Agomelatine prevented depression in the chronic restraint stress model through enhanced catalase activity and halted oxidative stress

Jiaxi Xu; Cheng Zhu; Piaopiao Jin; Wangdi Sun; Enyan Yu

doi:10.1371/journal.pone.0289248

. 2024 Feb 9;19(2):e0289248. doi: 10.1371/journal.pone.0289248

Agomelatine prevented depression in the chronic restraint stress model through enhanced catalase activity and halted oxidative stress

Jiaxi Xu ¹, Cheng Zhu ^2,³, Piaopiao Jin ⁴, Wangdi Sun ⁵, Enyan Yu ^6,^7,^*

Editor: Mohamed Abdel-Daim⁸

PMCID: PMC10857580 PMID: 38335199

Abstract

Background

Agomelatine (AGO) is an antidepressant with unique pharmacological effects; however, its underlying mechanisms remain unknown. In this study, we examined agomelatine’s effects on catalase activity, oxidative stress, and inflammation.

Methods

Chronic restraint stress (CRS) model mice were established over 4 weeks, and AGO 50 mg/kg was administered to different groups alongside a deferasirox (DFX) 10 mg/kg gavage treatment. Behavioral tests were performed to assess the effect of AGO on the remission of depression-like behaviors. Meanwhile, the expression of CAT, the oxidative stress signaling pathway and inflammatory protein markers were assessed using ELISA, qRT-PCR, Western blot, and immunohistochemistry.

Results

Four weeks of AGO treatment significantly improved depression-like behavior in mice through the activation of catalase in the hippocampus and serum of the model mice, increased superoxide dismutase expression, reduced malondialdehyde expression, and reduced oxidative stress damage. Deferasirox was found to offset this therapeutic effect partially. In addition, the inflammatory pathway (including nuclear factor-κB and nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha) was not significantly altered.

Conclusions

AGO can exert antidepressant effects by altering oxidative stress by modulating catalase activity.

Background

Depression (major depressive disorder, MDD) is one of the most common clinical psychiatric disorders, affecting nearly 350 million people worldwide [1]. Epidemiological surveys have shown that the lifetime prevalence of mood disorders has reached 7.37% [2], with depression accounting for 4.7% [3]. However, because of the enormous disease burden of MDD, the current scientific understanding of its occurrence and progression remains inadequate.

Currently, most antidepressants in clinical use, such as selective serotonin reuptake inhibitors, work by selectively inhibiting serotonin reuptake (5-hydroxytryptamine, 5-HT) in the brain. Agomelatine (AGO), an alternative antidepressant, may exert its anxiolytic effects through an agonist effect on MT1/MT2 receptors and an antagonist effect on 5-HT_2C receptors. Lu et al. [4] showed that AGO could improve depression symptoms in mice with chronic unpredictable mild stress (CUMS) by regulating the level of a brain-derived neurotrophic factor in the hippocampus. Previous studies have shown that the antidepressant effects of AGO are not entirely mediated through the same mechanisms as other conventional antidepressants [5–9].

Oxidative stress is an important factor in MDD pathogenesis [10] and is considered one of the main causes of MDD [11]. Maes et al. [12] found that plasma peroxide levels in MDD patients significantly increased compared to normal controls. Moreover, the peroxide levels were significantly higher in patients in the acute phase of the disease than in those with chronic depression (defined as depression lasting more than 2 years). As an important site of reactive oxygen species (ROS) production, the peroxisome plays a crucial role in maintaining the dynamic redox balance in cells and participates in various oxidative stress processes [13]. Catalase (CAT), such as superoxide dismutase (SOD) and glutathione peroxidase, are antioxidative enzymes that can overcome the role of oxidative stress [14]. CAT comprises approximately 40% of all peroxisomal enzymes and is involved in cell proliferation-associated transduction pathways, apoptosis, carbohydrate metabolism, and platelet activation [15]. CAT acts as an antioxidant enzyme by removing excess intracellular hydrogen peroxide (H₂O₂) and ROS [16]. Moreover, CAT activity can be significantly suppressed under oxidative stress conditions [17]. Ding et al. [18] conducted an in vivo study of depression using constructed fluorescent probe techniques in mouse models. They revealed the excess of peroxisomes and intracellular H₂O₂ in the mouse brain, leading to CAT inactivation, dysfunction of the 5-HT system, and, ultimately, depression-related behaviors in mice.

Studies have shown that cysteine and vitamin C can enhance CAT activity and remove excess H₂O₂ [19]. In contrast, deferasirox (DFX) can inhibit CAT activity and improve H₂O₂ levels [18]. The results of several clinical studies identified elevated CAT activity in the acute and chronic phases of MDD [20–22]. Increased CAT activity may reflect a compensatory mechanism reducing the effects of oxidative stress. However, some studies have presented the opposite conclusion. Ozcan et al. [23] found significantly lower CAT activity in depressed patients than in healthy controls, with no significant change in CAT activity after treatment. However, their study did not describe a specific drug treatment regimen. Bhatt et al. [24] found decreased CAT levels in the brains of mice with CUMS. Olsen et al. [25] found that antidepressants improved memory and reduced depression and anxiety symptoms by increasing CAT levels in mouse brain tissue, even without increased oxidative stress.

The activation of the oxidative stress pathway is an important pathophysiological factor in depression, based on the proposed hypothesis of the involvement of oxidative stress in the pathogenesis of MDD. AGO may improve depression symptoms, anxiety symptoms, and biochemical indicators of depression by affecting oxidative stress and inflammation.

This study mainly examined the changes in CAT levels and oxidative stress in the brain tissue during AGO treatment in a depression mouse model, determined the presence or absence of a correlation between this change and depression and anxious behavior in mice, and investigated whether this change would be affected by DFX. It was found that AGO can modulate oxidative stress in depression model mice by regulating CAT, thus highlighting new ideas for treating depression.

Results

AGO attenuated depressive behavior in depression model mice

The effect of AGO on depression-like behavior was investigated, first analyzing baseline body weight in the six groups of mice (Fig 1A). Secondly, body weight after 28 days of chronic restraint stress (CRS) and drug intervention (Fig 1B) and body weight gain values in the same groups of mice (Fig 1C). Statistical analysis showed that the CRS group lost significantly more body weight than the control group. AGO and AGO + DFX treatment partially offset this weight loss. The therapeutic effect of AGO was partially weakened by DFX, while the DFX treatment group and CRS group did not show any significant differences. At the end of the chronic stress period, a series of well-established behavioral tests that were designed to measure anxiety-like Open Field Test (OFT) and depression-like Sugar-water preference test (SPT), and Forced swimming test (FST) behaviors were conducted in different groups of mice. CRS mice showed lower sucrose preference (Fig 1D), significantly prolonged rest in the FST (Fig 1E), and a significant decrease in total travel in the central region of the OFT (Fig 1F) compared with control mice. These findings were significantly recovered in mice treated with AGO and AGO + DFX compared with those in CRS mice. However, the DFX treatment and CRS groups did not show significant differences in the tests mentioned above. Unfortunately, no significant effects were observed in the total travel time and central region movement time in the OFT tests (Fig 1G–1H). These experiments demonstrated that AGO treatment could restore depressive-like behavior after CRS. However, the therapeutic effect of AGO would be partially attenuated by DFX, indicating that AGO partially improves depressive-like behavior in mice.

Effect of AGO on CAT levels in mice

The hippocampal sections were immunohistochemically stained with CAT as a specific marker to investigate the effect of AGO on CAT protein expression in the hippocampus of the model mice (Fig 2A). The expression of CAT protein in the CRS group decreased significantly relative to that in the normal control group, and CAT protein expression in the AGO treatment group was significantly restored compared with that in the CRS group (Fig 2B).

Fig 2 — Immunohistochemistry shows the changes in CAT protein expression in the hippocampus of mice after CRS, AGO, and DFX intervention. (a) Staining of CAT protein. (B) Positive rate of CAT protein expression in the mouse hippocampus. *P<0.05; **P<0.01; ***P<0.001; CAT, catalase; CRS, chronic restraint stress; AGO, agomelatine; DFX, deferasirox; ns, no significant difference. Data are expressed as the mean ± standard deviation and were analyzed by one-way ANOVA, followed by post hoc multiple comparisons (LSD method). n = 3.

Meanwhile, we detected CAT activity in mouse serum (Fig 3A) and found that CAT activity was significantly lower in the CRS group than in the control group. CAT activity increased significantly after AGO treatment, and the DFX had a clear inhibitory effect.

In addition, analysis of CAT protein expression levels by protein immunoblotting (Fig 3D) confirmed that CAT protein expression was significantly lower in the CRS group than in the control group and that AGO treatment effectively restored CAT protein expression (Fig 3E and 3F).

We observed differences in CAT expression by measuring the mRNA expression of CAT in each group through quantitative real-time polymerase chain reaction (PCR), although these were not statistically significant.

In conclusion, we showed that AGO could effectively increase the CAT expression in depressed model mice with CRS.

Effects of AGO on oxidative stress in depression model mice

The serum concentrations of SOD and malondialdehyde (MDA) were measured using enzyme-linked immunosorbent assay (ELISA) to confirm the effect of AGO on oxidative stress in depression model mice (Fig 3B and 3C). The results showed that the CRS group had significantly lower serum MDA concentrations after AGO treatment, while serum SOD increased significantly with AGO treatment. Meanwhile, this therapeutic effect was partially offset by DFX.

Effect of AGO treatment on the NF-кB pathway in mouse models of depression

Extensive preclinical and clinical evidence shows that external stress is accompanied by increased proinflammatory cytokines and their downstream regulators. Nuclear factor (NF)-кB is a transcription factor reported to regulate an excess of proinflammatory cytokines. The expression levels of the NF-кB protein and IкB-α were analyzed by protein immunoblot (Fig 3G and 3H). Meanwhile, we detected the mRNA expression levels of NF-кB and IкBα by quantitative and real-time PCR (Fig 3I–3K). Unfortunately, our experiments did not reveal significant differences in the expressions of NF-кB and IкBα in each group.

