, pLI50-norC, and pLI50-tet38 were grown at 37°C in LB supplemented with chloramphenicol at 10 µg/mL. All other S. aureus and P. aeruginosa PAO1, PA14, mutant PA14(phzM), and mutant PA14(phzS) were grown in LB media unless otherwise stated.

CF clinical isolates collection

S. aureus (CF-SA) and P. aeruginosa (CF-PA) from patient sputum and throat samples were collected at the Massachusetts General Hospital Cystic Fibrosis Center (Institutional Review Board no. 2011P000620) over a period of 3 months (February 2023 to May 2023). Isolates were cultivated in LB broth, streaked out on LB agar plates, and grew at 37°C for 24 hours. All CF-SA and CF-PA grew normally within 24 hours, except CF-PA-5, which was co-cultured with CF-SA-7 and needed 48–72 hours to reached OD₆₀₀ ~1.2 (Table 3).

Measuring the growth inhibition activity of PYO on S. aureus

We carried out a well diffusion assay that was previously published to measure the anti-staphylococcal activity of PYO (24, 26). The assay was performed in three steps: (i) S. aureus grown to OD₆₀₀ ~0.5 was diluted 100-fold; then, 100 µL of the culture was spread evenly on the surface of an LB plate and allowed to dry. (ii) A series of wells with a 6-mm diameter were plugged out from the previously prepared S. aureus lawn on the LB plate. Molten LB agar (50 µL) was added to each well to form a foundation at the bottom of the well. (iii) A serial dilution of PYO was carried out, and a volume of 50 µL of each dilution was deposited inside the well, followed by incubation of the LB plate for 24 hours at 37°C. The anti-staphylococcal activity of PYO was determined by measuring the diameter of the zone of inhibition (millimeters) that surrounded each well. Sterilized distilled water or LB served as a negative control with no inhibition.

PYO susceptibility assay

PYO susceptibility testing was based on our previous study with some modifications (27). S. aureus RN6390 grew overnight; then, a fresh culture was started in LB broth (OD₆₀₀ ~0.05) and allowed to grow until OD₆₀₀ reached 0.6. PYO at concentrations ranging from 2 to 10 µg/mL was incorporated into LB plates. A fixed number of 10⁶ CFU of RN6390 was spread evenly on LB + PYO plates and then incubated at 37°C for 24 hours for colony count.

MIC testing of PYO and antibiotics

The MIC of PYO was determined by broth microdilution at 37°C for 24 hours, as previously described (34). A log phase culture of S. aureus RN6390 containing plasmid pLI50 or plasmid constructs pLI50-norA, pLI50-norB, pLI50-norC, or pLI50-tet38 (OD₆₀₀ ~0.5) grown in LB media was diluted 100-fold and inoculated into microtiter plates (Fisher Scientific, Pittsburgh, PA) containing a series of increasing concentrations of PYO (0–25 µg/mL). MIC_PYO was the lowest drug concentration that produced no visible turbidity after incubation at 37°C for 24 hours. To determine the contribution of S. aureus efflux pumps NorA, NorB, NorC, and Tet38 to the PYO resistance phenotype, reserpine at 40 µg/mL final concentration was added together with PYO to measure the MICs.

The MIC testing of S. aureus Newman and the 13 CF S. aureus isolates for susceptibility to norfloxacin, ciprofloxacin, tetracycline, and PYO was carried out as described above. MIC was the lowest drug concentration that produced no visible turbidity after incubation at 37°C for 24 hours.

Measuring the growth inhibition activity of P. aeruginosa on S. aureus

The same well diffusion assay was carried out with PYO replaced by P. aeruginosa. Strains PAO1, PA14, mutant PA14 (phzM), and mutant PA14 (phzS) were grown until OD₆₀₀ reached 1.2; then, 100 µL of the P. aeruginosa culture was deposited into each well. The LB plates containing S. aureus (lawn of bacteria) and P. aeruginosa (wells) were incubated for 24 hours at 37°C. The growth inhibition activity of P. aeruginosa was determined by measuring the diameter of the zone of inhibitions (millimeters) surrounding the wells.

Extraction of PYO from P. aeruginosa

We carried out the PYO extraction from P. aeruginosa as described by DeBritto et al. (25). Since PYO was most produced when P. aeruginosa reached the stationary phase with the bacterial cells in high density (39), we grew P. aeruginosa in LB media until the culture reached an OD₆₀₀ ~1.2 and then extracted their PYO.

P. aeruginosa (10 mL) were grown until OD₆₀₀ reached 1.2; then, bacteria were pelleted by centrifugation at 10,000 × g. The supernatant (10 mL) was collected and filter sterilized, and chloroform at 0.6× the volume of supernatant was added (6 mL). The mixture was vortexed vigorously for 30 seconds and then centrifuged at 10,000 × g for 15 minutes. The PYO mixed with chloroform (5 mL, blue color, bottom layer) was collected; then, PYO was extracted with HCl 0.2 M at 0.5× the volume of PYO/chloroform (2.5 mL) with vigorous vortexing for 30 seconds. The aqueous top layer (red color) containing PYO was collected, and the OD₅₂₀ was measured spectrophotometrically (16). The concentration of PYO was calculated based on the formula (PYO = OD₅₂₀ × 17.072 µg/mL) or using a standard curve with commercial PYO (Sigma-Aldrich, St. Louis, MO). To test the effect of PYO extracted from P. aeruginosa, 100 µL of the solution of extracted PYO was deposited into the wells prepared on a lawn of S. aureus as described above.

Quantitative real-time RT-PCR assay

Real-time RT-PCR assays to evaluate the relative transcript levels of norA, norB, norC, and tet38 were performed as previously described (52). Total S. aureus RNA was extracted from lysostaphin-treated cells using the RNeasy midi kit (Qiagen, Valencia, CA). cDNAs were synthesized using the Verso cDNA synthesis kit (Thermo Scientific, ABgene, Epsom, Surrey, United Kingdom), followed by real-time qRT-PCR assays using EvaGreen dye and the CFX96 real-time system (Bio-Rad, Hercules, CA). Primers designed for the qRT-PCR assays were synthesized at Eton Bioscience, Inc. (Eton Bioscience, Boston, MA), and are listed in Table 1. The housekeeping gene gmk was used as an internal control. All samples were analyzed in triplicate, and expression levels were normalized against gmk gene expression.

Statistical analysis

The experiments were performed in triplicate with three biological samples, and the data were expressed as mean ± SD. Data were analyzed using one-way ANOVA. The pairwise comparison was done with Tukey’s multiple comparisons to compare sample groups. Correlations were quantified by calculating Pearson correlation coefficients. The threshold for significance was set at a P-value <0.05. Analysis was completed using Graph Pad Prism version 9.5.1.