Discussion

We hypothesized that the effect of AGO in treating depression is associated with reducing the oxidative stress process in vivo, given the role of oxidative stress in the pathogenesis of depression. CRS induced depression-like behavior in mice, leading to increased MDA and decreased SOD and CAT levels, showing a redox imbalance and oxidative stress state in mice, consistent with previous studies [26]. The marked improvement in depression-like behavior and decreased MDA in depression model mice treated with AGO may be related to increased antioxidant enzymes. In this study, we found that AGO treatment for 4 weeks could activate CAT in the hippocampus of CRS mice, while the CAT inhibitor DFX could partially counteract this therapeutic effect. These findings indicate that AGO can alleviate depression-like behavior in mice by reducing oxidative stress. In addition, inflammation (as determined by NF-κB and IкBα levels) was not significantly altered, meaning that regulating oxidative stress may be another mechanism of action for depression of AGO [27].

The brain uses aerobic respiration to meet its high energy demand. Although the brain is only 2% of the body’s body weight, it consumes approximately 20% oxygen and 25% glucose [28]. Therefore, the central nervous system is very susceptible to oxidative stress, high levels of which can eventually cause oxidative damage, which is mainly manifested as an imbalance of pro-oxidants and antioxidants [29]. SOD converts superoxide anion radicals into H₂O₂; CAT, which reduces hydrogen to H₂O₂; and glutathione peroxidase are the main enzymatic antioxidants [30]. Previously, it was shown that oxidative stress plays a critical role in the pathophysiology of MDD [31]. Patients with MDD had a lower total antioxidant status and higher MDA levels in their blood than the controls [32]. However, the initially reduced SOD activity and elevated MDA levels in the serum of patients with MDD have been shown to normalize after long-term antidepressant treatment [33,34]. Oxidative stress is an imbalance between ROS and antioxidant enzymes that may cause biomolecular damage. Excess ROS eventually leads to the formation of proinflammatory factors, such as MDA and 8-hydroxy-2-deoxyguanosine, promoting the damage-related molecular patterns of immune responses [35]. MDA inhibits nucleotide excision repair systems and sensitization mutagenesis; disrupts DNA; and causes mitochondrial damage by increasing mitochondrial ROS, inhibiting mitochondrial respiration processes, and reducing mitochondrial membrane potential and antioxidant levels [36]. Superoxide production is increased in the brains of rats with CUMS [37], alongside increased protein and lipid peroxidation and unbalanced SOD and CAT activity [38]. Studies show that elevated oxidative stress has also been found in the brains of adult rats after maternal care deprivation [39]. Our data showed that CRS led to a decreased sugar water preference rate, prolonged forced swimming rest time, and depression-like behaviors such as decreased central total distance in the open field in mice. Meanwhile, CRS also leads to increased MDA expression in the serum, decreased CAT activity in the mouse hippocampus, and decreased SOD expression in the serum. The results of this study are consistent with those of previous studies.

AGO acts as a potent agonist of melatoninergic MT1 and MT2 receptors and as a 5-HT_2C receptor antagonist. Evidence accumulated over the extensive course of a previous study[40,41] supports the idea that the antidepressant effect of AGO is because of its synergistic melatoninergic and serotonergic effects [27]. The antidepressant effects of AGO have been illustrated in several mature rodent models reflecting the core clinical features of depression [27]. Chronic (3-week) AGO (40 mg/kg, intraperitoneal injection) has been shown to increase cell proliferation, neurogenesis, and cell survival in the rat hippocampus [39]. Furthermore, AGO improves cell maturity and survival throughout the hippocampus [42]. It has been reported that AGO increases SOD activity in the rat striatum and posterior cortex at 10 mg/kg and 30 mg/kg, respectively [43]. Our results showed that AGO significantly attenuated depressive-like behavior in CRS mice; by increasing CAT activity in the hippocampus and serum, it increased SOD and decreased MDA expression, thus reducing oxidative stress. Meanwhile, we administered the CAT-specific inhibitor DFX to the CRS model mice. We observed that the depression-like behavior and oxidative stress levels in this group were not significantly different from those in the CRS model group. It may be that CAT inhibition has participated in the pathological mechanism of the CRS model. In addition, we concurrently administered DFX and AGO treatment, which showed that the depression-like behavior and oxidative stress levels in the mice were significantly different from those in the AGO treatment group and the CRS group alone. This finding indicated that the therapeutic effect of AGO was produced through multiple different mechanisms and was partly achieved by enhancing CAT expression and activity, thus reducing oxidative stress.

The NF-κB protein family plays an important role in the expression of several proinflammatory genes as a key transcription factor. Regulation of this pathway by bioactive substances may be a potential solution for treating inflammatory diseases [44]. NF-κB is a key mediator of chronic stress-induced depression-like behaviors [45]. Moreover, it has been shown that cellular damage can be induced by the activation of the NF-κB signaling pathway, which is heavily involved in inflammation through ROS and proinflammatory cytokines. Research shows that AGO blocked this activation and the above effects, showing that antidepressant treatment may have broad neuroprotective effects [46]. AGO treatment has been shown to significantly inhibit NF-κB phosphorylation without changing the basal levels of the NF-κB/p65 protein. Because of the inhibition of NF-κB phosphorylation, NF-κ cannot be activated and transported into the nucleus, thus preventing cytokine synthesis [47]. Our experiments showed that NF-κB expression varied within different groups. However, there were no significant differences between groups, possibly because AGO affects NF-κB phosphorylation rather than the basal amount of NF-κB expression.

Conclusions

In conclusion, our study demonstrated that AGO has a clear antidepressant-like effect in a CRS model, consistent with previous studies. AGO can also reduce oxidative stress in mice by activating CAT, which we believe is one of the underlying antidepressant mechanisms.

Methods

Study animals

This study used 6–8-week-old specific pathogen-free male C57BL/6 mice weighing 22±3 g provided by Beijing Weitong Lihua Experimental Animal Company (experimental animal production license no. SCXK [Beijing] 2019–0011) and raised by the Experimental Animal Center of Zhejiang University of Traditional Chinese Medicine (experimental animal use license no. SYXK [Zhejiang] 2019–0022). The animals were adaptively maintained for 1 week. The mice were given a standard pelleted diet and free water, and they were housed at a controlled temperature (23°C±2°C) with 60% relative humidity and a 12 h light/dark cycle.

Model construction and grouping

Establishment of the CRS model [47,48]: the mice were placed in a transparent cylindrical tube with a length of approximately 10 cm and an internal diameter of approximately 3 cm. Therefore, this restricted the head and limb movement so that the head could only be moved slightly. Around the bound tube were eight ventilated holes approximately 0.6 cm in diameter for the mice to breathe. The binding time was from 10:00 to 16:00 (6 h). Each mouse was fed water ad libitum, although the water was not given during the binding process. We have considered the following aspects to ensure that the CRS model has been successfully built as much as possible: The weight of the mice after CRS modeling decreased significantly, with statistical significance.Through behavioral tests, it proved that mice after CRS modeling had depressive behavior. In this experiment, 1) the decreased sugar water preference rate in the sugar-water preference test, 2) the prolonged forced swimming rest time in the forced swimming test, 3) the decreased central total distance in the open field tests.[49,50] Successful mice were studied after 4 weeks of CRS molding.

Group: Sixty mice were randomly divided into six groups of 10 mice each: normal control (CON), CAT inhibitor (DFX), model (CRS), model + AGO (CON + AGO), model + CAT inhibitor (deferasirox) (CRS + DFX), and model + AGO + CAT inhibitor (CRS + AGO + DFX).

Drug treatment: Animals were treated for 4 weeks through intragastric administration. CRS + AGO mice, CRS + DFX mice, and CRS + AGO + DFX mice were treated with AGO (Jiangsu Hausen Pharmaceutical Company) 50 mg/kg, DFX, or both (Shanghai Bide Medical Technology Company) 10 mg/kg once a day, all drugs were dissolved in normal saline and administered as described in previous studies [5,51]. Mice from the CRS group were given equal normal saline from the first day until the fourth weekend. Mice in the CON and DFX groups were not treated with CRS stimulation. The CON group was administered equal amounts of normal saline (10 mg/kg) once a day; meanwhile, the DFX group was administered DFX (10 mg/kg) once a day.

Behavior index detection

Sugar-water preference test (SPT)

This Tang et al. [52] test is divided into adaptation and experimental stages. Adaptation stage: Single-cage feeding, with two water bottles placed simultaneously. Both bottles were filled with 1% sucrose water Within the first 24 h. One bottle contained pure water for the subsequent 24 h, and the other contained 1% sucrose water. Experimental stage: one bottle of 1% sucrose water and one bottle of pure water were given after 24 h of the SPT, and the overall weights of the bottles were recorded. The positions of the two water bottles were exchanged after 12 h, and their overall weight was re-recorded after 24 h. The sugar water preference rate was calculated as the indicator of the SPT (sugar water preference rate = sugar water consumption/[sugar water consumption + pure water consumption] × 100%).

Open Field Test (OFT)

SMART 3.0 virtually divided the absent field analysis box (40 cm × 40 cm × 40 cm) into central and peripheral parts using the Song et al. [53] OFT. Experiments were performed in a darker observation box. First, the mice were placed in the central grid to be observed for 5 min. After the experiment, the field box was wiped to remove the residual odor, and the next animal was tested. The main observation indicators were the central crossing time (s) and the total distance (cm).

Forced swimming test (FST)

Using the Lin et al. [54] FST, mice were placed in a circular transparent swimming bucket, 30 cm high, 12 cm in diameter, and 18 cm deep (i.e., that the tail and hind limbs could not touch the bottom), with a water temperature of 25°C±1°C. Each mouse first swam for 1 min to adapt to the environment. The behavioral indicators of the mice were recorded with a camera for 5 min, and their stationary time was recorded. The mice were dried with a towel after the experiment.

Immunohistochemistry

Mice were perfused with 4% paraformaldehyde (PFA) after being perfused with 50 mL (±) of saline through the heart for the immunohistochemistry study, and their brains were removed. The hippocampus was isolated and fixed in 4% paraformaldehyde for 3 days at 4 °C after that. Fixed Hippocampal tissue was embedded in paraffin and sectioned to 10μm thickness. Paraffin tissue sections were taken and baked at 60°C for 1 h; dried in three cylinders of xylene for 10 min; dehydrated by 95%, 80%, and 75% gradient alcohol for 1 min; immersed in tap water for 1 min; soaked in 3% H₂O₂ at 37°C for 30 min, phosphate-buffered saline (PBS) for 3 min, and 0.01 M citrate buffer for 20 min at 95°C; cooled to room temperature; and washed with PBS. Normal sheep serum working fluid was blocked at 37°C for 10 min. One-drop antibody plus rabbit anti-rat CAT (ab209211, Abcam) was added at 4°C overnight and rinsed in PBS. It was incubated with horseradish-labeled secondary antibody for 30 min in DAB. The section was re-stained with hematoxylin and sealed. PBS was used instead of the primary antibody as a negative control, and the normal mucosa was used as a positive control. The positive cell rate was calculated by randomly selecting five high-power fields (400X) and counting 100 cells per field [5,55].

ELISA experiments

The mice were anesthetized with 0.3% (0.15 ml/10 g) pentobarbital sodium by intraperitoneal injection. Blood was collected through a puncture of the retrobulbar venous plexus after anesthesia was deemed effective. Approximately 0.2 ml of blood was collected in a labeled centrifuge tube and kept at 20°C for 1–2 h. The blood was precooled to 4°C and centrifuged at 3000 rpm/min for 10 min. The serum was pipetted into a newly labeled centrifuge tube, frozen, and stored at -80°C for backup. Mouse catalase (CAT) ELISA Kit (ml037752, Enzyme-Linked Biotechnology), mouse superoxide dismutase (SOD) ELISA kit (ml643059, Enzyme-Linked Biotechnology), and MDA (Malondialdehyde) ELISA Kit (E-EL-0060c, Elabscience) content were determined according to the manufacturer’s instructions.

CAT activity detection

The methodology was carried out according to the manufacturer’s instructions (BC0200, Solarbio) [56–58]. Ice bath homogenate at a ratio of tissue mass (g): extract volume (mL) of 1:5°C–10.4°C was centrifuged at 8000 g for 10 min. The supernatant was then removed and placed on ice for testing. The working fluid was then configured according to the instructions. The spectrophotometer was preheated for more than 30 min, the wavelength was adjusted to 240 nm, and the distilled water was adjusted to 0. The CAT working fluid was detected for 10 min before determination in a 25°C water bath. Then, 1 mL of CAT detection solution was added to a 1 mL quartz plate before 35 L samples were added and mixed for 5 s. The initial light absorption at 240 nm and light absorption after 1 min were measured immediately at room temperature.

Quantitative real-time-PCR

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
NF-κB [59]	`CCGCTCGAGCTATGGACGATCTGTTTCCCCTC`	`CGGAATTCACCTTAGGAGCTGATCTGAC`
CAT [60]	`GCAGATACCTGTGAACTGTC`	`GTAGAATGTCCGCACCTGAG`
IкBα [61]	`CACTCCATCCTGAAGGCTACCAA`	`AAGGGCAGTCCGGCCATTA`
GAPDH [62]	`TGTGGGCATCAATGGATTTGG`	`ACACCATGTATTCCGGGTCAAT`

Open in a new tab

Primers for CAT, GAPDH, NF-κB, and IкBα were designed and submitted to TaKaRa for synthesis. Total RNA was extracted with the RNA extraction kit. The reverse transcription system was 20 μL, which was performed according to the reagent instructions. The reaction solution was taken for quantitative PCR according to the kit’s instructions. GAPDH was used as the internal reference control, and 2-ΔΔCt calculated the relative expression content of the target gene expression. Each group of samples was tested more than three times.

Western blot

Each group of mice was killed by cervical dislocation after completing the last behavioral test. Each subject’s brain was dissected and quickly placed on the ice surface. The hippocampal tissue was quickly isolated according to the stereotactic map of the mouse brain, immediately placed in liquid nitrogen, and then moved to an -80°C refrigerator for storage. The brain tissue was ground to a homogenate for the subsequent experimental testing, and a radioimmunoprecipitation assay lysate was added on ice for 30 min. The solution was centrifuged at 4°C at 14400 rpm for 15 min. The supernatant was removed and quantified with a bicinchoninic acid assay kit using a 5-protein loading buffer at 95°C for 10 min. SDS-PAGE electrophoresis was used to separate the protein, transferred to a polyvinylidene fluoride membrane, and then blocked for 1 h at room temperature with 5% skim milk powder. The membrane was then washed three times in TBST plus CAT (ab209211, Abcam), NF-κB (ab207297, Abcam), IкBα (ab32518, Abcam), and GAPDH (ab9484, Abcam). The primary antibody was incubated overnight at 4°C and then washed away with TBST. Then the corresponding secondary antibody was added for 1 h. The membrane was washed in TBST three times and swept with the ODYSSEY two-color infrared laser imaging system. The experimental results were processed with Image Studio Ver 2.0 software.

Statistical analysis

SPSS 25.0 software (IBM Corp., Armonk, NY, USA) was used for the statistical analysis. All data are presented as mean ± standard deviation. Multi-group overall comparisons were analyzed using one-way ANOVA and post hoc multiple comparisons (LSD method). A P-value of <0.05 was considered statistically significant.

Supporting information

S1 File

(ZIP)

Click here for additional data file.^{(38.6MB, zip)}

Acknowledgments

We appreciate the Experimental Animal Center of Zhejiang Chinese Medical University for the technical assistance they provided.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by The National Natural Science Foundation of China (grant number 8177051246).The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Murray CJ, Atkinson C, Bhalla K, Birbeck G, Burstein R, Chou D, et al. The state of US health, 1990–2010: burden of diseases, injuries, and risk factors. JAMA. 2013;310: 591–608. doi: 10.1001/jama.2013.13805 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Huang Y, Wang Y, Wang H, Liu Z, Yu X, Yan J, et al. Prevalence of mental disorders in China: a cross-sectional epidemiological study. Lancet Psychiatry. 2019;6: 211–224. doi: 10.1016/S2215-0366(18)30511-X [DOI] [PubMed] [Google Scholar]
3.Ferrari AJ, Somerville AJ, Baxter AJ, Norman R, Patten SB, Vos T, et al. Global variation in the prevalence and incidence of major depressive disorder: a systematic review of the epidemiological literature. Psychol Med. 2013;43: 471–481. doi: 10.1017/S0033291712001511 [DOI] [PubMed] [Google Scholar]
4.Lu Y, Ho CS, McIntyre RS, Wang W, Ho RC. Agomelatine-induced modulation of brain-derived neurotrophic factor (BDNF) in the rat hippocampus. Life Sci. 2018;210: 177–184. doi: 10.1016/j.lfs.2018.09.003 [DOI] [PubMed] [Google Scholar]
5.Chen F, Chen S, Liu J, Amin N, Jin W, Fang M. Agomelatine softens depressive-like behavior through the regulation of autophagy and apoptosis. BioMed Res Int. 2021;2021: 6664591. doi: 10.1155/2021/6664591 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
6.Lan T, Wu Y, Zhang Y, Li S, Zhu Z, Wang L, et al. Agomelatine rescues lipopolysaccharide-induced neural injury and depression-like behaviors via suppression of the Gαi-2-PKA-ASK1 signaling pathway. J Neuroinflammation. 2022;19: 117. doi: 10.1186/s12974-022-02479-x [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Rebai R, Jasmin L, Boudah A. Agomelatine effects on fat-enriched diet induced neuroinflammation and depression-like behavior in rats. Biomed Pharmacother. 2021;135: 111246. doi: 10.1016/j.biopha.2021.111246 [DOI] [PubMed] [Google Scholar]
8.Ozdamar Unal G, Demirdas A, Nazıroglu M, Ovey IS. Agomelatine attenuates calcium signaling and apoptosis via the inhibition of TRPV1 channel in the hippocampal neurons of rats with chronic mild stress depression model. Behav Brain Res. 2022;434: 114033. doi: 10.1016/j.bbr.2022.114033 [DOI] [PubMed] [Google Scholar]
9.Rainer Q, Xia L, Guilloux JP, Gabriel C, Mocaër E, Hen R, et al. Beneficial behavioural and neurogenic effects of agomelatine in a model of depression/anxiety. Int J Neuropsychopharmacol. 2012;15: 321–335. doi: 10.1017/S1461145711000356 [DOI] [PubMed] [Google Scholar]
10.Berton O, Nestler EJ. New approaches to antidepressant drug discovery: beyond monoamines. Nat Rev Neurosci. 2006;7: 137–151. doi: 10.1038/nrn1846 [DOI] [PubMed] [Google Scholar]
11.Lindqvist D, Dhabhar FS, James SJ, Hough CM, Jain FA, Bersani FS, et al. Oxidative stress, inflammation and treatment response in major depression. Psychoneuroendocrinology. 2017;76: 197–205. doi: 10.1016/j.psyneuen.2016.11.031 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Maes M, Mihaylova I, Kubera M, Uytterhoeven M, Vrydags N, Bosmans E. Increased plasma peroxides and serum oxidized low density lipoprotein antibodies in major depression: markers that further explain the higher incidence of neurodegeneration and coronary artery disease. J Affect Disord. 2010;125: 287–294. doi: 10.1016/j.jad.2009.12.014 [DOI] [PubMed] [Google Scholar]
13.Yano T, Oku M, Akeyama N, Itoyama A, Yurimoto H, Kuge S, et al. A novel fluorescent sensor protein for visualization of redox states in the cytoplasm and in peroxisomes. Mol Cell Biol. 2010;30: 3758–3766. doi: 10.1128/MCB.00121-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Kurutas EB. The importance of antioxidants which play the role in cellular response against oxidative/nitrosative stress: current state. Nutr J. 2016;15: 71. doi: 10.1186/s12937-016-0186-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Chelikani P, Fita I, Loewen PC. Diversity of structures and properties among catalases. Cell Mol Life Sci. 2004;61: 192–208. doi: 10.1007/s00018-003-3206-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Antonenkov VD, Grunau S, Ohlmeier S, Hiltunen JK. Peroxisomes are oxidative organelles. Antioxid Redox Signal. 2010;13: 525–537. doi: 10.1089/ars.2009.2996 [DOI] [PubMed] [Google Scholar]
17.Rai A, Gill M, Kinra M, Shetty R, Krishnadas N, Rao CM, et al. Catechin ameliorates depressive symptoms in Sprague Dawley rats subjected to chronic unpredictable mild stress by decreasing oxidative stress. Biomed Rep. 2019;11: 79–84. doi: 10.3892/br.2019.1226 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Ding Q, Tian Y, Wang X, Li P, Su D, Wu C, et al. Oxidative damage of tryptophan hydroxylase-2 mediated by peroxisomal superoxide anion radical in brains of mouse with depression. J Am Chem Soc. 2020;142: 20735–20743. doi: 10.1021/jacs.0c09576 [DOI] [PubMed] [Google Scholar]
19.Lyons JE, Ellis PE, Myers HK. Halogenated metalloporphyrin complexes as catalysts for selective reactions of acyclic alkanes with molecular oxygen. J Catal. 1995;155: 59–73. doi: 10.1006/jcat.1995.1188 [DOI] [Google Scholar]
20.Szuster-Ciesielska A, Słotwińska M, Stachura A, Marmurowska-Michałowska H, Dubas-Slemp H, Bojarska-Junak A, et al. Accelerated apoptosis of blood leukocytes and oxidative stress in blood of patients with major depression. Prog Neuropsychopharmacol Biol Psychiatry. 2008;32: 686–694. doi: 10.1016/j.pnpbp.2007.11.012 [DOI] [PubMed] [Google Scholar]
21.Vaváková M, Ďuračková Z, Trebatická J. Markers of oxidative stress and neuroprogression in depression disorder. Oxid Med Cell Longev. 2015;2015: 898393. doi: 10.1155/2015/898393 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Camkurt MA, Fındıklı E, Bakacak M, Tolun Fİ, Karaaslan MF. Evaluation of malondialdehyde, superoxide dismutase and catalase activity in fetal cord blood of depressed mothers. Clin Psychopharmacol Neurosci. 2017;15: 35–39. doi: 10.9758/cpn.2017.15.1.35 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Ozcan ME, Gulec M, Ozerol E, Polat R, Akyol O. Antioxidant enzyme activities and oxidative stress in affective disorders. Int Clin Psychopharmacol. 2004;19: 89–95. doi: 10.1097/00004850-200403000-00006 [DOI] [PubMed] [Google Scholar]
24.Bhatt S, Mahesh R, Jindal A, Devadoss T. Neuropharmacological effect of novel 5-HT3 receptor antagonist, N-n-propyl-3-ethoxyquinoxaline-2-carboxamide (6n) on chronic unpredictable mild stress-induced molecular and cellular response: behavioural and biochemical evidences. Pharmacol Rep. 2014;66: 804–810. doi: 10.1016/j.pharep.2014.05.002 [DOI] [PubMed] [Google Scholar]
25.Olsen RH, Johnson LA, Zuloaga DG, Limoli CL, Raber J. Enhanced hippocampus-dependent memory and reduced anxiety in mice over-expressing human catalase in mitochondria. J Neurochem. 2013;125: 303–313. doi: 10.1111/jnc.12187 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Choi JH, Lee MJ, Chang Y, Lee S, Kim HJ, Lee SW, et al. Valeriana fauriei exerts antidepressant-like effects through anti-inflammatory and antioxidant activities by inhibiting brain-derived neurotrophic factor associated with chronic restraint stress. Rejuvenation Res. 2020;23: 245–255. doi: 10.1089/rej.2018.2157 [DOI] [PubMed] [Google Scholar]
27.Guardiola-Lemaitre B, De Bodinat C, Delagrange P, Millan MJ, Munoz C, Mocaër E. Agomelatine: mechanism of action and pharmacological profile in relation to antidepressant properties. Br J Pharmacol. 2014;171: 3604–3619. doi: 10.1111/bph.12720 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Lee SY, Lee SJ, Han C, Patkar AA, Masand PS, Pae CU. Oxidative/nitrosative stress and antidepressants: targets for novel antidepressants. Prog Neuropsychopharmacol Biol Psychiatry. 2013;46: 224–235. doi: 10.1016/j.pnpbp.2012.09.008 [DOI] [PubMed] [Google Scholar]
29.Balmus IM, Ciobica A, Antioch I, Dobrin R, Timofte D. Oxidative stress implications in the affective disorders: main biomarkers, animal models relevance, genetic perspectives, and antioxidant approaches. Oxid Med Cell Longev. 2016;2016: 3975101. doi: 10.1155/2016/3975101 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Behr GA, Moreira JC, Frey BN. Preclinical and clinical evidence of antioxidant effects of antidepressant agents: implications for the pathophysiology of major depressive disorder. Oxid Med Cell Longev. 2012;2012: 609421. doi: 10.1155/2012/609421 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Michel TM, Pülschen D, Thome J. The role of oxidative stress in depressive disorders. Curr Pharm Des. 2012;18: 5890–5899. doi: 10.2174/138161212803523554 [DOI] [PubMed] [Google Scholar]
32.Liu T, Zhong S, Liao X, Chen J, He T, Lai S, et al. A meta-analysis of oxidative stress markers in depression. PLoS One. 2015;10: e0138904. doi: 10.1371/journal.pone.0138904 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Herken H, Gurel A, Selek S, Armutcu F, Ozen ME, Bulut M, et al. Adenosine deaminase, nitric oxide, superoxide dismutase, and xanthine oxidase in patients with major depression: impact of antidepressant treatment. Arch Med Res. 2007;38: 247–252. doi: 10.1016/j.arcmed.2006.10.005 [DOI] [PubMed] [Google Scholar]
34.Jiménez-Fernández S, Gurpegui M, Díaz-Atienza F, Pérez-Costillas L, Gerstenberg M, Correll CU. Oxidative stress and antioxidant parameters in patients with major depressive disorder compared to healthy controls before and after antidepressant treatment: results from a meta-analysis. J Clin Psychiatry. 2015;76: 1658–1667. doi: 10.4088/JCP.14r09179 [DOI] [PubMed] [Google Scholar]
35.Bakunina N, Pariante CM, Zunszain PA. Immune mechanisms linked to depression via oxidative stress and neuroprogression. Immunology. 2015;144: 365–373. doi: 10.1111/imm.12443 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Moylan S, Maes M, Wray NR, Berk M. The neuroprogressive nature of major depressive disorder: pathways to disease evolution and resistance, and therapeutic implications. Mol Psychiatry. 2013;18: 595–606. doi: 10.1038/mp.2012.33 [DOI] [PubMed] [Google Scholar]
37.Lucca G, Comim CM, Valvassori SS, Réus GZ, Vuolo F, Petronilho F, et al. Effects of chronic mild stress on the oxidative parameters in the rat brain. Neurochem Int. 2009;54: 358–362. doi: 10.1016/j.neuint.2009.01.001 [DOI] [PubMed] [Google Scholar]
38.Lucca G, Comim CM, Valvassori SS, Réus GZ, Vuolo F, Petronilho F, et al. Increased oxidative stress in submitochondrial particles into the brain of rats submitted to the chronic mild stress paradigm. J Psychiatr Res. 2009;43: 864–869. doi: 10.1016/j.jpsychires.2008.11.002 [DOI] [PubMed] [Google Scholar]
39.Réus GZ, Nacif MP, Abelaira HM, Tomaz DB, dos Santos MA, Carlessi AS, et al. Ketamine ameliorates depressive-like behaviors and immune alterations in adult rats following maternal deprivation. Neurosci Lett. 2015;584: 83–87. doi: 10.1016/j.neulet.2014.10.022 [DOI] [PubMed] [Google Scholar]
40.Millan MJ, Marin P, Kamal M, Jockers R, Chanrion B, Labasque M, et al. The melatonergic agonist and clinically active antidepressant, agomelatine, is a neutral antagonist at 5-HT(2C) receptors. Int J Neuropsychopharmacol. 2011;14(6):768–83. doi: 10.1017/S1461145710001045 [DOI] [PubMed] [Google Scholar]
41.Norman TR, Cranston I, Irons JA, Gabriel C, Dekeyne A, Millan MJ, et al. Agomelatine suppresses locomotor hyperactivity in olfactory bulbectomised rats: a comparison to melatonin and to the 5-HT(2c) antagonist, S32006. European journal of pharmacology. 2012;674(1):27–32. doi: 10.1016/j.ejphar.2011.10.010 [DOI] [PubMed] [Google Scholar]
42.Soumier A, Banasr M, Lortet S, Masmejean F, Bernard N, Kerkerian-Le-Goff L, et al. Mechanisms contributing to the phase-dependent regulation of neurogenesis by the novel antidepressant, agomelatine, in the adult rat hippocampus. Neuropsychopharmacology. 2009;34: 2390–2403. doi: 10.1038/npp.2009.72 [DOI] [PubMed] [Google Scholar]
43.de Mello AH, Souza Lda R, Cereja AC, Schraiber Rde B, Florentino D, Martins MM, et al. Effect of subchronic administration of agomelatine on brain energy metabolism and oxidative stress parameters in rats. Psychiatry Clin Neurosci. 2016;70: 159–66 doi: 10.1111/pcn.12371 [DOI] [PubMed] [Google Scholar]
44.Hyeon JY, Choi EY, Choe SH, Park HR, Choi JI, Choi IS, et al. Agomelatine, a MT1/MT2 melatonergic receptor agonist with serotonin 5-HT2C receptor antagonistic properties, suppresses Prevotella intermedia lipopolysaccharide-induced production of proinflammatory mediators in murine macrophages. Arch Oral Biol. 2017;82: 11–18. doi: 10.1016/j.archoralbio.2017.05.015 [DOI] [PubMed] [Google Scholar]
45.Horowitz MA, Wertz J, Zhu D, Cattaneo A, Musaelyan K, Nikkheslat N, et al. Antidepressant compounds can be both pro- and anti-inflammatory in human hippocampal cells. Int J Neuropsychopharmacol. 2014;18. doi: 10.1093/ijnp/pyu076 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Asci H, Ozmen O, Erzurumlu Y, Sofu A, Icten P, Kaynak M. Agomelatine protects heart and aorta against lipopolysaccharide-induced cardiovascular toxicity via inhibition of NF-kbeta phosphorylation. Drug Chem Toxicol. 2022;45: 133–142. doi: 10.1080/01480545.2019.1663209 [DOI] [PubMed] [Google Scholar]
47.Chiba S, Numakawa T, Ninomiya M, Richards MC, Wakabayashi C, Kunugi H. Chronic restraint stress causes anxiety- and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain-derived neurotrophic factor in the prefrontal cortex. Prog Neuropsychopharmacol Biol Psychiatry. 2012;39: 112–119. doi: 10.1016/j.pnpbp.2012.05.018 [DOI] [PubMed] [Google Scholar]
48.Jung J, Lee SM, Lee MJ, Ryu JS, Song JH, Lee JE, et al. Lipidomics reveals that acupuncture modulates the lipid metabolism and inflammatory interaction in a mouse model of depression. Brain Behav Immun. 2021;94: 424–436. doi: 10.1016/j.bbi.2021.02.003 [DOI] [PubMed] [Google Scholar]
49.Yan HC, Cao X, Das M, Zhu XH, Gao TM. Behavioral animal models of depression. Neurosci Bull. 2010;26(4):327–37. doi: 10.1007/s12264-010-0323-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Campos AC, Fogaça MV, Aguiar DC, Guimarães FS. Animal models of anxiety disorders and stress. Revista brasileira de psiquiatria (Sao Paulo, Brazil: 1999). 2013;35 Suppl 2:S101–11. doi: 10.1590/1516-4446-2013-1139 [DOI] [PubMed] [Google Scholar]
51.Wu Y, Ran L, Yang Y, Gao X, Peng M, Liu S, et al. Deferasirox alleviates dss-induced ulcerative colitis in mice by inhibiting ferroptosis and improving intestinal microbiota. Life Sci. 2023;314: 121312. doi: 10.1016/j.lfs.2022.121312 [DOI] [PubMed] [Google Scholar]
52.Tang J, Liang X, Dou X, Qi Y, Yang C, Luo Y, et al. Exercise rather than fluoxetine promotes oligodendrocyte differentiation and myelination in the hippocampus in a male mouse model of depression. Transl Psychiatry. 2021;11: 622. doi: 10.1038/s41398-021-01747-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Song AQ, Gao B, Fan JJ, Zhu YJ, Zhou J, Wang YL, et al. NLRP1 inflammasome contributes to chronic stress-induced depressive-like behaviors in mice. J Neuroinflammation. 2020;17: 178. doi: 10.1186/s12974-020-01848-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Lin J, Song Z, Chen X, Zhao R, Chen J, Chen H, et al. Trans-cinnamaldehyde shows anti-depression effect in the forced swimming test and possible involvement of the endocannabinoid system. Biochem Biophys Res Commun. 2019;518: 351–356. doi: 10.1016/j.bbrc.2019.08.061 [DOI] [PubMed] [Google Scholar]
55.Cai M, Lee JH, Yang EJ. Electroacupuncture attenuates cognition impairment via anti-neuroinflammation in an Alzheimer’s disease animal model. J Neuroinflammation. 2019;16: 264. doi: 10.1186/s12974-019-1665-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Zhang X, Jing S, Lin H, Sun W, Jiang W, Yu C, et al. Anti-fatigue effect of anwulignan via the NRF2 and PGC-1α signaling pathway in mice. Food Funct. 2019;10: 7755–7766. doi: 10.1039/c9fo01182j [DOI] [PubMed] [Google Scholar]
57.Kong D, Yan Y, He XY, Yang H, Liang B, Wang J, et al. Effects of resveratrol on the mechanisms of antioxidants and estrogen in Alzheimer’s disease. Biomed Res Int. 2019;2019: 8983752. doi: 10.1155/2019/8983752 [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Wang ZX, Lian WW, He J, He XL, Wang YM, Pan CH, et al. Cornuside ameliorates cognitive impairments in scopolamine induced ad mice: involvement of neurotransmitter and oxidative stress. J Ethnopharmacol. 2022;293: 115252. doi: 10.1016/j.jep.2022.115252 [DOI] [PubMed] [Google Scholar]
59.Yuan YH, Sun JD, Wu MM, Hu JF, Peng SY, Chen NH. Rotenone could activate microglia through nfκb associated pathway. Neurochem Res. 2013;38: 1553–1560. doi: 10.1007/s11064-013-1055-7 [DOI] [PubMed] [Google Scholar]
60.El Mouatassim S, Guérin P, Ménézo Y. Expression of genes encoding antioxidant enzymes in human and mouse oocytes during the final stages of maturation. Mol Hum Reprod. 1999;5: 720–725. doi: 10.1093/molehr/5.8.720 [DOI] [PubMed] [Google Scholar]
61.Feng X, Wang H, Ye S, Guan J, Tan W, Cheng S, et al. Up-regulation of microRNA-126 may contribute to pathogenesis of ulcerative colitis via regulating NF-kappaB inhibitor IκBα. PloS One. 2012;7: e52782. doi: 10.1371/journal.pone.0052782 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Zha H, Miao W, Rong W, Wang A, Jiang W, Liu R, et al. Remote ischaemic perconditioning reduces the infarct volume and improves the neurological function of acute ischaemic stroke partially through the miR-153-5p/TLR4/p65/IkBa signalling pathway. Folia Neuropathol. 2021;59: 335–349. doi: 10.5114/fn.2021.112127 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0289248.r001

Decision Letter 0

Mohamed Abdel-Daim

8 Mar 2023

PONE-D-23-03416Agomelatine improves depression through mechanisms affecting oxidative stress and inflammation via altered catalase activityPLOS ONE

Dear Dr. Xu,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 22 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Mohamed Abdel-Daim, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please note that PLOS ONE has specific guidelines on code sharing for submissions in which author-generated code underpins the findings in the manuscript. In these cases, all author-generated code must be made available without restrictions upon publication of the work. Please review our guidelines at https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-code and ensure that your code is shared in a way that follows best practice and facilitates reproducibility and reuse.

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

4. Thank you for stating the following financial disclosure:

"This work was supported by The National Natural Science Foundation of China (grant number 8177051246)."

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

5. Thank you for stating the following in the Funding Section of your manuscript:

"This work was supported by The National Natural Science Foundation of China (grant number 8177051246)."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"This work was supported by The National Natural Science Foundation of China (grant number 8177051246)."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

6. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The current work aimed to investigate the possible antidepressant effect of agomelatine (AGO) and the role of the catalase (CAT) enzyme in mediating this effect. In addition, the theories of increased oxidative stress and neuroinflammation were tested in chronic restraint stress model. The manuscript follows the standard scientific way; however, it needs much improvement. I have The following concerns about the manuscript:

1) Title

It doesn’t express the results of the current study in a good way because 1) AGO was given from day 1 of the study and not after the development of the chronic restraint stress (CRS) model; 2) There were no significant differences regarding the inflammatory markers tested between all groups; 3) Blocking catalase by deferasirox didn’t worsen the CRS model. The authors could think of another title, I suggest “Agomelatine prevented depression in chronic restraint stress model through enhanced catalase activity and halted oxidative stress”. If significant results were found regarding the inflammatory markers after revising the post hoc analysis of ANOVA, you may express this in the title as well.

2) Abstract

• Page 2, Line 21 (first line): The abbreviation of agomelatine (AGO) should be mentioned and used subsequently after that, see also line 32 & 39.

3) Introduction

• Page 3, lines 52, 53: Please, modify the sentence “agomelatine (AGO) may exert its anxiolytic, depressive effects …” and choose a better word than “depressive” to express the drug-calming effect; otherwise, remove it. This is because “depressive” is not logical while the study aimed to test agomelatine in the treatment of depression.

• Page 3, line 56: Please, add references to the sentence stating “Previous studies”.

• Page 4, line 67: “glutathione” is not an antioxidant enzyme, please edit to “glutathione peroxidase”.

• Page 4, line 67: The word “neutralize” is better to be changed to “overcome”.

• Page 5, line 89: The Phrase “we propose a novel hypothesis” is not accurate since the relation between depression and increased ROS has been proposed many years ago. It is better to be edited to “Based on the proposed hypothesis of the involvement of oxidative stress in the pathogenesis of MDD, …”

• Page 5, line 90: Please, edit the phrase “AGO can improve depression” to “AGO may improve depression” so that the research question carries the possibility of the desired effect.

4) Results

• Page 6, line 117: Please, edit the “abovementioned trials” by adding a space after the word “above” and replacing “trials” with “tests”. Also, replace the word “trial” in line 118.

• Page 6, line 122: The phrase “through routes that enhance CAT activity” is not appropriate in place because, in this paragraph, you only express the behavioral test results and the results of oxidative stress have not been mentioned yet.

• Page 8, line 152: Please, delete “CAT inhibitor” because deferasirox is primarily classified as an iron chelator, and in the results, we only mention the effect of the tested drugs without explanation.

• Page 9, line 177: Please, edit this sentence “The results showed that the CRS group had significantly lower serum SOD and MDA concentrations after AGO treatment” as serum SOD was significantly increased with AGO treatment.

• Page 9, line 179: Please, remove this sentence “This is because CRS causes elevated levels of oxidative stress, and AGO was shown to attenuate oxidative stress in mouse models of depression, potentially because of its effects on CAT activity” as it is an explanatory sentence. It should be placed within the discussion.

• Page 9, line 185: NF-κB is a downstream regulator of inflammatory cytokines. Please, correct the word “upstream regulators”.

5) Discussion

• Page 10, line 203: This sentence is vague “This means that, except in melatonin and 5-HT2C, the synergistic effect of regulating oxidative stress may be another mode of action for AGO”. Please, edit the sentence to be more clear and express the desired aim.

• Page 11, line 228: The sentence “In turn, this leads to increased CAT expression…” should be edited and clarified whether you want to refer to the results of the CRS or AGO results. Also, revise the changes of CAT, SOD, and MDA accordingly.

• Page 12, line 246: The following inference is not correct “demonstrating that oxidative stress may be caused by the inhibition of CAT activity”. It refers that other mechanisms than CAT inhibition participating in the CRS model &/or MDD pathogenesis. Your inference could be correct if the administration of DFX further worse the CRS model. Please, explain or criticize.

• Page 13, line 259: Please, edit the sentence starting with “AGO blocked this activation …” to show that these are the result of a previous study (reference 39) and not the current study.

6) Conclusion

• Page 13, line 270: Please, edit the phrase “is the underlying antidepressant mechanism” to “is one of the underlying antidepressant mechanisms”.

7) Methods

• Page 13, line 272: “Study subjects” is better to be replaced with “Study animals”.

• Page 14 (Model construction and grouping): Please, add references to the paragraph on model establishing.

• Page 14, line 285: Please, check this phrase for grammar “Each mouse was fed water on an ad libitum diet”. I think the preposition should be removed “Each mouse was fed water ad libitum”.

• Page 14, line 286: Please, mention the criteria of “Successful mice” and a reference for that.

• Page 14, line 290: Please, correct the drug name “dilarosine” to “deferasirox”.

• Page 14, lines 291-297: Please, mention the references for the selected dose of the drugs. Also, mention the route of administration clearly and edit “saline infusion for gavage”. How did you calculate the dose of the saline (normal saline 10 mg/kg/day) while it is a solution?

• Page 15: Please, add references to the Sugar-water preference test, Open Field Test, and Forced swimming test.

• Page 16: Please, add references to Immunohistochemistry. Also, specify which part of the brain has been used in paraffin tissue sections.

• Page 17, line 340: Please, mention the catalog number and the scientific name of the ELISA kits used to assess CAT, SOD, and MDA.

• Page 17, line 342: Please, add the reference for CAT activity detection.

• Page 17, line 354: Please, mention the reference for the primers’ design.

• Page 18, line 381: It is illogical to use the T-test to compare between two groups' mean since SPSS contains post hoc tests after ANOVA. Please, recheck all your statistical analysis with the appropriate post hoc test again.

8) Figure legends

• Figure 1 legend (Page 6, line 124:) I suggest using the following title “Effects of the CRS, AGO, and DFX intervention on body weight and behavioral tests” and remove the phrase “Effects of the CRS, AGO, and DFX intervention” from the subsequent subtitle. Please, edit as appropriate and add the name of the statistical test used.

• Figure 2 legend (Page 7, line 143): Please, edit the title to “Effects of the CRS, AGO, and DFX intervention on immunohistochemistry of CAT protein in the hippocampus of mice” and add the name of the statistical test used.

• Figure 3 legend (Page 8, line 157): Please, add the name of the statistical test used.

9) English proof

• Please, the manuscript has to be checked by a native English speaker.

Thank you and best wishes.

Reviewer #2: The manuscript is discussing the molecular mechanisms underlying the anti-depressant effect of Agomelatine.

some important questions need to be answered:

1-Where the blood samples taken are collected from?

2- What is the reference for the duration of the induction method?

3- How is the doses for the used drugs determined ?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Sherihan SalahEldin Abdelhmaid

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Feb 9;19(2):e0289248. doi: 10.1371/journal.pone.0289248.r002

Author response to Decision Letter 0

14 Mar 2023

Thanks for taking your time to review this manuscript. We really appreciate all editors and reviewers detailed comments and suggestions! According to editors valuable comments, we ensure that our manuscript meets PLOS ONE's style requirements. As suggested, we have attached the Funding Statement and Role of Funder statement in the resubmission cover letter and the ethics statement is moved to the Methods section in the Manuscript.

According to reviewers valuable comments, we have made corresponding changes and adjustments in the Revised Manuscript with Track Changes and the Response to Reviewers. Those changes are highlighted in blue within the re-submitted files.

We hope you will find this revised version satisfactory and look forward to hearing from you. We would be glad to respond to any further questions and comments that you may have.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(60.2KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0289248.r003

Decision Letter 1

Mohamed Abdel-Daim

15 May 2023

PONE-D-23-03416R1Agomelatine prevented depression in the chronic restraint stress model through enhanced catalase activity and halted oxidative stressPLOS ONE

Dear Dr. Xu,

Please submit your revised manuscript by Jun 29 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Mohamed Abdel-Daim, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: Thank you so much. The authors addressed most of my concerns, but minor changes should be considered:

- Page 11, line 230: Please, add the references of the “previous studies” mentioned.

- Page 14, line 286: Please, add the criteria of “Successful mice” with references to the revised manuscript.

- Page 17, line 354: Please, add the sequences of the primers’ and the references to the revised manuscript.

Best wishes.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

**********

PLoS One. 2024 Feb 9;19(2):e0289248. doi: 10.1371/journal.pone.0289248.r004

Author response to Decision Letter 1

23 Jun 2023

Response Letter to Reviewers

Thanks very much for taking the time to review this manuscript and providing us with this great opportunity to submit a revised version of our manuscript (Manuscript: PONE-D-23-03416). We appreciate all your detailed comments and suggestions! We have incorporated them, and those changes are highlighted in yellow within the re-submitted files. We hope this revised manuscript has addressed your concerns and look forward to hearing from you.

I have the following replies to the comments of reviewers.

---------------------------------------------------------------------------------------------------------------------------

# Comments from reviewer 1:

Thank you so much. The authors addressed most of my concerns, but minor changes should be considered:

- Page 11, line 230: Please, add the references of the “previous studies” mentioned.

- Page 14, line 286: Please, add the criteria of “Successful mice” with references to the revised manuscript.

- Page 17, line 354: Please, add the sequences of the primers’ and the references to the revised manuscript.

Best wishes.

# Authors response:

Thank you very much for your time in reviewing the manuscript and your encouraging comments on the merits. We also appreciate your clear feedback and hope that you will find that the explanation has fully addressed all of your concerns and that this re-submitted manuscript is satisfactory. Below, we will specifically address the comments point-by-point, and changes are highlighted in yellow within the re-submitted files.

Comment 1:” Page 11, line 230: Please, add the references of the “previous studies” mentioned.”

Response:

Thank you for the detailed review to improve our manuscript. As suggested by the reviewer, we add the references of the “previous studies”. (Page 11, lines 231)

“Evidence accumulated over the extensive course of a previous study[40,41] supports the idea that the antidepressant effect of AGO is because of its synergistic melatoninergic and serotonergic effects [29].”

Reference:

40. Millan MJ, Marin P, Kamal M, Jockers R, Chanrion B, Labasque M, et al. The melatonergic agonist and clinically active antidepressant, agomelatine, is a neutral antagonist at 5-HT(2C) receptors. Int J Neuropsychopharmacol. 2011;14(6):768-83. doi: 10.1017/s1461145710001045.

41. Norman TR, Cranston I, Irons JA, Gabriel C, Dekeyne A, Millan MJ, et al. Agomelatine suppresses locomotor hyperactivity in olfactory bulbectomised rats: a comparison to melatonin and to the 5-HT(2c) antagonist, S32006. European journal of pharmacology. 2012;674(1):27-32. doi: 10.1016/j.ejphar.2011.10.010.

Comment 2: ”Page 14, line 286: Please, add the criteria of “Successful mice” with references to the revised manuscript.”

Response:

Thank you for the detailed review to improve our manuscript. As suggested by the reviewer, we have added this important information to our re-submitted manuscript. (Page 14, lines 283-289)

“We have considered the following aspects to ensure that the CRS model has been successfully built as much as possible: The weight of the mice after CRS modeling decreased significantly, with statistical significance.Through behavioral tests, it proved that mice after CRS modeling had depressive behavior. In this experiment, 1) the decreased sugar water preference rate in the sugar-water preference test, 2) the prolonged forced swimming rest time in the forced swimming test, 3) the decreased central total distance in the open field tests.[49,50]”

References:

49. Yan HC, Cao X, Das M, Zhu XH, Gao TM. Behavioral animal models of depression. Neurosci Bull. 2010;26(4):327-37. doi: 10.1007/s12264-010-0323-7.

50. Campos AC, Fogaça MV, Aguiar DC, Guimarães FS. Animal models of anxiety disorders and stress. Revista brasileira de psiquiatria (Sao Paulo, Brazil : 1999). 2013;35 Suppl 2:S101-11. doi: 10.1590/1516-4446-2013-1139.

Comment 3:“Page 17, line 354: Please, add the sequences of the primers’ and the references to the revised manuscript.”

Response:

Thank you for pointing this out. We have revised it in our manuscript to reflect your great suggestion. (Page 18, lines 366)

Gene Forward primer（5’-3’） Reverse primer（5’-3’）

NF-κB[59] CCGCTCGAGCTATGGACGATCTGTTTCCCCTC CGGAATTCACCTTAGGAGCTGATCTGAC

CAT[60] GCAGATACCTGTGAACTGTC GTAGAATGTCCGCACCTGAG

IкBα[61] CACTCCATCCTGAAGGCTACCAA AAGGGCAGTCCGGCCATTA

GAPDH[62] TGTGGGCATCAATGGATTTGG ACACCATGTATTCCGGGTCAAT

References:

59. Yuan YH, Sun JD, Wu MM, Hu JF, Peng SY, Chen NH. Rotenone could activate microglia through nfκb associated pathway. Neurochem Res. 2013;38: 1553-1560. doi: 10.1007/s11064-013-1055-7.

60. El Mouatassim S, Guérin P, Ménézo Y. Expression of genes encoding antioxidant enzymes in human and mouse oocytes during the final stages of maturation. Mol Hum Reprod. 1999;5: 720-725. doi: 10.1093/molehr/5.8.720.

61. Feng X, Wang H, Ye S, Guan J, Tan W, Cheng S, et al. Up-regulation of microRNA-126 may contribute to pathogenesis of ulcerative colitis via regulating NF-kappaB inhibitor IκBα. PloS One. 2012;7: e52782. doi: 10.1371/journal.pone.0052782.

62. Zha H, Miao W, Rong W, Wang A, Jiang W, Liu R, et al. Remote ischaemic perconditioning reduces the infarct volume and improves the neurological function of acute ischaemic stroke partially through the miR-153-5p/TLR4/p65/IkBa signalling pathway. Folia Neuropathol. 2021;59: 335-349. doi: 10.5114/fn.2021.112127.

Finally, we would like to take this opportunity to thank you again for all your time and for providing us with this excellent opportunity to improve the manuscript. We hope you will find this revised version satisfactory.

Attachment

Submitted filename: Response to Reviewers2.docx

Click here for additional data file.^{(17.2KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0289248.r005

Decision Letter 2

Mohamed Abdel-Daim

14 Jul 2023

Agomelatine prevented depression in the chronic restraint stress model through enhanced catalase activity and halted oxidative stress

PONE-D-23-03416R2

Dear Dr. Xu,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mohamed Abdel-Daim, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0289248.r006

Acceptance letter

Mohamed Abdel-Daim

2 Feb 2024

PONE-D-23-03416R2

PLOS ONE

Dear Dr. Yu,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Mohamed Abdel-Daim

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File

(ZIP)

Click here for additional data file.^{(38.6MB, zip)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(60.2KB, docx)}

Attachment

Submitted filename: Response to Reviewers2.docx

Click here for additional data file.^{(17.2KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0289248.ref001] 1.Murray CJ, Atkinson C, Bhalla K, Birbeck G, Burstein R, Chou D, et al. The state of US health, 1990–2010: burden of diseases, injuries, and risk factors. JAMA. 2013;310: 591–608. doi: 10.1001/jama.2013.13805 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref002] 2.Huang Y, Wang Y, Wang H, Liu Z, Yu X, Yan J, et al. Prevalence of mental disorders in China: a cross-sectional epidemiological study. Lancet Psychiatry. 2019;6: 211–224. doi: 10.1016/S2215-0366(18)30511-X [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref003] 3.Ferrari AJ, Somerville AJ, Baxter AJ, Norman R, Patten SB, Vos T, et al. Global variation in the prevalence and incidence of major depressive disorder: a systematic review of the epidemiological literature. Psychol Med. 2013;43: 471–481. doi: 10.1017/S0033291712001511 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref004] 4.Lu Y, Ho CS, McIntyre RS, Wang W, Ho RC. Agomelatine-induced modulation of brain-derived neurotrophic factor (BDNF) in the rat hippocampus. Life Sci. 2018;210: 177–184. doi: 10.1016/j.lfs.2018.09.003 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref005] 5.Chen F, Chen S, Liu J, Amin N, Jin W, Fang M. Agomelatine softens depressive-like behavior through the regulation of autophagy and apoptosis. BioMed Res Int. 2021;2021: 6664591. doi: 10.1155/2021/6664591 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[pone.0289248.ref006] 6.Lan T, Wu Y, Zhang Y, Li S, Zhu Z, Wang L, et al. Agomelatine rescues lipopolysaccharide-induced neural injury and depression-like behaviors via suppression of the Gαi-2-PKA-ASK1 signaling pathway. J Neuroinflammation. 2022;19: 117. doi: 10.1186/s12974-022-02479-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref007] 7.Rebai R, Jasmin L, Boudah A. Agomelatine effects on fat-enriched diet induced neuroinflammation and depression-like behavior in rats. Biomed Pharmacother. 2021;135: 111246. doi: 10.1016/j.biopha.2021.111246 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref008] 8.Ozdamar Unal G, Demirdas A, Nazıroglu M, Ovey IS. Agomelatine attenuates calcium signaling and apoptosis via the inhibition of TRPV1 channel in the hippocampal neurons of rats with chronic mild stress depression model. Behav Brain Res. 2022;434: 114033. doi: 10.1016/j.bbr.2022.114033 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref009] 9.Rainer Q, Xia L, Guilloux JP, Gabriel C, Mocaër E, Hen R, et al. Beneficial behavioural and neurogenic effects of agomelatine in a model of depression/anxiety. Int J Neuropsychopharmacol. 2012;15: 321–335. doi: 10.1017/S1461145711000356 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref010] 10.Berton O, Nestler EJ. New approaches to antidepressant drug discovery: beyond monoamines. Nat Rev Neurosci. 2006;7: 137–151. doi: 10.1038/nrn1846 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref011] 11.Lindqvist D, Dhabhar FS, James SJ, Hough CM, Jain FA, Bersani FS, et al. Oxidative stress, inflammation and treatment response in major depression. Psychoneuroendocrinology. 2017;76: 197–205. doi: 10.1016/j.psyneuen.2016.11.031 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref012] 12.Maes M, Mihaylova I, Kubera M, Uytterhoeven M, Vrydags N, Bosmans E. Increased plasma peroxides and serum oxidized low density lipoprotein antibodies in major depression: markers that further explain the higher incidence of neurodegeneration and coronary artery disease. J Affect Disord. 2010;125: 287–294. doi: 10.1016/j.jad.2009.12.014 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref013] 13.Yano T, Oku M, Akeyama N, Itoyama A, Yurimoto H, Kuge S, et al. A novel fluorescent sensor protein for visualization of redox states in the cytoplasm and in peroxisomes. Mol Cell Biol. 2010;30: 3758–3766. doi: 10.1128/MCB.00121-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref014] 14.Kurutas EB. The importance of antioxidants which play the role in cellular response against oxidative/nitrosative stress: current state. Nutr J. 2016;15: 71. doi: 10.1186/s12937-016-0186-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref015] 15.Chelikani P, Fita I, Loewen PC. Diversity of structures and properties among catalases. Cell Mol Life Sci. 2004;61: 192–208. doi: 10.1007/s00018-003-3206-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref016] 16.Antonenkov VD, Grunau S, Ohlmeier S, Hiltunen JK. Peroxisomes are oxidative organelles. Antioxid Redox Signal. 2010;13: 525–537. doi: 10.1089/ars.2009.2996 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref017] 17.Rai A, Gill M, Kinra M, Shetty R, Krishnadas N, Rao CM, et al. Catechin ameliorates depressive symptoms in Sprague Dawley rats subjected to chronic unpredictable mild stress by decreasing oxidative stress. Biomed Rep. 2019;11: 79–84. doi: 10.3892/br.2019.1226 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref018] 18.Ding Q, Tian Y, Wang X, Li P, Su D, Wu C, et al. Oxidative damage of tryptophan hydroxylase-2 mediated by peroxisomal superoxide anion radical in brains of mouse with depression. J Am Chem Soc. 2020;142: 20735–20743. doi: 10.1021/jacs.0c09576 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref019] 19.Lyons JE, Ellis PE, Myers HK. Halogenated metalloporphyrin complexes as catalysts for selective reactions of acyclic alkanes with molecular oxygen. J Catal. 1995;155: 59–73. doi: 10.1006/jcat.1995.1188 [DOI] [Google Scholar]

[pone.0289248.ref020] 20.Szuster-Ciesielska A, Słotwińska M, Stachura A, Marmurowska-Michałowska H, Dubas-Slemp H, Bojarska-Junak A, et al. Accelerated apoptosis of blood leukocytes and oxidative stress in blood of patients with major depression. Prog Neuropsychopharmacol Biol Psychiatry. 2008;32: 686–694. doi: 10.1016/j.pnpbp.2007.11.012 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref021] 21.Vaváková M, Ďuračková Z, Trebatická J. Markers of oxidative stress and neuroprogression in depression disorder. Oxid Med Cell Longev. 2015;2015: 898393. doi: 10.1155/2015/898393 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref022] 22.Camkurt MA, Fındıklı E, Bakacak M, Tolun Fİ, Karaaslan MF. Evaluation of malondialdehyde, superoxide dismutase and catalase activity in fetal cord blood of depressed mothers. Clin Psychopharmacol Neurosci. 2017;15: 35–39. doi: 10.9758/cpn.2017.15.1.35 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref023] 23.Ozcan ME, Gulec M, Ozerol E, Polat R, Akyol O. Antioxidant enzyme activities and oxidative stress in affective disorders. Int Clin Psychopharmacol. 2004;19: 89–95. doi: 10.1097/00004850-200403000-00006 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref024] 24.Bhatt S, Mahesh R, Jindal A, Devadoss T. Neuropharmacological effect of novel 5-HT3 receptor antagonist, N-n-propyl-3-ethoxyquinoxaline-2-carboxamide (6n) on chronic unpredictable mild stress-induced molecular and cellular response: behavioural and biochemical evidences. Pharmacol Rep. 2014;66: 804–810. doi: 10.1016/j.pharep.2014.05.002 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref025] 25.Olsen RH, Johnson LA, Zuloaga DG, Limoli CL, Raber J. Enhanced hippocampus-dependent memory and reduced anxiety in mice over-expressing human catalase in mitochondria. J Neurochem. 2013;125: 303–313. doi: 10.1111/jnc.12187 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref026] 26.Choi JH, Lee MJ, Chang Y, Lee S, Kim HJ, Lee SW, et al. Valeriana fauriei exerts antidepressant-like effects through anti-inflammatory and antioxidant activities by inhibiting brain-derived neurotrophic factor associated with chronic restraint stress. Rejuvenation Res. 2020;23: 245–255. doi: 10.1089/rej.2018.2157 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref027] 27.Guardiola-Lemaitre B, De Bodinat C, Delagrange P, Millan MJ, Munoz C, Mocaër E. Agomelatine: mechanism of action and pharmacological profile in relation to antidepressant properties. Br J Pharmacol. 2014;171: 3604–3619. doi: 10.1111/bph.12720 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref028] 28.Lee SY, Lee SJ, Han C, Patkar AA, Masand PS, Pae CU. Oxidative/nitrosative stress and antidepressants: targets for novel antidepressants. Prog Neuropsychopharmacol Biol Psychiatry. 2013;46: 224–235. doi: 10.1016/j.pnpbp.2012.09.008 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref029] 29.Balmus IM, Ciobica A, Antioch I, Dobrin R, Timofte D. Oxidative stress implications in the affective disorders: main biomarkers, animal models relevance, genetic perspectives, and antioxidant approaches. Oxid Med Cell Longev. 2016;2016: 3975101. doi: 10.1155/2016/3975101 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref030] 30.Behr GA, Moreira JC, Frey BN. Preclinical and clinical evidence of antioxidant effects of antidepressant agents: implications for the pathophysiology of major depressive disorder. Oxid Med Cell Longev. 2012;2012: 609421. doi: 10.1155/2012/609421 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref031] 31.Michel TM, Pülschen D, Thome J. The role of oxidative stress in depressive disorders. Curr Pharm Des. 2012;18: 5890–5899. doi: 10.2174/138161212803523554 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref032] 32.Liu T, Zhong S, Liao X, Chen J, He T, Lai S, et al. A meta-analysis of oxidative stress markers in depression. PLoS One. 2015;10: e0138904. doi: 10.1371/journal.pone.0138904 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref033] 33.Herken H, Gurel A, Selek S, Armutcu F, Ozen ME, Bulut M, et al. Adenosine deaminase, nitric oxide, superoxide dismutase, and xanthine oxidase in patients with major depression: impact of antidepressant treatment. Arch Med Res. 2007;38: 247–252. doi: 10.1016/j.arcmed.2006.10.005 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref034] 34.Jiménez-Fernández S, Gurpegui M, Díaz-Atienza F, Pérez-Costillas L, Gerstenberg M, Correll CU. Oxidative stress and antioxidant parameters in patients with major depressive disorder compared to healthy controls before and after antidepressant treatment: results from a meta-analysis. J Clin Psychiatry. 2015;76: 1658–1667. doi: 10.4088/JCP.14r09179 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref035] 35.Bakunina N, Pariante CM, Zunszain PA. Immune mechanisms linked to depression via oxidative stress and neuroprogression. Immunology. 2015;144: 365–373. doi: 10.1111/imm.12443 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref036] 36.Moylan S, Maes M, Wray NR, Berk M. The neuroprogressive nature of major depressive disorder: pathways to disease evolution and resistance, and therapeutic implications. Mol Psychiatry. 2013;18: 595–606. doi: 10.1038/mp.2012.33 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref037] 37.Lucca G, Comim CM, Valvassori SS, Réus GZ, Vuolo F, Petronilho F, et al. Effects of chronic mild stress on the oxidative parameters in the rat brain. Neurochem Int. 2009;54: 358–362. doi: 10.1016/j.neuint.2009.01.001 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref038] 38.Lucca G, Comim CM, Valvassori SS, Réus GZ, Vuolo F, Petronilho F, et al. Increased oxidative stress in submitochondrial particles into the brain of rats submitted to the chronic mild stress paradigm. J Psychiatr Res. 2009;43: 864–869. doi: 10.1016/j.jpsychires.2008.11.002 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref039] 39.Réus GZ, Nacif MP, Abelaira HM, Tomaz DB, dos Santos MA, Carlessi AS, et al. Ketamine ameliorates depressive-like behaviors and immune alterations in adult rats following maternal deprivation. Neurosci Lett. 2015;584: 83–87. doi: 10.1016/j.neulet.2014.10.022 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref040] 40.Millan MJ, Marin P, Kamal M, Jockers R, Chanrion B, Labasque M, et al. The melatonergic agonist and clinically active antidepressant, agomelatine, is a neutral antagonist at 5-HT(2C) receptors. Int J Neuropsychopharmacol. 2011;14(6):768–83. doi: 10.1017/S1461145710001045 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref041] 41.Norman TR, Cranston I, Irons JA, Gabriel C, Dekeyne A, Millan MJ, et al. Agomelatine suppresses locomotor hyperactivity in olfactory bulbectomised rats: a comparison to melatonin and to the 5-HT(2c) antagonist, S32006. European journal of pharmacology. 2012;674(1):27–32. doi: 10.1016/j.ejphar.2011.10.010 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref042] 42.Soumier A, Banasr M, Lortet S, Masmejean F, Bernard N, Kerkerian-Le-Goff L, et al. Mechanisms contributing to the phase-dependent regulation of neurogenesis by the novel antidepressant, agomelatine, in the adult rat hippocampus. Neuropsychopharmacology. 2009;34: 2390–2403. doi: 10.1038/npp.2009.72 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref043] 43.de Mello AH, Souza Lda R, Cereja AC, Schraiber Rde B, Florentino D, Martins MM, et al. Effect of subchronic administration of agomelatine on brain energy metabolism and oxidative stress parameters in rats. Psychiatry Clin Neurosci. 2016;70: 159–66 doi: 10.1111/pcn.12371 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref044] 44.Hyeon JY, Choi EY, Choe SH, Park HR, Choi JI, Choi IS, et al. Agomelatine, a MT1/MT2 melatonergic receptor agonist with serotonin 5-HT2C receptor antagonistic properties, suppresses Prevotella intermedia lipopolysaccharide-induced production of proinflammatory mediators in murine macrophages. Arch Oral Biol. 2017;82: 11–18. doi: 10.1016/j.archoralbio.2017.05.015 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref045] 45.Horowitz MA, Wertz J, Zhu D, Cattaneo A, Musaelyan K, Nikkheslat N, et al. Antidepressant compounds can be both pro- and anti-inflammatory in human hippocampal cells. Int J Neuropsychopharmacol. 2014;18. doi: 10.1093/ijnp/pyu076 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref046] 46.Asci H, Ozmen O, Erzurumlu Y, Sofu A, Icten P, Kaynak M. Agomelatine protects heart and aorta against lipopolysaccharide-induced cardiovascular toxicity via inhibition of NF-kbeta phosphorylation. Drug Chem Toxicol. 2022;45: 133–142. doi: 10.1080/01480545.2019.1663209 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref047] 47.Chiba S, Numakawa T, Ninomiya M, Richards MC, Wakabayashi C, Kunugi H. Chronic restraint stress causes anxiety- and depression-like behaviors, downregulates glucocorticoid receptor expression, and attenuates glutamate release induced by brain-derived neurotrophic factor in the prefrontal cortex. Prog Neuropsychopharmacol Biol Psychiatry. 2012;39: 112–119. doi: 10.1016/j.pnpbp.2012.05.018 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref048] 48.Jung J, Lee SM, Lee MJ, Ryu JS, Song JH, Lee JE, et al. Lipidomics reveals that acupuncture modulates the lipid metabolism and inflammatory interaction in a mouse model of depression. Brain Behav Immun. 2021;94: 424–436. doi: 10.1016/j.bbi.2021.02.003 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref049] 49.Yan HC, Cao X, Das M, Zhu XH, Gao TM. Behavioral animal models of depression. Neurosci Bull. 2010;26(4):327–37. doi: 10.1007/s12264-010-0323-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref050] 50.Campos AC, Fogaça MV, Aguiar DC, Guimarães FS. Animal models of anxiety disorders and stress. Revista brasileira de psiquiatria (Sao Paulo, Brazil: 1999). 2013;35 Suppl 2:S101–11. doi: 10.1590/1516-4446-2013-1139 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref051] 51.Wu Y, Ran L, Yang Y, Gao X, Peng M, Liu S, et al. Deferasirox alleviates dss-induced ulcerative colitis in mice by inhibiting ferroptosis and improving intestinal microbiota. Life Sci. 2023;314: 121312. doi: 10.1016/j.lfs.2022.121312 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref052] 52.Tang J, Liang X, Dou X, Qi Y, Yang C, Luo Y, et al. Exercise rather than fluoxetine promotes oligodendrocyte differentiation and myelination in the hippocampus in a male mouse model of depression. Transl Psychiatry. 2021;11: 622. doi: 10.1038/s41398-021-01747-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref053] 53.Song AQ, Gao B, Fan JJ, Zhu YJ, Zhou J, Wang YL, et al. NLRP1 inflammasome contributes to chronic stress-induced depressive-like behaviors in mice. J Neuroinflammation. 2020;17: 178. doi: 10.1186/s12974-020-01848-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref054] 54.Lin J, Song Z, Chen X, Zhao R, Chen J, Chen H, et al. Trans-cinnamaldehyde shows anti-depression effect in the forced swimming test and possible involvement of the endocannabinoid system. Biochem Biophys Res Commun. 2019;518: 351–356. doi: 10.1016/j.bbrc.2019.08.061 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref055] 55.Cai M, Lee JH, Yang EJ. Electroacupuncture attenuates cognition impairment via anti-neuroinflammation in an Alzheimer’s disease animal model. J Neuroinflammation. 2019;16: 264. doi: 10.1186/s12974-019-1665-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref056] 56.Zhang X, Jing S, Lin H, Sun W, Jiang W, Yu C, et al. Anti-fatigue effect of anwulignan via the NRF2 and PGC-1α signaling pathway in mice. Food Funct. 2019;10: 7755–7766. doi: 10.1039/c9fo01182j [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref057] 57.Kong D, Yan Y, He XY, Yang H, Liang B, Wang J, et al. Effects of resveratrol on the mechanisms of antioxidants and estrogen in Alzheimer’s disease. Biomed Res Int. 2019;2019: 8983752. doi: 10.1155/2019/8983752 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref058] 58.Wang ZX, Lian WW, He J, He XL, Wang YM, Pan CH, et al. Cornuside ameliorates cognitive impairments in scopolamine induced ad mice: involvement of neurotransmitter and oxidative stress. J Ethnopharmacol. 2022;293: 115252. doi: 10.1016/j.jep.2022.115252 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref059] 59.Yuan YH, Sun JD, Wu MM, Hu JF, Peng SY, Chen NH. Rotenone could activate microglia through nfκb associated pathway. Neurochem Res. 2013;38: 1553–1560. doi: 10.1007/s11064-013-1055-7 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref060] 60.El Mouatassim S, Guérin P, Ménézo Y. Expression of genes encoding antioxidant enzymes in human and mouse oocytes during the final stages of maturation. Mol Hum Reprod. 1999;5: 720–725. doi: 10.1093/molehr/5.8.720 [DOI] [PubMed] [Google Scholar]

[pone.0289248.ref061] 61.Feng X, Wang H, Ye S, Guan J, Tan W, Cheng S, et al. Up-regulation of microRNA-126 may contribute to pathogenesis of ulcerative colitis via regulating NF-kappaB inhibitor IκBα. PloS One. 2012;7: e52782. doi: 10.1371/journal.pone.0052782 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0289248.ref062] 62.Zha H, Miao W, Rong W, Wang A, Jiang W, Liu R, et al. Remote ischaemic perconditioning reduces the infarct volume and improves the neurological function of acute ischaemic stroke partially through the miR-153-5p/TLR4/p65/IkBa signalling pathway. Folia Neuropathol. 2021;59: 335–349. doi: 10.5114/fn.2021.112127 [DOI] [PubMed] [Google Scholar]

PERMALINK

Agomelatine prevented depression in the chronic restraint stress model through enhanced catalase activity and halted oxidative stress

Jiaxi Xu

Cheng Zhu

Piaopiao Jin

Wangdi Sun

Enyan Yu

Roles

Abstract

Background

Methods

Results

Conclusions

Background

Results

AGO attenuated depressive behavior in depression model mice

Fig 1. Effects of the CRS, AGO, and DFX intervention on body weight and behavioral tests.

Effect of AGO on CAT levels in mice

Fig 2. Effects of the CRS, AGO, and DFX intervention on immunohistochemistry of CAT protein in the hippocampus of mice.

Fig 3. ELISA, Western blot, and PCR results.

Effects of AGO on oxidative stress in depression model mice

Effect of AGO treatment on the NF-кB pathway in mouse models of depression

Discussion

Conclusions

Methods

Study animals

Model construction and grouping

Behavior index detection

Sugar-water preference test (SPT)

Open Field Test (OFT)

Forced swimming test (FST)

Immunohistochemistry

ELISA experiments

CAT activity detection

Quantitative real-time-PCR

Western blot

Statistical analysis

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Mohamed Abdel-Daim

Roles

Author response to Decision Letter 0

Decision Letter 1

Mohamed Abdel-Daim

Roles

Author response to Decision Letter 1

Decision Letter 2

Mohamed Abdel-Daim

Roles

Acceptance letter

Mohamed Abdel-Daim

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases