Skip to main content
PMC home page
eLife logoLink to eLife
. 2024 Jan 29;13:e93517. doi: 10.7554/eLife.93517

The tRNA thiolation-mediated translational control is essential for plant immunity

Xueao Zheng 1,2,3,4,5,6,†, Hanchen Chen 1,3,4,5,6,†, Zhiping Deng 7, Yujing Wu 1,3,4,5,6, Linlin Zhong 8, Chong Wu 1,3,4,5,6, Xiaodan Yu 1,3,4,5,6, Qiansi Chen 2, Shunping Yan 1,3,4,5,6,✉
Editors: Detlef Weigel9, Detlef Weigel10
PMCID: PMC10863982  PMID: 38284752

Abstract

Plants have evolved sophisticated mechanisms to regulate gene expression to activate immune responses against pathogen infections. However, how the translation system contributes to plant immunity is largely unknown. The evolutionarily conserved thiolation modification of transfer RNA (tRNA) ensures efficient decoding during translation. Here, we show that tRNA thiolation is required for plant immunity in Arabidopsis. We identify a cgb mutant that is hyper-susceptible to the pathogen Pseudomonas syringae. CGB encodes ROL5, a homolog of yeast NCS6 required for tRNA thiolation. ROL5 physically interacts with CTU2, a homolog of yeast NCS2. Mutations in either ROL5 or CTU2 result in loss of tRNA thiolation. Further analyses reveal that both transcriptome and proteome reprogramming during immune responses are compromised in cgb. Notably, the translation of salicylic acid receptor NPR1 is reduced in cgb, resulting in compromised salicylic acid signaling. Our study not only reveals a regulatory mechanism for plant immunity but also uncovers an additional biological function of tRNA thiolation.

Research organism: A. thaliana

Introduction

As sessile organisms, plants are frequently infected by different pathogens, which greatly affect plant growth and development, and cause a tremendous loss in agriculture (Jones and Dangl, 2006; Spoel and Dong, 2012; Yan et al., 2013). To defend against pathogens, plants have evolved sophisticated immune mechanisms. One essential immune regulator is the phytohormone salicylic acid (SA), which plays a central role in immune responses (Vlot et al., 2009; Peng et al., 2021; Yan and Dong, 2014; Zhou and Zhang, 2020). Upon pathogen infection, the biosynthesis of SA is dramatically induced. Plants defective in SA biosynthesis or SA signaling are hyper-susceptible to pathogens (Cao et al., 1997; Rekhter et al., 2019). Several independent forward genetic screens revealed that NONEXPRESSER OF PR GENES 1 (NPR1) is a master regulator of SA signaling (Canet et al., 2010; Cao et al., 1997; Ryals et al., 1997; Shah et al., 1997). In the Arabidopsis npr1 mutant, the SA-mediated immune responses are dramatically reduced. Biochemical and structural studies suggested that NPR1 and its homologs NPR3 and NPR4 are SA receptors (Ding et al., 2018; Fu et al., 2012; Kumar et al., 2022; Wang et al., 2020; Wu et al., 2012; Zhou et al., 2023).

Immune responses involve massive changes in gene expression at transcription, post-transcription, translation, and post-translation levels. Compared with other regulatory mechanisms, the translation regulation mechanism is less well studied. Notably, it is reported that both the pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) involve translational reprogramming (Xu et al., 2017; Yoo et al., 2020). And PABP/purine-rich motif was described as an initiation module for PTI-associated translation (Wang et al., 2022) and CDC123, an ATP-grasp protein, is a key activator of ETI-associated translation (Chen et al., 2023b).

During translation, the code information of mRNA is decoded by transfer RNA (tRNA) molecules, which carry different amino acids. In this sense, the tRNA molecules function as deliverers of the building blocks for translation. The decoding efficiency of tRNAs is affected by their abundance and modifications as well as aminoacyl-tRNA synthetases, amino acid abundance, and elongation factors. Interestingly, an emerging regulatory role for tRNA modifications during elongation has been reported (Delaunay et al., 2016; Schaffrath and Leidel, 2017; Torres et al., 2014).

Currently, more than 150 different tRNA modifications have been identified (Agris et al., 2018). Among them, the 5-methoxycarbonylmethyl-2-thiouridine of uridine at wobble nucleotide (mcm5s2U) is highly conserved in all eukaryotes. The mcm5s2U modification is present in the wobble position of tRNA-Lys(UUU), tRNA-Gln(UUG), and tRNA-Glu(UUC) (Huang et al., 2005; Lu et al., 2005; Sen and Ghosh, 1976). In budding yeast (Saccharomyces cerevisiae), the 5-methoxycarbonylmethyl of uridine (mcm5U) is catalyzed by the Elongator protein (ELP) complex and the Trm9/112 complex, whereas thiolation (s2U) is mediated by the ubiquitin-related modifier 1 (URM1) pathway involving URM1, UBA4, NCS2, and NCS6 (Leidel et al., 2009; Nakai et al., 2004; Noma et al., 2009; Zabel et al., 2008). Loss of the mcm5s2U modification causes ribosome pausing at AAA and CAA codons, which results in defective co-translational folding of nascent peptides and protein aggregation, thereby disrupting proteome homeostasis (Nedialkova and Leidel, 2015; Ranjan and Rodnina, 2017; Rezgui et al., 2013). In yeasts, the mcm5s2U modification was reported to regulate cell cycle, DNA damage repair, and abiotic stress responses (Dewez et al., 2008; Jablonowski et al., 2006; Klassen et al., 2017; Leidel et al., 2009; Nedialkova and Leidel, 2015; Zinshteyn and Gilbert, 2013). In humans, loss of the mcm5s2U modification causes numerous disorders including severe developmental defects, neurological diseases, tumorigenesis, and cancer metastasis (Pan, 2018; Shaheen et al., 2019; Simpson et al., 2009; Torres et al., 2014; Waszak et al., 2020). In plants, loss of the mcm5s2U modification was associated with developmental defects and hypersensitivity to heat stress (Leiber et al., 2010; Nakai et al., 2019; Xu et al., 2020). However, it remains unknown whether the mcm5s2U modification is involved in plant immune responses.

In this study, we found that the mcm5s2U modification is required for plant immunity. Transcriptome and proteome analyses revealed that the mcm5s2U modification is essential for the reprogramming of immune-related genes. Especially, the translation of the master immune regulator NPR1 is compromised in the mcm5s2U mutant. Our study not only expands the biological function of tRNA thiolation but also highlights the importance of translation control in plant immunity.

Results

ROL5 is required for plant immunity

In a study to test the disease phenotypes of some transgenic Arabidopsis, we found that one transgenic line was hyper-susceptible to the bacterial pathogen Pseudomonas syringae pv. Maculicola (Psm) ES4326. The disease symptom resembled that of npr1, in which the master immune regulator NPR1 was mutated (Figure 1A and B). We named this line cgb (for Chao Gan Bing; ‘hyper-susceptible to pathogens’ in Chinese). To identify the causal gene of cgb, we sequenced its genome using the next-generation sequencing technology, which revealed that there was a T-DNA insertion in the fourth exon of ROL5 (AT2G44270; Figure 1C). The insertion was confirmed by genotyping analysis (Figure 1D). In the cgb mutant, the transcript of ROL5 was undetectable (Figure 1E), indicating that cgb was a knock-out mutant. To confirm that ROL5 was the CGB gene, we carried out a complementation experiment by transforming ROL5 into the cgb mutant. As shown in Figure 1A and B, the disease phenotype of the complementation line (COM) was similar to that of wild-type (WT). Moreover, we generated another allele of ROL5 mutant, rol5-c, using the CRISPR-Cas9 gene-editing approach (Wang et al., 2015). In rol5-c, a 2 bp deletion in the first exon of ROL5 causes a frameshift (Figure 1C). As expected, the rol5-c mutant was hyper-susceptible to Psm as cgb (Figure 1A and B). These data strongly suggested that ROL5 is required for plant immunity.

Figure 1. The rol5 mutants are more susceptible to the bacterial pathogen Psm ES4326 than wild-type (WT).

Figure 1.

Open in a new tab

(A) Pictures of Arabidopsis 3 days after infection. The arrows indicate the leaves inoculated with Psm ES4326 (OD600=0.0002). cgb and rol5-c are mutants defective in ROL5. COM, the complementation line of cgb. npr1-1 serves as a positive control. Bar = 1 cm. (B) The growth of Psm ES4326. CFU, colony-forming unit. Error bars represent 95% confidence intervals (n=7). Statistical significance was determined by two-tailed Student’s t-test. ***, p<0.001; ns, not significant. (C) A schematic diagram showing the site of the T-DNA insertion in cgb and the deleted nucleotides in rol5-c. (D) The genotyping results using the primers indicated in C. (E) The transcript of ROL5 is not detectable in cgb. UBQ5 serves as an internal reference gene.

Figure 1—source data 1. Source data related to Figure 1B.
Figure 1—source data 2. Source data related to Figure 1D.
Figure 1—source data 3. Source data related to Figure 1E.

ROL5 interacts with CTU2 in Arabidopsis

ROL5 is a homolog of yeast NCS6 (Leiber et al., 2010), which forms a protein complex with NCS2 to catalyze mcm5s2U34 (Figure 2A). The NCS2 homolog in Arabidopsis is CTU2 (Philipp et al., 2014). To test whether ROL5 interacts with CTU2, we first performed yeast two-hybrid assays. Consistent with the previous finding (Philipp et al., 2014), only when ROL5 and CTU2 were co-expressed, the yeasts could grow on the selective medium (Figure 2B), indicating that ROL5 interacts with CTU2 in yeast. To test whether they can interact in vivo, we carried out split luciferase assays in Nicotiana benthamiana. ROL5 was fused with the N-terminal half of luciferase (nLUC) and CTU2 was fused with the C-terminal half of luciferase (cLUC). An interaction between two proteins brings the two halves of luciferase in close proximity, leading to enzymatic activity and production of luminescence that is detectable using a hypersensitive CCD camera. As shown in Figure 2C, the luminescence signal could be detected only when ROL5-nLUC and cLUC-CTU2 were co-expressed. We also performed co-immunoprecipitation (CoIP) assays in N. benthamiana. When ROL5-FLAG was co-expressed with CTU2-GFP, ROL5-FLAG could be immunoprecipitated by the GFP-Trap beads (Figure 2D). To test whether the interaction is direct, we conducted GST pull-down assays. GST-CTU2 and ROL5-His proteins were expressed in Escherichia coli and were purified using affinity resins. As shown in Figure 2E, ROL5-His could be specifically pulled down by GST-CTU2, but not by GST alone, suggesting that ROL5 directly interacts with CTU2.

Figure 2. ROL5 interacts with CTU2.

Figure 2.

Open in a new tab

(A) A schematic diagram showing the function of ROL5 and CTU2. The ROL5 homolog NCS6 and the CTU2 homolog NCS2 form a complex to catalyze the mcm5s2U modification at wobble nucleotide of tRNA-Lys (UUU), tRNA-Gln (UUC), and tRNA-Glu (UUG), which pair with the AAA, GAA, and CAA codons in mRNA, respectively. (B) Yeast two-hybrid assays. The growth of yeast cells on the SD-Trp/Leu/His medium indicates interaction. BD, binding domain. AD, activation domain. (C) Split luciferase assays. The indicated proteins were fused to either the C- or N-terminal half of luciferase (cLUC or nLUC) and were transiently expressed in N. benthamiana. The luminesce detected by a CCD camera reports interaction. (D) Co-immunoprecipitation (CoIP) assays. CTU2-GFP and/or ROL5-FLAG fusion proteins were expressed in N. benthamiana. The protein samples were precipitated by GFP-Trap, followed by western blotting using anti-GFP or anti-FLAG antibodies. (E) GST pull‐down assays. The recombinant GST or GST-CTU2 proteins coupled with glutathione beads were used to pull down His-ROL5, followed by western blotting using anti-His or anti-GST antibodies.

Figure 2—source data 1. Source data related to Figure 2D.
Figure 2—source data 2. Source data related to Figure 2E.

The tRNA thiolation is required for plant immunity

Given that CTU2 interacts with ROL5, we reasoned that the ctu2 mutant should have similar phenotypes to rol5 in response to pathogens. To test this, we infected the T-DNA insertion mutant ctu2-1 with Psm ES4326. As expected, the ctu2-1 mutant is hyper-susceptible to the pathogen (Figure 3A and B).

Figure 3. ROL5 and CTU2 are required for mcm5s2U modification and plant immunity.

Figure 3.

Open in a new tab

(A and B) The rol5-c and ctu2-1 mutants are more susceptible to the bacterial pathogen Psm ES4326 than wild-type (WT). (A) Pictures of Arabidopsis plants 3 days after infection. Arrows indicate the leaves inoculated with Psm ES4326. Bar = 1 cm. (B) The growth of Psm ES4326. CFU, colony-forming unit. Error bars represent 95% confidence intervals (n=6). Statistical significance was determined by two-tailed Student’s t-test. ***, p<0.001. (C) The rol5-c and ctu2-1 mutants lack the mcm5s2U modification. The levels of U, cm5U, mcm5U, and mcm5s2U were quantified through high-performance liquid chromatography coupled with mass spectrometry (HPLC-MS) analyses. The intensity and the retention time of each nucleotide are shown. The structure of each nucleotide and the catalyzing enzymes are shown on the right.

Figure 3—source data 1. Source data related to Figure 3A.
Figure 3—source data 2. Source data related to Figure 3C.

By using N-acryloylamino phenyl mercuric chloride, which binds thiolated tRNAs, previous studies revealed that tRNA thiolation was defective in the rol5 and ctu2 mutant (Leiber et al., 2010; Philipp et al., 2014). To confirm this result, we measured the mcm5U and mcm5s2U levels in WT, rol5-c, and ctu2-1 using high-performance liquid chromatography coupled with mass spectrometry (HPLC-MS). In WT, mcm5U was almost undetectable (Figure 3C), indicating that it is efficiently transformed into mcm5s2U in Arabidopsis. However, in the rol5-c and ctu2-1 mutants, the mcm5s2U level was undetectable while the mcm5U level was very high, suggesting that both ROL5 and CTU2 are required for mcm5s2U. These data revealed that ROL5 and CTU2 form a complex to catalyze the mcm5s2U modification, which is essential for plant immunity.

Transcriptome and proteome reprogramming are compromised in cgb

To understand why the cgb mutant was hyper-susceptible to pathogens, we performed transcriptome and proteome analyses of the cgb mutant and the COM line. Each sample was divided into two parts, one for transcriptome analysis using RNA sequencing (RNA-seq) approach, and the other for proteome analysis using a tandem mass tag (TMT)-based approach. Principal component analysis showed that the reproducibility between biological replicates was good (Figure 4—figure supplement 1). The differentially expressed genes (DEGs) and the differentially expressed proteins (DEPs) between different samples were identified and quantified through data analysis. Regarding the transcriptome, in COM, 22% (4819) and 27% (5767) of genes were respectively up-regulated or down-regulated after Psm infection (Figure 4A). However, only 18% (3986) and 23% (4913) of genes were respectively up-regulated or down-regulated in cgb. Regarding the proteome, in COM, 16% (1193) and 13% (1021) of proteins were respectively up-regulated or down-regulated after Psm infection (Figure 4B). In contrast, only 12% (909) and 10% (787) of proteins were respectively up-regulated or down-regulated in cgb. Therefore, the numbers of both DEGs and DEPs were reduced in cgb compared to those in COM.

Figure 4. The transcriptome and proteome reprogramming are compromised in cgb.

(A and B) The percentage and the number of the differentially expressed genes (DEGs, p-value <0.05, |Log2Foldchange|>Log21.5, (A)) and the differentially expressed proteins (DEPs, p-value <0.05, |Log2Foldchange|>Log21.2, (B)) after Psm infection in the cgb mutant and the complementation line (COM). Down, down-regulated. Up, up-regulated. Nc, no change. (C and D) The percentage and the number of the attenuated genes (C) and proteins (D) in cgb among the up-regulated DEGs and DEPs in COM. (E and F) Gene Ontology (GO) analysis of the attenuated genes (E) or proteins (E) in cgb. The top 15 significantly enriched GO terms are shown.

Figure 4—source data 1. Source data related to Figure 4A.
Figure 4—source data 2. Source data related to Figure 4B.
Figure 4—source data 3. Source data related to Figure 4C.
Figure 4—source data 4. Source data related to Figure 4D.
Figure 4—source data 5. Source data related to Figure 4E.
Figure 4—source data 6. Source data related to Figure 4F.

Figure 4.

Figure 4—figure supplement 1. Principal component analysis (PCA) of the transcriptome (A) and proteome samples (B).

Figure 4—figure supplement 1.

Open in a new tab

To further examine the gene expression defects in cgb, we compared the expression changes after Psm infection between cgb and COM. Among 4819 up-regulated DEGs in COM, the expression changes of 1113 genes were less prominent in cgb than in COM (Figure 4C). These genes were referred to as attenuated genes. Among 1193 up-regulated DEPs in COM, the expression changes of 366 proteins were less prominent in cgb than in COM (Figure 4D). These proteins were named attenuated proteins. Gene Ontology (GO) analysis of the attenuated genes and attenuated proteins revealed that many important biological processes were significantly enriched (Figure 4E and F). These data suggested that both transcriptome and proteome reprogramming were compromised in cgb.

The translation efficiency of immune-related proteins is compromised in cgb

Since the mcm5s2U modification directly regulates translation process (Nedialkova and Leidel, 2015; Schaffrath and Leidel, 2017), we sought to identify the proteins with compromised translation efficiency. The 366 attenuated proteins in cgb may be due to reduced transcription or reduced translation. To distinguish between these two possibilities, we performed Venn diagram analysis between attenuated genes and attenuated proteins, revealing that 261 attenuated proteins were not attenuated at the transcript level, suggesting that the attenuated expression of these proteins is due to reduced translation (Figure 5A). GO analysis of these 261 proteins revealed that some immune-related processes (i.e. response to salicylic acid, defense response to bacterium, and immune system process) were significantly enriched (Figure 5B). Notably, NPR1 is one of these proteins.

Figure 5. The translation of immune-related proteins is compromised in cgb.

(A) Venn diagram analysis of attenuated genes and proteins. (B) Gene Ontology (GO) analysis of the 261 attenuated proteins. The top 6 significantly enriched GO terms are shown. (C) Western blot analysis of NPR1 protein levels. The 7-day-old seedlings grown on 1/2 MS medium were treated with buffer (10 mM MgCl2, pH 7.5, Mock) or Psm ES4326 (OD600=0.2) for 48 hr. (D) Polysome profiling results. Abs, the absorbance of sucrose gradient at 254 nm. The numbers on the X-axis indicate the polysomal fractions subjected to qPCR analyses. (E) The qPCR analyses. The relative mRNA level of NPR1 in different fractions or in total mRNA was normalized against UBQ5. The ratio between the relative mRNA levels in each fraction and in total mRNA was shown (n=3). Statistical significance was determined by two-tailed Student’s t-test. **, p<0.01; ***, p<0.001; ns, not significant. (F) The heatmap showing the expression changes of salicylic acid (SA)-responsive genes after pathogen infection.

Figure 5—source data 1. Source data related to Figure 5A.
Figure 5—source data 2. Source data related to Figure 5B.
Figure 5—source data 3. Source data related to Figure 5C.
Figure 5—source data 4. Source data related to Figure 5D.
elife-93517-fig5-data4.xlsx (110.7KB, xlsx)
Figure 5—source data 5. Source data related to Figure 5E.
Figure 5—source data 6. Source data related to Figure 5F.

Figure 5.

Figure 5—figure supplement 1. Analyses of NPR1 transcript levels in cgb and COM.

Figure 5—figure supplement 1.

The 7-day-old seedlings grown on 1/2 MS medium were treated with buffer (10 mM MgCl2, pH 7.5, Mock) or Psm ES4326 (OD600=0.2) for 48 hr. The relative mRNA level of NPR1 was normalized against UBQ5. Error bars represent 95% confidence intervals (n=3). Statistical significance was determined by two-tailed Student’s t-test. ns, not significant.
Figure 5—figure supplement 2. The salicylic acid (SA)-mediated protection assay.

Figure 5—figure supplement 2.

The Arabidopsis plants were treated with (+) or without (-) 600 μM benzothiadiazole (BTH) for 24 hr before infection. The growth of Psm ES4326 was shown. CFU, colony-forming unit. Error bars represent 95% confidence intervals (n=7). Statistical significance was determined by two-tailed Student’s t-test. ***, p<0.001; ns, not significant.
Figure 5—figure supplement 3. The genetic relationship between NPR1 and CGB.

Figure 5—figure supplement 3.

The Arabidopsis plants were infected with Psm ES4326 and the growth of Psm ES4326 was shown. CFU, colony-forming unit. Error bars represent 95% confidence intervals (n=7). Statistical significance was determined by two-tailed Student’s t-test. **, p<0.01.
Open in a new tab

To verify the expression of NPR1, we performed RT-qPCR and western blot analysis. Consistent with transcriptome and proteome data, the transcription levels of NPR1 were similar between COM and cgb both before and after Psm ES4326 infection (Figure 5—figure supplement 1), whereas the NPR1 protein level was much higher in COM than that in cgb after Psm ES4326 infection (Figure 5C). To further confirm that the translation of NPR1 was reduced in cgb, we carried out ribosome profiling experiment. Compared with COM, the polysome fractions in cgb were reduced (Figure 5D), suggesting that the overall translation efficiency is lower in cgb. As expected, the relative mRNA levels of NPR1 in multiple polysome fractions were significantly lower in cgb than in COM (Figure 5E).

The reduced NPR1 protein level in cgb suggested that SA signaling is compromised. To test this possibility, we examined the expression of all the genes (118) belonging to the GO term ‘response to salicylic acid’. In our transcriptome data, we could detect the expression of 73 genes, among which 59 genes (80.8%) were reduced in cgb compared with COM (Figure 5F). To further examine the defects of SA signaling in cgb, we performed SA-mediated protection assay. The Arabidopsis plants were treated with benzothiadiazole (BTH), a functional analog of SA, for 24 hr before infection. As expected, the growth of Psm ES4326 was reduced in BTH-treated COM, but not cgb and npr1 (Figure 5—figure supplement 2). These results suggested that SA signaling is indeed compromised in the cgb mutant.

To investigate the genetic relationship between CGB and NPR1, we generated the cgb npr1 double mutant and examined its disease phenotypes. We found that cgb npr1 was significantly more susceptible than either npr1 or cgb (Figure 5—figure supplement 3). There are two possible reasons for the observed additive effects of cgb and npr1. First, the translation of NPR1 was reduced rather than completely blocked in cgb (Figure 5C). In other words, NPR1 still has some function in cgb. But in the cgb npr1 double mutant, the function of NPR1 is completely abolished, which explains why cgb npr1 was more susceptible than cgb. Second, in addition to NPR1, some other immune regulators (such as PAD4, EDS5, and SAG101) were also compromised in cgb (Figure 5B), which explains why cgb npr1 was more susceptible than npr1.

Discussion

Upon pathogen infections, plants need to efficiently reprogram their gene expression, allowing the transition from growth to defense. However, how translation contributes to the immune response is not well studied. It is known that tRNA thiolation is required for efficient protein expression (Nedialkova and Leidel, 2015; Schaffrath and Leidel, 2017). Here, we show that tRNA thiolation is abolished in the cgb mutant (Figure 3), leading to disease hyper-susceptibility (Figure 1). We found that the translation of many immune-related proteins was reduced in cgb (Figure 5). Therefore, our study strongly suggested that tRNA thiolation is required for plant immunity, revealing an additional mechanism underlying plant immune responses. It is possible that tRNA thiolation is a regulatory step during immune responses. However, since many defense-related proteins are up-regulated after pathogen infection (Figure 4B), we cannot rule out the possibility that tRNA thiolation just becomes a limiting factor due to the high demand of translation resource during immune responses. More studies are required to distinguish these two possibilities.

The SA receptor NPR1 is the master regulator of SA signaling. NPR1 can function as a transcription coactivator to regulate gene expression and an adaptor of ubiquitin E3 ligase to mediate protein degradation (Yu et al., 2022; Yu et al., 2021; Zavaliev et al., 2020). It has been shown that the activity of NPR1 is regulated at multiple levels including post-translational modifications such as phosphorylation, ubiquitination, S-nitrosylation, and sumoylation (Saleh et al., 2015; Spoel et al., 2009; Tada et al., 2008). However, how NPR1 is regulated at the translational level is unknown. Here, we show that the tRNA thiolation-mediated translation control is required for the optimal expression of NPR1 (Figure 5B and D), revealing an additional layer of regulation for NPR1.

The tRNA thiolation modification is highly conserved in eukaryotes. However, its biological functions in plants are less well understood. Previously, it was reported that tRNA thiolation regulates the development of root hairs, chloroplasts, and leaf cells (Leiber et al., 2010; Philipp et al., 2014). Recently, it was found that tRNA thiolation is required for heat stress tolerance (Xu et al., 2020). Our study revealed an additional biological function of tRNA thiolation in plant immunity. It will also be interesting to test whether tRNA thiolation is required for responses to other stresses such as drought, salinity, and cold.

The ELP complex is composed of six proteins, with ELP1, ELP2, and ELP3 forming a core sub-complex, and ELP4, ELP5, and ELP6 forming an accessory sub-complex. The ELP complex catalyzes the cm5U modification, which is the precursor of mcm5s2U catalyzed by ROL5 and CTU2. As expected, the mcm5s2U modification was undetectable in the elp mutants such as elp3 and elp6 mutants (Leitner et al., 2015; Mehlgarten et al., 2010). Interestingly, similar to the rol5 and ctu2 mutants, the elp2 and elp3 mutants were hyper-susceptible to pathogens (DeFraia et al., 2010; Defraia et al., 2013; Wang et al., 2013). In addition to tRNA modification, the ELP complex has several other distinct activities including histone acetylation, α-tubulin acetylation, and DNA demethylation (Wang et al., 2013). Therefore, it is difficult to dissect which activity of the ELP complex contributes to plant immunity. However, the only known activity of ROL5 and CTU2 is to catalyze tRNA thiolation. Considering that the elp, rol5, and ctu2 mutants are all defective in tRNA thiolation, it is likely the tRNA modification activity of the ELP complex underlies its function in plant immunity.

Previous studies have identified numerous pathogen-responsive genes through transcriptome analysis (Zhang et al., 2020). However, the correlation between mRNAs and proteins is not always that strong (Lahtvee et al., 2017; Schwanhäusser et al., 2011). Given that proteins are major players in cellular functions, it is necessary to study immune responses at the protein level. Through high-throughput proteome analysis, we found 2215 proteins differentially accumulated after Psm infection in Arabidopsis (Figure 4). To our knowledge, this is the largest dataset of pathogen-responsive proteins in Arabidopsis. We believe that this dataset will provide a good research resource for future studies on plant immunity.

Materials and methods

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Arabidopsis thaliana) ROL5 TAIR AT2G44270
Gene (Arabidopsis thaliana) CTU2 TAIR AT4G35910
Genetic reagent (Arabidopsis thaliana) cgb This paper It contains a T-DNA insertion in the fourth exon of ROL5 and is hypersusceptible to pathogen.
Genetic reagent (Arabidopsis thaliana) COM This paper It contains the coding sequence of ROL5 driven by 35S promoter in cgb.
Genetic reagent (Arabidopsis thaliana) rol5-c This paper The mutant was generated using CRISPR-Cas9 system. It contains a 2-bp deletion in the first exon of ROL5.
Genetic reagent (Arabidopsis thaliana) ctu2-1 ABRC SALK_032692
Genetic reagent (Arabidopsis thaliana) npr1-1 Cao et al., 1997
Strain, strain Background (Escherichia coli) BL21 TransGen Cat # CD901-02 Electrocompetent cells
Strain, strain background (Escherichia coli) DH5α TransGen Cat # CD201-01 Electrocompetent cells
Strain, strain background (Agrobacterium tumefaciens) GV3101 Sangon Cat # B528430 Electrocompetent cells
Strain, strain background (Saccharomyces cerevisiae) AH109 Clontech Cat # 630489 Electrocompetent cells
Strain, strain background (Pseudomonas syringae pv. Maculicola) Psm 4326 Durrant et al., 2007 ES4326
Antibody Anti-NPR1 (Rabbit polyclonal) From Dr. Li Yang WB(1:3000)
Antibody Anti-His (Mouse monoclonal) Abclonal Cat # AE003 WB(1:5000)
Antibody Anti-GST (Mouse monoclonal) Abclonal Cat # AE001 WB(1:5000)
Antibody Anti-FLAG (Mouse monoclonal) Promoter WB(1:5000)
Antibody Anti-GFP (Mouse monoclonal) Promoter WB(1:5000)
Other GFP-Trap chromotek Cat # gtma
Other Hypersil GOLD Thermo Fisher Cat # 25005-254630
Open in a new tab

Plant material and growth conditions

All Arabidopsis seeds used in this study are in Columbia-0 background. The npr1-1 mutant was described previously (Cao et al., 1997). The cgb mutant and the complementation line were generated in this study. The mutant of ctu2-1 (SALK_032692) was purchased from ABRC. The rol5-c mutant was generated using EC1-based CRISPR-Cas9 system (Wang et al., 2015). All seeds were sterilized with 2% Plant Preservative Mixture-100 (Plant Cell Technology) at 4°C in the dark for 2 days and then were plated on Murashige and Skoog (MS) medium with 1% sucrose and 0.3% phytagel. The plants were grown under long-day conditions at 22°C (16 hr of light/8 hr of dark; supplied by white-light tubes).

Strains and growth conditions

E. coli strain DH5α for molecular cloning was cultured in LB medium at 37°C. E. coli strain BL21 (DE3) for recombinant protein expression was cultured in LB medium at 16°C. Agrobacterium tumefaciens strain GV3101 for transformation was cultured in Yeast Extract Beef (YEB) medium at 28°C. Psm ES4326 for infection assay was cultured in King’s B (KB) medium at 28°C. Yeast strain AH109 for yeast two-hybrid assay was cultured in Yeast Peptone Dextrose (YPD) medium or SD medium at 28°C.

Vector constructions

The vectors were constructed using the digestion-ligation method or a lighting cloning system (Biodragon Immunotechnology). For complementation experiment, ROL5 was inserted into Nco I/Xba I-digested pFGC5941. For pull-down assays, CTU2 was inserted into BamH I/Xho I-digested pGEX-6P-1; ROL5 was inserted into Nco I/Hind III-digested pET28a. For split luciferase assays, ROL5 and CTU2 were cloned into the Kpn I/Sal I-digested pJW771 and pJW772, respectively. For yeast two-hybrid assays, ROL5 and CTU2 were cloned into EcoR I/BamH I-digested pGBKT7 and pGADT7. For CoIP assays, ROL5-FLAG and CTU2-GFP were cloned into Nco I/Xba I-digested pFGC5941. To generate rol5-c, the target sequence was designed and cloned into pHEE401 as described previously (Wang et al., 2015). The primer sequences used for cloning are listed in Appendix 1—table 1.

Reverse transcription and qPCR

The total RNA or the RNA in ribosome fractions was extracted using TRIzol Reagent (Invitrogen). The cDNA was synthesized using HiScript II Q RT SuperMix (Vazyme). The qPCR analyses were performed using the AceQ qPCR SYBR Green Master Mix (Vazyme). UBQ5 was used as the internal reference gene. Primers used for qPCR are listed in Appendix 1—table 1.

Pathogen infection

The third and fourth leaves of 3-week-old Arabidopsis plants were infiltrated with Psm ES4326 (OD600=0.0002) using a needleless syringe. Three days after infection, the leaves were sampled to measure the growth of Psm ES4326 as described previously (Durrant et al., 2007). For SA-mediated protection assay, the 3-week-old Arabidopsis plants were treated with 600 μM BTH (Syngenta) for 24 hr before infection.

Yeast two-hybrid assays

Matchmaker GAL4 Two-Hybrid System (Clontech) was used and the assays were performed according to the user manual. Briefly, the bait (in pGBKT7) and prey (in pGADT7) vectors were co-transformed into the yeast strain AH109. The protein interactions were determined by yeast growth on SD/-Leu/-Trp/-His/ medium. The empty vectors were used as negative controls.

In vitro pull-down assays

The GST pull-down assays were performed as previously described (Chen et al., 2023a , Chen et al., 2023b). Briefly, ROL5-His, GST, and GST-CTU2 proteins were expressed in E. coli BL21 (DE3). GST (5 μg) and GST-CTU2 (5 μg) were coupled to glutathione beads (GE Healthcare Life Sciences) and then were incubated with ROL5-His (10 μg) in 0.5 mL binding buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, and 2 mM DTT) at 4°C for 2 hr. The beads were washed three times with washing buffer (binding buffer plus 2% NP-40), boiled in 1× SDS loading buffer, and analyzed by western blot using anti-GST (Abclonal) or anti-His (Abclonal) antibodies.

CoIP assays

The CoIP assays were performed as previously described (Chen et al., 2021). 35S:ROL5-FLAG and 35S:CTU2-GFP were transformed into A. tumefaciens GV3101. 35S:ROL5-FLAG strain (OD600=1) was mixed with the same volume of buffer or 35S:CTU2-GFP strain (OD600=1) and was infiltrated into N. benthamiana leaves. After 48 hr, the infiltrated leaves were ground in liquid nitrogen and were resuspended in IP buffer (20 mM Tris-HCl pH 7.5, 50 mM NaCl, 1 mM EDTA, 0.1% SDS, 1% Triton X-100, 1 mM PMSF, 100 μM MG132, 1× protease inhibitor cocktail) for total protein extraction. The lysates were incubated with GFP-Trap magnetic beads (Chromotek) at 4°C for 2 hr. The beads were washed using washing buffer (20 mM Tris-HCl pH 7.5, 150–500 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1× Protease Inhibitor Cocktail) and then boiled in 1× SDS loading buffer. The western blotting was performed using anti-FLAG (Promoter) and anti-GFP (Promoter) antibodies.

Split luciferase assays

Split luciferase assay was performed as described previously (Chen et al., 2008). The constructs were transformed into A. tumefaciens strain GV3101 (OD600=1). The resultant strains were then infiltrated into leaves of N. benthamiana. After 48 hr, 1 mM luciferin (GOLDBIO) was applied onto leaves and the images were captured using Lumazone imaging system equipped with 2048B CCD camera (Roper).

Quantification of tRNA modifications

Quantification of tRNA modifications was performed using liquid chromatography coupled with mass spectrometry according to a previous study (Su et al., 2014). Total tRNA was extracted using a microRNA kit (Omega Bio-Tek). Five micrograms of tRNA were hydrolyzed in 10 μL enzymic buffer (1 U benzonase, 0.02 U phosphodiesterase I, and 0.02 U alkaline phosphatase) at 37°C for 3 hr. The UHPLC system (Thermo Fisher Scientific) coupled with TSQ Altis Triple Quadrupole Mass Spectrometer (Thermo Fisher Scientific) was used for quantification of tRNA modification. For the liquid chromatography, the Hypersil GOLD HPLC column (3 µm, 150×2.1 mm2; Thermo Fisher Scientific) was used. The solvent gradient was set as the protocol (Su et al., 2014). The Tracefinder software (Thermo Fisher Scientific) was further used for peak assignment, area calculation, and normalization. Corresponding structures and molecular masses were obtained from the Modomics database (https://iimcb.genesilico.pl/modomics/modifications).

RNA and protein extraction for transcriptome and proteome analysis

The samples were ground in liquid nitrogen and divided into two parts, one for transcriptome analysis and the other for proteome analysis. Total RNA was extracted using TRIzol Reagent (Invitrogen). Library preparation and RNA-sequencing were performed by Novogene Cooperation. Total proteins were extracted using phenol-methanol method (Deng et al., 2007). The protein concentration was determined with 2D Quant Kit (GE Healthcare Life Sciences) using bovine serum albumin as a standard.

Proteome analysis

For trypsin digestion, 60 μg proteins of each sample were reduced with 20 mM Tris-phosphine for 60 min at 30°C. Cysteines were alkylated with 30 mM iodoacetamide for 30 min at room temperature in the dark. Proteins were precipitated with 6 volumes of cold acetone overnight and then dissolved in 50 mM triethylammonium bicarbonate (TEAB). Proteins were digested with trypsin (protease/protein = 1/25, wt/wt) overnight at 37°C.

For TMT labeling, each sample containing 25 μg of peptide in 50 mM TEAB buffer was combined with its respective 10-plex TMT reagent (Thermo Fisher Scientific) and incubated for 1 hr at room temperature. Three biological replicates were labeled respectively for each sample, in which COM was labeled with 126-, 127N-, and 128C- of the 10-plex TMT reagent, while cgb was labeled with 129N-, 130C-, and 131- of the 10-plex TMT reagents. The labeling reactions were stopped by the addition of 2 μL of 5% hydroxylamine.

For LC-MS/MS analysis, multiplexed TMT-labeled samples were combined, vacuum dried, reconstituted in 2% acetonitrile and 5 mM ammonium hydroxide (pH 9.5), and separated with the Waters Acquity BEH column (C18, 1.7 μm, 100 mm, Waters) using UPLC system (Waters) at a flow rate of 300 μL/min. Total of 24 fractions were collected, combined into 12 fractions, and vacuum dried for LC-MS/MS analysis. The solvent gradient was set as previously described (Deng et al., 2007). Samples were then analyzed on an Ultimate 3000 nano UHPLC system (Thermo Fisher Scientific) coupled online to a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). The trapping column (PepMap C18, 100 Å, 100 μm×2 cm, 5 μm) and an analytical column (PepMap C18, 100 Å, 75 μm i.d.×50 cm long, 2 μm) were used for separation of the samples. The solvent gradient and MASS parameters were set as previously described (Deng et al., 2007).

Transcriptome data analysis

Raw reads were processed and aligned to the Arabidopsis genome (https://www.arabidopsis.org) using STAR (v.2.6.1a). Genes with over 10 reads were filtered and processed using DESeq2 (v.1.22.2) to identify the DEGs (p-value <0.05, |Log2FoldChange|>Log21.5) (Love et al., 2014).

Proteome data analysis

Raw data were processed using Proteome Discoverer (v.2.2.0.388) and aligned to Arabidopsis genome (https://www.arabidopsis.org) with the SEQUEST HT search engine. Searches were configured with static modifications for the TMT reagents (+229.163 Da). The precursor mass tolerance was set as 10 ppm; the fragment mass tolerance was set as 0.02 Da; the trypsin missed cleavage was set as 2. The reversed sequence decoy strategy was used to control peptide false discovery. The peptides with q scores <0.01 were accepted, and at least one unique peptide was required for matching a protein entry for its identification. PSMs (peptide spectrum matches) results were processed with DESeq2 (v.1.22.2) to identify the DEPs (p-value <0.05, |Log2FoldChange|>Log21.2).

GO and heatmap analysis

The DEGs or proteins were analyzed by using Clusterprofile (v.3.18.1) (Yu et al., 2012). The heatmap analysis was processed by using pheatmap2 (v.1.0.12).

Analysis of NPR1 protein level

The seedlings were ground in liquid nitrogen and were resuspended in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 200 mM DTT, 1 mM PSMF, 50 µM MG132, 1× protease inhibitor cocktail). After centrifuging, the supernatants were mixed with the same volume of 2× SDS loading buffer and were incubated at 75°C for 15 min. The western blotting was performed using an anti-NPR1 antibody (provided by Li Yang from China Agricultural University).

Ribosome profiling

The ribosome profiling was performed as previously described with some modifications (Hsu et al., 2016; Xu et al., 2017). The plant sample (0.05–0.1 g) was ground in liquid nitrogen and extracted with 1 mL ribosome lysis buffer (200 mM Tris-HCl pH 8.0, 200 mM KCl, 35 mM MgCl2, 1% Triton X-100, 100 μM MG132, 1 mM DTT, and 100 μg/mL cycloheximide), followed by ultracentrifugation at 4°C for 2 hr (38,000 rpm, Beckman, SW41 rotor) through a 20–60% sucrose gradient (40 mM Tris-HCl, pH 8.4, 20 mM KCl, 10 mM MgCl2, and 50 μg/mL cycloheximide) prepared by Gradient Master (Biocomp Instruments). The profiling signals were recorded by Piston Gradient Fractionator (Biocomp Instruments).

Acknowledgements

We are grateful to Dr. Pascal Genschik for critical revision, Dr. Zhipeng Zhou for helpful discussion, Dr. Peng Chen for technical support, and Dr. Li Yang for providing the anti-NPR1 antibody. This work is supported by the National Natural Science Foundation of China (31970311, 32000373, and 32270306), HZAU-AGIS Cooperation Fund (SZYJY2022004), and BaiChuan Program.

Appendix 1

Appendix 1—table 1. The primers used in this study.

Name Sequence（5'–3'） Application
ROL5-F1 ACATTACAATTACATTTACAATTACATGGAGGCCAAGAACAAGAA For complementation
ROL5-R1 GGGTCTTAATTAACTCTCTAGATTAGAAATCCAGAGATCCACAT
ROL5-F2 CGGAATTC ATGGAGGCCAAGAACAAGA For Y2H
ROL5-R2 CGGGATCC TTAGAAATCCAGAGATCCAC
CTU2-F1 CGGAATTC ATGGCTTGTAATTCCTCAG
CTU2-R1 CGGGATCC TTAGACAACCTCTTCATCGT
ROL5-F3 GGGGTACCATGGAGGCCAAGAACAAGA For split luc
ROL5-R3 GCGTCGACGAAATCCAGAGATCCAC
CTU2-F2 GGGGTACCATGGCTTGTAATTCCTCAG
CTU2-R2 GCGTCGACTTAGACAACCTCTTCATCGT
GUS-F acgcgtcccggggcggtaccATGGTAGATCTGAGGGTAAA
GUS-R cgaaagctctgcaggtcgacCTATTGTTTGCCTCCCTGCTG
ROL5-F0 TGACTGCTCCCTACCTGTCGAGTTTTAGAGCTAGAAATAGC For CRISPR mutant of ROL5
ROL5-R0 AACGAGACGTCCCGTCCTCAAACAATCTCTTAGTCGACTCTAC
ROL5-BsF ATATATGGTCTCGATTGACTGCTCCCTACCTGTCGAGTT
ROL5-BsR ATTATTGGTCTCGAAACGAGACGTCCCGTCCTCAAACAA
ROL5-F4 TTGAAAGGTTTACATCTTGGAAT For sequencing of target sites
ROL5-R4 AAAGGTGATTGCTTAGATTCTGATT
ROL5-F5 CTCAAAAACCTCATAAAAGCACTCT
ROL5-R5 AACTGCGTCACTGTCTTTACTCT
ROL5-F6 TTAAGAAGGAGATATACCATGGGCATGGAGGCCAAGAACAAGA For protein expression
ROL5-R6 GAGTGCGGCCGCAAGCTTTTAGAAATCCAGAGATCCAC
CTU2-F3 TTCCAGGGGCCCCTGGGATCCATGGCTTGTAATTCCTCAG
CTU2-R3 AGTCACGATGCGGCCGCTCGAGTTAGACAACCTCTTCATCGT
ROL5-F7 CAATTACATTTACAATTACATGGAGGCCAAGAACAAGA For co-immunoprecipitation
ROL5-R7 GGGTCTTAATTAACTCTCTAGATTTGTCATCATCGTCTTTG
CTU2-F4 CAATTACATTTACAATTACATGGCTTGTAATTCCTCAGG
CTU2-R4 GGGTCTTAATTAACTCTCTAGATTACTTGTACAGCTCGTCCA
cgb-LP GTATGAGAAGTGATTGAGTATGTG For genotyping
cgb-RP TCGATGTGCACCTACTTAATCTAC
cgb-RB CTAATGAGTGAGCTAACTCAC
ctu2-LP TCACATTGCATTGAATCATCC For genotyping
ctu2-RP TCAAATTTAGCACATGGGACC
ROL5-F1 GGAGCTGCGTTATTGAAAGTAG For qPCR
ROL5-R1 CCACGATATGCATTAGGAGAGT
UBQ5-F1 GAAGATCCAAGACAAGGAAGGA
UBQ5-R1 CTTCTTCCTCTTCTTAGCACCA
NPR1-P1 ATGATTTCTACAGCGACGCTAA
NPR1-P2 GACTTCGTAATCCTTGGCAATC
Open in a new tab

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Shunping Yan, Email: spyan@mail.hzau.edu.cn.

Detlef Weigel, Max Planck Institute for Biology Tübingen, Germany.

Detlef Weigel, Max Planck Institute for Biology Tübingen, Germany.

Funding Information

This paper was supported by the following grants:

  • National Natural Science Foundation of China 31970311 to Shunping Yan.

  • HZAU-AGIS Cooperation Fund SZYJY2022004 to Shunping Yan.

  • National Natural Science Foundation of China 32000373 to Xiaodan Yu.

  • National Natural Science Foundation of China 32270306 to Shunping Yan.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Investigation, Writing – original draft, Project administration, Writing – review and editing.

Investigation, Project administration, Writing – review and editing.

Formal analysis, Project administration.

Investigation.

Investigation.

Investigation.

Funding acquisition, Writing – review and editing.

Writing – review and editing.

Conceptualization, Supervision, Funding acquisition, Writing – original draft, Writing – review and editing.

Additional files

MDAR checklist

Data availability

RNA sequencing datasets have been deposited to GSE database with an accession number GSE183087. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the iProX partner repository with the dataset identifier PXD028189. Data analysis scripts are available on GitHub (copy archived at Zheng, 2022). Source data files have been provided for Figures 1B, 1D, 1E, 2D, 2E, 3B, 3C, Figure 4, and Figure 5.

The following datasets were generated:

Zheng X, Wu C, Yan S. 2022. The thiolation modification of tRNA is essential for plant immunity. NCBI Gene Expression Omnibus. GSE183087

Zheng X, Yan S. 2021. The thiolation modification of tRNA is essential for plant immunity. ProteomeXchange. PXD028189

References

  1. Agris PF, Eruysal ER, Narendran A, Väre VYP, Vangaveti S, Ranganathan SV. Celebrating wobble decoding: half a century and still much is new. RNA Biology. 2018;15:537–553. doi: 10.1080/15476286.2017.1356562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Canet JV, Dobón A, Roig A, Tornero P. Structure-function analysis of npr1 alleles in arabidopsis reveals a role for its paralogs in the perception of salicylic acid. Plant, Cell & Environment. 2010;33:1911–1922. doi: 10.1111/j.1365-3040.2010.02194.x. [DOI] [PubMed] [Google Scholar]
  3. Cao H, Glazebrook J, Clarke JD, Volko S, Dong X. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell. 1997;88:57–63. doi: 10.1016/s0092-8674(00)81858-9. [DOI] [PubMed] [Google Scholar]
  4. Chen H, Zou Y, Shang Y, Lin H, Wang Y, Cai R, Tang X, Zhou JM. Firefly luciferase complementation imaging assay for protein-protein interactions in plants. Plant Physiology. 2008;146:368–376. doi: 10.1104/pp.107.111740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen H, He C, Wang C, Wang X, Ruan F, Yan J, Yin P, Wang Y, Yan S. RAD51 supports DMC1 by inhibiting the SMC5/6 complex during meiosis. The Plant Cell. 2021;33:2869–2882. doi: 10.1093/plcell/koab136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen H, Pan T, Zheng X, Huang Y, Wu C, Yang T, Gao S, Wang L, Yan S. The ATR–WEE1 kinase module promotes SUPPRESSOR OF GAMMA RESPONSE 1 translation to activate replication stress responses. The Plant Cell. 2023a;35:3021–3034. doi: 10.1093/plcell/koad126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen T, Xu G, Mou R, Greene GH, Liu L, Motley J, Dong X. Global translational induction during NLR-mediated immunity in plants is dynamically regulated by CDC123, an ATP-sensitive protein. Cell Host & Microbe. 2023b;31:334–342. doi: 10.1016/j.chom.2023.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. DeFraia CT, Zhang X, Mou Z. Elongator subunit 2 is an accelerator of immune responses in Arabidopsis thaliana. The Plant Journal. 2010;64:511–523. doi: 10.1111/j.1365-313X.2010.04345.x. [DOI] [PubMed] [Google Scholar]
  9. Defraia CT, Wang Y, Yao J, Mou Z. Elongator subunit 3 positively regulates plant immunity through its histone acetyltransferase and radical S-adenosylmethionine domains. BMC Plant Biology. 2013;13:102. doi: 10.1186/1471-2229-13-102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Delaunay S, Rapino F, Tharun L, Zhou Z, Heukamp L, Termathe M, Shostak K, Klevernic I, Florin A, Desmecht H, Desmet CJ, Nguyen L, Leidel SA, Willis AE, Büttner R, Chariot A, Close P. Elp3 links tRNA modification to IRES-dependent translation of LEF1 to sustain metastasis in breast cancer. The Journal of Experimental Medicine. 2016;213:2503–2523. doi: 10.1084/jem.20160397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Deng Z, Zhang X, Tang W, Oses-Prieto JA, Suzuki N, Gendron JM, Chen H, Guan S, Chalkley RJ, Peterman TK, Burlingame AL, Wang ZY. A proteomics study of brassinosteroid response in arabidopsis. Molecular & Cellular Proteomics. 2007;6:2058–2071. doi: 10.1074/mcp.M700123-MCP200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dewez M, Bauer F, Dieu M, Raes M, Vandenhaute J, Hermand D. The conserved Wobble uridine tRNA thiolase Ctu1-Ctu2 is required to maintain genome integrity. PNAS. 2008;105:5459–5464. doi: 10.1073/pnas.0709404105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ding Y, Sun T, Ao K, Peng Y, Zhang Y, Li X, Zhang Y. Opposite roles of salicylic acid receptors npr1 and npr3/npr4 in transcriptional regulation of plant immunity. Cell. 2018;173:1454–1467. doi: 10.1016/j.cell.2018.03.044. [DOI] [PubMed] [Google Scholar]
  14. Durrant WE, Wang S, Dong X. Arabidopsis SNI1 and RAD51D regulate both gene transcription and DNA recombination during the defense response. PNAS. 2007;104:4223–4227. doi: 10.1073/pnas.0609357104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fu ZQ, Yan S, Saleh A, Wang W, Ruble J, Oka N, Mohan R, Spoel SH, Tada Y, Zheng N, Dong X. NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature. 2012;486:228–232. doi: 10.1038/nature11162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hsu PY, Calviello L, Wu HYL, Li FW, Rothfels CJ, Ohler U, Benfey PN. Super-resolution ribosome profiling reveals unannotated translation events in Arabidopsis. PNAS. 2016;113:E7126–E7135. doi: 10.1073/pnas.1614788113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Huang B, Johansson MJO, Byström AS. An early step in wobble uridine tRNA modification requires the elongator complex. RNA. 2005;11:424–436. doi: 10.1261/rna.7247705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jablonowski D, Zink S, Mehlgarten C, Daum G, Schaffrath R. tRNAGlu wobble uridine methylation by Trm9 identifies elongator’s key role for zymocin-induced cell death in yeast. Molecular Microbiology. 2006;59:677–688. doi: 10.1111/j.1365-2958.2005.04972.x. [DOI] [PubMed] [Google Scholar]
  19. Jones JDG, Dangl JL. The plant immune system. Nature. 2006;444:323–329. doi: 10.1038/nature05286. [DOI] [PubMed] [Google Scholar]
  20. Klassen R, Bruch A, Schaffrath R. Independent suppression of ribosomal +1 frameshifts by different tRNA anticodon loop modifications. RNA Biology. 2017;14:1252–1259. doi: 10.1080/15476286.2016.1267098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kumar S, Zavaliev R, Wu Q, Zhou Y, Cheng J, Dillard L, Powers J, Withers J, Zhao J, Guan Z, Borgnia MJ, Bartesaghi A, Dong X, Zhou P. Structural basis of NPR1 in activating plant immunity. Nature. 2022;605:561–566. doi: 10.1038/s41586-022-04699-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lahtvee PJ, Sánchez BJ, Smialowska A, Kasvandik S, Elsemman IE, Gatto F, Nielsen J. Absolute quantification of protein and mrna abundances demonstrate variability in gene-specific translation efficiency in yeast. Cell Systems. 2017;4:495–504. doi: 10.1016/j.cels.2017.03.003. [DOI] [PubMed] [Google Scholar]
  23. Leiber RM, John F, Verhertbruggen Y, Diet A, Knox JP, Ringli C. The TOR pathway modulates the structure of cell walls in arabidopsis. The Plant Cell. 2010;22:1898–1908. doi: 10.1105/tpc.109.073007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Leidel S, Pedrioli PGA, Bucher T, Brost R, Costanzo M, Schmidt A, Aebersold R, Boone C, Hofmann K, Peter M. Ubiquitin-related modifier urm1 acts as a sulphur carrier in thiolation of eukaryotic transfer RNA. Nature. 2009;458:228–232. doi: 10.1038/nature07643. [DOI] [PubMed] [Google Scholar]
  25. Leitner J, Retzer K, Malenica N, Bartkeviciute R, Lucyshyn D, Jäger G, Korbei B, Byström A, Luschnig C. Meta-regulation of arabidopsis auxin responses depends on tRNA maturation. Cell Reports. 2015;11:516–526. doi: 10.1016/j.celrep.2015.03.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15:550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lu J, Huang B, Esberg A, Johansson MJO, Byström AS. The kluyveromyces lactis gamma-toxin targets tRNA anticodons. RNA. 2005;11:1648–1654. doi: 10.1261/rna.2172105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mehlgarten C, Jablonowski D, Wrackmeyer U, Tschitschmann S, Sondermann D, Jäger G, Gong Z, Byström AS, Schaffrath R, Breunig KD. Elongator function in tRNA wobble uridine modification is conserved between yeast and plants. Molecular Microbiology. 2010;76:1082–1094. doi: 10.1111/j.1365-2958.2010.07163.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nakai Y, Umeda N, Suzuki T, Nakai M, Hayashi H, Watanabe K, Kagamiyama H. Yeast Nfs1p is involved in thio-modification of both mitochondrial and cytoplasmic tRNAs. The Journal of Biological Chemistry. 2004;279:12363–12368. doi: 10.1074/jbc.M312448200. [DOI] [PubMed] [Google Scholar]
  30. Nakai Y, Horiguchi G, Iwabuchi K, Harada A, Nakai M, Hara-Nishimura I, Yano T. Trna wobble modification affects leaf cell development in Arabidopsis thaliana. Plant & Cell Physiology. 2019;60:2026–2039. doi: 10.1093/pcp/pcz064. [DOI] [PubMed] [Google Scholar]
  31. Nedialkova DD, Leidel SA. Optimization of codon translation rates via trna modifications maintains proteome integrity. Cell. 2015;161:1606–1618. doi: 10.1016/j.cell.2015.05.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Noma A, Sakaguchi Y, Suzuki T. Mechanistic characterization of the sulfur-relay system for eukaryotic 2-thiouridine biogenesis at tRNA wobble positions. Nucleic Acids Research. 2009;37:1335–1352. doi: 10.1093/nar/gkn1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Pan T. Modifications and functional genomics of human transfer RNA. Cell Research. 2018;28:395–404. doi: 10.1038/s41422-018-0013-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Peng Y, Yang J, Li X, Zhang Y. Salicylic acid: Biosynthesis and signaling. Annual Review of Plant Biology. 2021;72:761–791. doi: 10.1146/annurev-arplant-081320-092855. [DOI] [PubMed] [Google Scholar]
  35. Philipp M, John F, Ringli C. The cytosolic thiouridylase CTU2 of Arabidopsis thaliana is essential for posttranscriptional thiolation of tRNAs and influences root development. BMC Plant Biology. 2014;14:109. doi: 10.1186/1471-2229-14-109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ranjan N, Rodnina MV. Thio-modification of trna at the wobble position as regulator of the kinetics of decoding and translocation on the ribosome. Journal of the American Chemical Society. 2017;139:5857–5864. doi: 10.1021/jacs.7b00727. [DOI] [PubMed] [Google Scholar]
  37. Rekhter D, Lüdke D, Ding Y, Feussner K, Zienkiewicz K, Lipka V, Wiermer M, Zhang Y, Feussner I. Isochorismate-derived biosynthesis of the plant stress hormone salicylic acid. Science. 2019;365:498–502. doi: 10.1126/science.aaw1720. [DOI] [PubMed] [Google Scholar]
  38. Rezgui VAN, Tyagi K, Ranjan N, Konevega AL, Mittelstaet J, Rodnina MV, Peter M, Pedrioli PGA. tRNA tKUUU, tQUUG, and tEUUC wobble position modifications fine-tune protein translation by promoting ribosome A-site binding. PNAS. 2013;110:12289–12294. doi: 10.1073/pnas.1300781110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Ryals J, Weymann K, Lawton K, Friedrich L, Ellis D, Steiner HY, Johnson J, Delaney TP, Jesse T, Vos P, Uknes S. The arabidopsis NIM1 protein shows homology to the mammalian transcription factor inhibitor I kappa B. The Plant Cell. 1997;9:425–439. doi: 10.1105/tpc.9.3.425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Saleh A, Withers J, Mohan R, Marqués J, Gu Y, Yan S, Zavaliev R, Nomoto M, Tada Y, Dong X. Posttranslational modifications of the master transcriptional regulator npr1 enable dynamic but tight control of plant immune responses. Cell Host & Microbe. 2015;18:169–182. doi: 10.1016/j.chom.2015.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schaffrath R, Leidel SA. Wobble uridine modifications-a reason to live, a reason to die?! RNA Biology. 2017;14:1209–1222. doi: 10.1080/15476286.2017.1295204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schwanhäusser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, Chen W, Selbach M. Global quantification of mammalian gene expression control. Nature. 2011;473:337–342. doi: 10.1038/nature10098. [DOI] [PubMed] [Google Scholar]
  43. Sen GC, Ghosh HP. Role of modified nucleosides in tRNA: effect of modification of the 2-thiouridine derivative located at the 5’-end of the anticodon of yeast transfer RNA Lys2. Nucleic Acids Research. 1976;3:523–535. doi: 10.1093/nar/3.3.523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Shah J, Tsui F, Klessig DF. Characterization of a salicylic acid-insensitive mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-inducible expression of the tms2 gene. Molecular Plant-Microbe Interactions. 1997;10:69–78. doi: 10.1094/MPMI.1997.10.1.69. [DOI] [PubMed] [Google Scholar]
  45. Shaheen R, Mark P, Prevost CT, AlKindi A, Alhag A, Estwani F, Al-Sheddi T, Alobeid E, Alenazi MM, Ewida N, Ibrahim N, Hashem M, Abdulwahab F, Bryant EM, Spinelli E, Millichap J, Barnett SS, Kearney HM, Accogli A, Scala M, Capra V, Nigro V, Fu D, Alkuraya FS. Biallelic variants in CTU2 cause DREAM-PL syndrome and impair thiolation of tRNA wobble U34. Human Mutation. 2019;40:2108–2120. doi: 10.1002/humu.23870. [DOI] [PubMed] [Google Scholar]
  46. Simpson CL, Lemmens R, Miskiewicz K, Broom WJ, Hansen VK, van Vught PWJ, Landers JE, Sapp P, Van Den Bosch L, Knight J, Neale BM, Turner MR, Veldink JH, Ophoff RA, Tripathi VB, Beleza A, Shah MN, Proitsi P, Van Hoecke A, Carmeliet P, Horvitz HR, Leigh PN, Shaw CE, van den Berg LH, Sham PC, Powell JF, Verstreken P, Brown RH, Robberecht W, Al-Chalabi A. Variants of the elongator protein 3 (ELP3) gene are associated with motor neuron degeneration. Human Molecular Genetics. 2009;18:472–481. doi: 10.1093/hmg/ddn375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Spoel SH, Mou Z, Tada Y, Spivey NW, Genschik P, Dong X. Proteasome-mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunity. Cell. 2009;137:860–872. doi: 10.1016/j.cell.2009.03.038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Spoel SH, Dong X. How do plants achieve immunity? defence without specialized immune cells. Nature Reviews. Immunology. 2012;12:89–100. doi: 10.1038/nri3141. [DOI] [PubMed] [Google Scholar]
  49. Su D, Chan CTY, Gu C, Lim KS, Chionh YH, McBee ME, Russell BS, Babu IR, Begley TJ, Dedon PC. Quantitative analysis of ribonucleoside modifications in tRNA by HPLC-coupled mass spectrometry. Nature Protocols. 2014;9:828–841. doi: 10.1038/nprot.2014.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tada Y, Spoel SH, Pajerowska-Mukhtar K, Mou Z, Song J, Wang C, Zuo J, Dong X. Plant immunity requires conformational changes [corrected] of NPR1 via S-nitrosylation and thioredoxins. Science. 2008;321:952–956. doi: 10.1126/science.1156970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Torres AG, Batlle E, Ribas de Pouplana L. Role of tRNA modifications in human diseases. Trends in Molecular Medicine. 2014;20:306–314. doi: 10.1016/j.molmed.2014.01.008. [DOI] [PubMed] [Google Scholar]
  52. Vlot AC, Dempsey DA, Klessig DF. Salicylic acid, a multifaceted hormone to combat disease. Annual Review of Phytopathology. 2009;47:177–206. doi: 10.1146/annurev.phyto.050908.135202. [DOI] [PubMed] [Google Scholar]
  53. Wang Y, An C, Zhang X, Yao J, Zhang Y, Sun Y, Yu F, Amador DM, Mou Z. The Arabidopsis elongator complex subunit2 epigenetically regulates plant immune responses. The Plant Cell. 2013;25:762–776. doi: 10.1105/tpc.113.109116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in arabidopsis in a single generation. Genome Biology. 2015;16:144. doi: 10.1186/s13059-015-0715-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wang W, Withers J, Li H, Zwack PJ, Rusnac DV, Shi H, Liu L, Yan S, Hinds TR, Guttman M, Dong X, Zheng N. Structural basis of salicylic acid perception by arabidopsis NPR proteins. Nature. 2020;586:311–316. doi: 10.1038/s41586-020-2596-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wang J, Zhang X, Greene GH, Xu G, Dong X. PABP/purine-rich motif as an initiation module for cap-independent translation in pattern-triggered immunity. Cell. 2022;185:3186–3200. doi: 10.1016/j.cell.2022.06.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Waszak SM, Robinson GW, Gudenas BL, Smith KS, Forget A, Kojic M, Garcia-Lopez J, Hadley J, Hamilton KV, Indersie E, Buchhalter I, Kerssemakers J, Jäger N, Sharma T, Rausch T, Kool M, Sturm D, Jones DTW, Vasilyeva A, Tatevossian RG, Neale G, Lombard B, Loew D, Nakitandwe J, Rusch M, Bowers DC, Bendel A, Partap S, Chintagumpala M, Crawford J, Gottardo NG, Smith A, Dufour C, Rutkowski S, Eggen T, Wesenberg F, Kjaerheim K, Feychting M, Lannering B, Schüz J, Johansen C, Andersen TV, Röösli M, Kuehni CE, Grotzer M, Remke M, Puget S, Pajtler KW, Milde T, Witt O, Ryzhova M, Korshunov A, Orr BA, Ellison DW, Brugieres L, Lichter P, Nichols KE, Gajjar A, Wainwright BJ, Ayrault O, Korbel JO, Northcott PA, Pfister SM. Germline elongator mutations in sonic hedgehog medulloblastoma. Nature. 2020;580:396–401. doi: 10.1038/s41586-020-2164-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Wu Y, Zhang D, Chu JY, Boyle P, Wang Y, Brindle ID, De Luca V, Després C. The arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Reports. 2012;1:639–647. doi: 10.1016/j.celrep.2012.05.008. [DOI] [PubMed] [Google Scholar]
  59. Xu G, Yuan M, Ai C, Liu L, Zhuang E, Karapetyan S, Wang S, Dong X. uORF-mediated translation allows engineered plant disease resistance without fitness costs. Nature. 2017;545:491–494. doi: 10.1038/nature22372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Xu Y, Zhang L, Ou S, Wang R, Wang Y, Chu C, Yao S. Natural variations of SLG1 confer high-temperature tolerance in indica rice. Nature Communications. 2020;11:5441. doi: 10.1038/s41467-020-19320-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Yan S, Wang W, Marqués J, Mohan R, Saleh A, Durrant WE, Song J, Dong X. Salicylic acid activates DNA damage responses to potentiate plant immunity. Molecular Cell. 2013;52:602–610. doi: 10.1016/j.molcel.2013.09.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Yan S, Dong X. Perception of the plant immune signal salicylic acid. Current Opinion in Plant Biology. 2014;20:64–68. doi: 10.1016/j.pbi.2014.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Yoo H, Greene GH, Yuan M, Xu G, Burton D, Liu L, Marqués J, Dong X. Translational regulation of metabolic dynamics during effector-triggered immunity. Molecular Plant. 2020;13:88–98. doi: 10.1016/j.molp.2019.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS. 2012;16:284–287. doi: 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Yu X, Xu Y, Yan S. Salicylic acid and ethylene coordinately promote leaf senescence. Journal of Integrative Plant Biology. 2021;63:823–827. doi: 10.1111/jipb.13074. [DOI] [PubMed] [Google Scholar]
  66. Yu X, Cui X, Wu C, Shi S, Yan S. Salicylic acid inhibits gibberellin signaling through receptor interactions. Molecular Plant. 2022;15:1759–1771. doi: 10.1016/j.molp.2022.10.001. [DOI] [PubMed] [Google Scholar]
  67. Zabel R, Bär C, Mehlgarten C, Schaffrath R. Yeast alpha-tubulin suppressor Ats1/Kti13 relates to the elongator complex and interacts with elongator partner protein Kti11. Molecular Microbiology. 2008;69:175–187. doi: 10.1111/j.1365-2958.2008.06273.x. [DOI] [PubMed] [Google Scholar]
  68. Zavaliev R, Mohan R, Chen T, Dong X. Formation of npr1 condensates promotes cell survival during the plant immune response. Cell. 2020;182:1093–1108. doi: 10.1016/j.cell.2020.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zhang H, Zhang F, Yu Y, Feng L, Jia J, Liu B, Li B, Guo H, Zhai J. A comprehensive online database for exploring ∼20,000 public arabidopsis rna-seq libraries. Molecular Plant. 2020;13:1231–1233. doi: 10.1016/j.molp.2020.08.001. [DOI] [PubMed] [Google Scholar]
  70. Zheng T. Cgb project. swh:1:rev:dc83f7e363376f4364ca5db5000043795eea06c5Software Heritage. 2022 https://archive.softwareheritage.org/swh:1:dir:eaa2a2142feb6cd76a512544fe50bff265057dfe;origin=https://github.com/XueaoZHENG/cgb_project;visit=swh:1:snp:243c9307eb31f29b6ac1863ce5d5dfde1b0491f2;anchor=swh:1:rev:dc83f7e363376f4364ca5db5000043795eea06c5
  71. Zhou JM, Zhang Y. Plant immunity: danger perception and signaling. Cell. 2020;181:978–989. doi: 10.1016/j.cell.2020.04.028. [DOI] [PubMed] [Google Scholar]
  72. Zhou P, Zavaliev R, Xiang Y, Dong X. Seeing is believing: understanding functions of NPR1 and its paralogs in plant immunity through cellular and structural analyses. Current Opinion in Plant Biology. 2023;73:102352. doi: 10.1016/j.pbi.2023.102352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Zinshteyn B, Gilbert WV. Loss of a conserved tRNA anticodon modification perturbs cellular signaling. PLOS Genetics. 2013;9:e1003675. doi: 10.1371/journal.pgen.1003675. [DOI] [PMC free article] [PubMed] [Google Scholar]

Editor's evaluation

Detlef Weigel 1

This valuable study provides solid evidence for a role of tRNA thiolation in Arabidopsis immunity through genetic, transcriptomic, and proteomic approaches, specifically that the tRNA mcm5s2U modification affects SA signaling through NPR1 translation.

Decision letter

Editor: Detlef Weigel1

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

eLife. 2024 Jan 29;13:e93517. doi: 10.7554/eLife.93517.sa2

Author response

Point-by-point description of the revisions

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Review comment

The article titled "The tRNA thiolation-mediated translational control is essential for plant immunity" by Zheng et al. highlights the critical role of tRNA thiolation in Arabidopsis plant immunity through comprehensive analysis, including genetics, transcriptional, translational, and proteomic approaches. Through their investigation, the authors identified a cbp mutant, resulting in the knockout of ROL5, and discovered that ROL5 and CTU2 form a complex responsible for catalyzing the mcm5s2U modification, which plays a pivotal role in immune regulation. The findings from this study unveil a novel regulatory mechanism for plant defense. Undoubtedly, this discovery is innovative and holds significant potential impact. However, before considering publication, it is necessary for the authors to address the various questions raised in the manuscript concerning the experiments and analysis to ensure the reliability of the study's conclusions.

Thank you very much for your support and suggestions!

Here is Comments:

Line 64-65:

The author mentioned that 'While NPR1 is a positive regulator of SA signaling, NPR3 and NPR4 are negative regulators.' However, several recent discoveries are suggesting that it may not be a definitive fact that NPR3 and NPR4 are negative regulators. Therefore, I recommend the authors to review this section in light of the findings from recent papers and make necessary edits to reflect the most current understanding.

Thank you for your feedback. Since we mainly focused on NPR1 in this study, we removed this sentence to avoid confusion. We provided additional information about NPR1 in the Introduction section to emphasize the importance of NPR1 (Line 64-68).

Line 182- & Figure 4:

The author conducted RNA-seq, Ribo-seq, and proteome analysis. Describing the analysis as "transcriptional and translational" using RNA-seq and proteome data seems not entirely accurate. Proteome data compared with RNA-seq not only reflects translational changes but may also encompass post-translational regulations that contribute to the observed differences. To maintain precision, the title of this section should either be modified to "transcriptional and protein analysis" or, alternatively, compare RNA-seq and Ribo-seq data to demonstrate the transcriptional and translational changes more explicitly.

Thank you for your suggestions. We agree with you and thus change the description accordingly throughout the manuscript.

Line 229-235 and Figure 5C:

The interpretation of Figure 5C's polysome profiling results is inconclusive. There does not seem to be a noticeable difference in polysomal fractions between the cab mutant and CAM. The observed differences in the overlay of multiple polysome fractions between cab and COM could be primarily influenced by baseline variations rather than a significant decrease in the polynomial fractions in cpg. Therefore, it is necessary to carefully review other relevant papers that discuss polysome fraction data and their analysis. By doing so, the authors can make the appropriate corrections to ensure accurate interpretations.

Thank you for your comments. We agree that the difference between cgb and COM was not dramatic visually. This is a common feature of polysome profiling assay (e.g. Extended Data Figure 1f in Nature 545: 487–490; Figure 1c in Nature Plants, 9: 289–301). In our case, the difference between polysome fractions was unlikely due to the baseline variation for two reasons. First, baseline variation affects monosome and polysome fractions in the same way. However, our results showed the monosome fraction of cgb is higher than that of COM, whereas the polysome fraction of cgb is lower than that of COM. Second, this result was repeatedly detected. For better visualization, we adjusted the scale of Y axis in the revised manuscript (Figure 5D).

Line 482 Ion Leakage assay:

I could not find the ion leakage assay in this manuscript, so I wonder why it is mentioned.

We are sorry for the mistake. The Ion leakage data were included in previous visions of the manuscript. We removed the data but forgot to remove the corresponding method in the present version.

Materials and methods:

To enhance the reproducibility of the study, the authors should provide a more detailed description of the Materials and methods, especially for critical experiments like the Yeast-two-hybrid assays. Clear documentation of specific reagents, strains, and protocols used, along with information on controls, will bolster the validity of the results and facilitate future research in this area.

Thank you for your suggestions. We provided more details in the methods. For yeast two-hybrid assays, the vector information was included in “Vector constructions” section.

Minor Point:

Line 61: There is a space between ')' and '.', which needs to be edited.

The space was deleted.

Reviewer #1 (Significance (Required)):

This study holds significant importance within the field of plant immunity research. The authors have made valuable contributions through their comprehensive analysis, encompassing genetics, transcriptional, translational, and proteomic approaches, to elucidate the critical role of tRNA thiolation in plant immunity. One of the major strengths of this study lies in its ability to shed light on a previously unknown regulatory mechanism for plant defense. By identifying the cbp mutant and investigating the role of ROL5 and CTU2 in catalyzing the mcm5s2U modification, the authors have unveiled a novel aspect of plant immune regulation. This innovative discovery provides a deeper understanding of the intricate molecular processes governing immunity in plants.

Moreover, the study's findings are not limited to the immediate field of plant immunity but also have broader implications for the scientific community. By employing diverse methodologies, the authors have demonstrated how tRNA thiolation exerts control over both transcriptional and translational reprogramming, revealing intricate links between these processes. This integrative approach sets a precedent for future research in the field of plant molecular biology and opens up new avenues for investigating other aspects of immune regulation.

In terms of its relevance, the study's findings have the potential to captivate researchers across various disciplines, such as plant biology, molecular genetics, and translational research. The insights gained from this study may inspire researchers to explore further the role of tRNA in other regulation.

Thank you very much for your positive comments and support!

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

The authors presented an intriguing and previously unknown mechanism that the tRNA mcm5s2U modification regulates plant immunity through the SA signaling pathway, specifically by controlling NPR1 translation. The manuscript was well-written and logically structured, allowing for a clear understanding of the research. The authors provided strong and persuasive data to support their key claims. However, further improvement is required to strengthen the conclusion that mcm5s2U regulates plant immunity by controlling NPR1 translation.

Thank you very much for your positive comments and support!

Major comments:

1. NPR1 translation should be examined to verify the Mass Spec (Figure 5B) and polysome profiling data (Figure 5D) by checking the NPR1 protein and mRNA level using antibodies and qPCR, respectively, in the cgb mutant background to establish a concrete confirmation of CGB regulation in NPR1 translation.

This is a very constructive suggestion. We performed these experiments and found that the transcription levels of NPR1 were similar between COM and cgb both before and after Psm ES4326 infection (Figure S2), which is consistent with RNA-Seq data. Consistent with the Mass Spec and polysome profiling data, the NPR1 protein level was much higher in COM than that in cgb (Figure 5C) after Psm ES4326 infection. Together, these data further supported our conclusion that translation of NPR1 is impaired in cgb.

2. Analyzing the genetic epistasis of CGB and NPR1 to check if CGB regulates plant immunity through the NPR1-dependent SA signal pathway. If the authors' claim is valid, I would expect no addictive effect on bacterial growth in the cgb/npr1 double mutant compared to the single mutants. Due to the broad impact of CGB on plant signaling (Figures 4E and 4F), the SA protection assay, which concentrates on the SA signal pathway, needs to be tested in WT, cgb and npr1 plants as an alternative assay to the genetic epistasis analysis. I expect that the SA-mediated protection is also compromised in cgb mutant background.

Thank you for your suggestions. We did examine the growth of Psm ES4326 in the cgb npr1 double mutant and found that cgb npr1 was significantly more susceptible than npr1 and cgb (Figure below). Although the additive effects were observed, this result was not against our conclusion for the following reasons. First, the translation of NPR1 was reduced rather than completely blocked in cgb. In other words, NPR1 still has some function in cgb. But in the cgb npr1 double mutant, the function of NPR1 is completely abolished, which explains why cgb npr1 was more susceptible than cgb. Second, in addition to NPR1, some other immune regulators (such as PAD4, EDS5, and SAG101) were also compromised in cgb (Figure 5B), which explained why cgb npr1 was more susceptible than npr1. Since the result of the genetic analysis was not intuitive, we decided not to include it in the manuscript.

SA signaling is known to regulate both basal resistance and systemic acquired resistance (SA-mediated protection). We have shown that cgb is defective in the defect of basal resistance, which cgb is sufficient to support our conclusion that the tRNA thiolation is essential for plant immunity. We agree that it is expected that the SA-mediated protection is also compromised in cgb. We will test this in the future study.

Author response image 1.

Author response image 1.

Open in a new tab

1. Could the authors comment on why using COM instead of WT as a control to perform the majority of the experiments?

Thank you for your comments. In addition to ROL5, the cgb mutant may have other mutations compared with WT.COM is a complementation line in the cgb background. Therefore, the genetic background between COM and cgb may be more similar than that of WT and cgb.

1. In Figure 5E, why does ACTIN2 have an enhanced translation while NPR1 shows a compromised one in cgb mutant? How does the mcm5s2U distinguish NPR1 and ACTIN2 codons? Does mcm5s2U modification have both positive and negative roles in regulating protein translation?

Thank you for raising this question. As previously reported, loss of the mcm5s2U modification causes ribosome pausing at AAA and CAA codons. Therefore, the translation of the mRNAs with more GAA/CAA/AAA codons (called s2 codon) is likely to be affected more dramatically in cgb. We have analyzed the percentage of s2 codon at whole-genome level (Figure below). The average percentage is 8.5%, while NPR1 contains 10.1% s2 codon and actin contains only 4.5% s2 codon. When fewer ribosomes are used for translation of the mRNAs with high s2 codon percentage, more ribosomes are available for translation of the mRNAs with low s2 codon percentage, which may account for the enhanced translation efficiency. To focus on NPR1 and to avoid confusion, we removed the ACTIN data in the revised manuscript.

Author response image 2.

Author response image 2.

Open in a new tab

3. Specify the protein amount used for the in vitro pull-down assay and agrobacteria concentration used for the tobacco Co-IP assay in the protocol section.

We added this information in Method section in the revised manuscript.

4. Delete the SA quantification and Ion leakage assay in the protocol, which are not used in the study.

We are sorry for the mistake. The SA quantification and ion leakage data were included in previous visions of the manuscript. We removed the data but forgot to remove the corresponding method in the present version. We deleted them in the revised manuscript.

5. The strain Pst DC3000 avrRPT2 was not used in this study. Please remove it.

We are sorry for the mistake. The strain Pst DC3000 avrRPT2 was used for ion leakage assay in previous visions of the manuscript. We deleted it in the revised manuscript.

6. In Figure 5F, did the 59 genes tested overlap with the 366 attenuated proteins in the cgb mutant? Were the 59 genes translationally regulated?

Thank you for your suggestion. Venn diagram analysis revealed that 12 genes (about 20%) are also attenuated proteins, suggesting that the mcm5s2U modification regulates the translation of some SA-responsive genes.

Author response image 3.

Author response image 3.

Open in a new tab

Reviewer #2 (Significance (Required)):

The authors' study is significant as it establishes the first connection between tRNA mcm5s2U modification and plant immunity, specifically by regulating NPR1 protein translation. This research expands our understanding of the biological role of tRNA mcm5s2U modification and highlights the importance of translational control in plant immunity. It is likely to captivate scientists working in this field.

Thank you very much for your positive comments and support!

Reviewer #3 (Evidence, reproducibility and clarity (Required)):

In this manuscript, the authors identified a cgb mutant that carries a mutation in the ROL5 gene Both the cgb mutant and the newly created rol5-c mutant are susceptible to the bacterial pathogen Psm. The authors showed that ROL5 interacts with CTU2, the Arabidopsis homologous protein of the yeast tRNA thiolation enzyme NCS2. A ctu2-1 mutant is also susceptible to Psm, suggesting the tRNA thiolation may play a role in plant immunity. Indeed, tRNA mcm5S2U levels are undetectable in rol5-c and ctu2-1 mutants. The authors found that the cgb mutation significantly attenuated basal and Psm-induced transcriptome and proteome changes. Furthermore, it was found that the translation efficiency of a group of SA signaling-related proteins including NPR1 is compromised.

The manuscript provides solid evidence for the involvement of ROL5 and CTU2 in plant immunity using the rol5 and ctu2 mutants. The authors may consider the following suggestions and comments to improve the manuscript.

Thank you very much for your support and suggestions!

1. The function of the Elongator complex in tRNA modification/thiolation has been extensively studied. In Arabidopsis Elongator mutants, mcm5S2U levels are very low, similar to the levels in the rol5 and ctu2 mutants (Mehlgarten et al., 2010, Mol Microbiology, 76, 1082-1094; Leitner et al., 2015 Cell Rep). In elp mutants, the PIN protein levels are reduced without reduced mRNA levels (Leitner et al., 2015), indicating that Elongator-mediated tRNA modification is involved in translation regulation. The Elongator complex plays an important role in plant immunity, though the reduced mcm5S2U levels in elp mutants were not proposed as the exclusive cause of the immune phenotypes. In fact, it would be difficult to establish a cause-effect relationship between tRNA modification and immunity. These results should be discussed in the manuscript.

Thank you very much for your insightful comment on the role of the ELP complex in tRNA modification and plant immunity. We added a paragraph discussing the ELP complex in the revised manuscript (Line 280-295).

In addition to tRNA modification, the ELP complex has several other distinct activities including histone acetylation, α-tubulin acetylation, and DNA demethylation. Therefore, it is difficult to dissect which activity of the ELP complex contributes to plant immunity. However, the only known activity of ROL5 and CTU2 is to catalyze tRNA thiolation. Considering that the elp, rol5, and ctu2 mutants are all defective in tRNA thiolation, it is likely the tRNA modification activity of the ELP complex underlies its function in plant immunity.

2. The interaction between CTU2 and ROL5 in Y2H has previously been reported (Philipp et al., 2014). The same report also showed reduced tRNA thiolation in the ctu2-2 mutant using polyacrylamide gel. These results should be mentioned/discussed in the manuscript.

Thank you for pointing them out. We added this information in the revised version (Line 146-147).

3. tRNA modification unlikely plays a unique role in plant immunity. It can be inferred that mutations affecting tRNA modification (rol5, ctu2, elp, etc.) would delay both internal and external stimulus-induced signaling including immune signaling.

We agree with you that tRNA modification has other roles in addition to plant immunity. In the Discussion section, we have mentioned that “it was found that tRNA thiolation is required for heat stress tolerance (Xu et al., 2020). ……It will also be interesting to test whether tRNA thiolation is required for responses to other stresses such as drought, salinity, and cold.” (Line276-279).

4. It would be interesting to conduct statistical analyses on the genetic codons used in the CDSs whose translation was attenuated as described in the manuscript. Do these genes including NPR1 use more than average levels of AAA, CAA, and GAA codons? If not, why their translation is impaired?

Thank you for your suggestion. We called GAA/CAA/AAA codons s2 codon. We have analyzed the percentage of s2 codon at whole-genome level (Figure below). NPR1 does contain more s2 codon (10.1%) than the average level (8.5%). We are preparing another manuscript, which will report the relationship between s2 codon and translation.

Author response image 4.

Author response image 4.

Open in a new tab

Referees cross-commenting

It is important to put current research in the context of available knowledge in the field. The digram in Figure 3C shows that the Elongator complex functions upstream of ROL5 & CTU2 in modifying tRNA. The function of Elongator in plant immunity has been well established. The similarities and differences should be discussed. Additionally, it may no be a good idea to claim that the results are novel.

Thank you for your comments. We added a paragraph discussing the ELP complex in the revised manuscript (Line 280-295). The ELP complex catalyzes the cm5U modification, which is the precursor of mcm5s2U catalyzed by ROL5 and CTU2. In addition to tRNA modification, the ELP complex has several other distinct activities including histone acetylation, α-tubulin acetylation, and DNA demethylation. Therefore, it is difficult to dissect which activity of the ELP complex contributes to plant immunity. However, the only known activity of ROL5 and CTU2 is to catalyze tRNA thiolation. Considering that the elp, rol5, and ctu2 mutants are all defective in tRNA thiolation, it is likely the tRNA modification activity of the ELP complex underlies its function in plant immunity. Therefore, our study improved our understanding of the ELP complex in plant immunity. We have deleted the words “new” and “novel” throughout the manuscript.

Reviewer #3 (Significance (Required)):

The manuscript provides solid evidence for the involvement of ROL5 and CTU2 in plant immunity. However, the authors did not acknowledge the existing results about the Elongator complex that functions in the same pathway in modifying tRNA. The involvement of Elongator in plant immunity has been well established. The cause-effect relationship between tRNA modification and plant immunity is difficult to demonstrate.

We think that the cause-effect relationship between the activities of the ELP complex and plant immunity is difficult to demonstrate because the ELP complex has several distinct activities other than tRNA modification. However, since the only known activity of ROL5 and CTU2 is to catalyze tRNA thiolation, the cause-effect relationship between tRNA thiolation and plant immunity is clear, which indicated that the tRNA modification activity of the ELP complex contributes to plant immunity.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Zheng X, Wu C, Yan S. 2022. The thiolation modification of tRNA is essential for plant immunity. NCBI Gene Expression Omnibus. GSE183087
    2. Zheng X, Yan S. 2021. The thiolation modification of tRNA is essential for plant immunity. ProteomeXchange. PXD028189

    Supplementary Materials

    Figure 1—source data 1. Source data related to Figure 1B.
    elife-93517-fig1-data1.xlsx (8.7KB, xlsx)
    Figure 1—source data 2. Source data related to Figure 1D.
    elife-93517-fig1-data2.zip (6.9MB, zip)
    Figure 1—source data 3. Source data related to Figure 1E.
    elife-93517-fig1-data3.zip (6.9MB, zip)
    Figure 2—source data 1. Source data related to Figure 2D.
    elife-93517-fig2-data1.zip (9.1MB, zip)
    Figure 2—source data 2. Source data related to Figure 2E.
    elife-93517-fig2-data2.zip (4MB, zip)
    Figure 3—source data 1. Source data related to Figure 3A.
    elife-93517-fig3-data1.xlsx (8.6KB, xlsx)
    Figure 3—source data 2. Source data related to Figure 3C.
    elife-93517-fig3-data2.xlsx (1.1MB, xlsx)
    Figure 4—source data 1. Source data related to Figure 4A.
    elife-93517-fig4-data1.xlsx (1.5MB, xlsx)
    Figure 4—source data 2. Source data related to Figure 4B.
    elife-93517-fig4-data2.xlsx (344KB, xlsx)
    Figure 4—source data 3. Source data related to Figure 4C.
    elife-93517-fig4-data3.xlsx (61.7KB, xlsx)
    Figure 4—source data 4. Source data related to Figure 4D.
    elife-93517-fig4-data4.xlsx (30.9KB, xlsx)
    Figure 4—source data 5. Source data related to Figure 4E.
    elife-93517-fig4-data5.xlsx (17.4KB, xlsx)
    Figure 4—source data 6. Source data related to Figure 4F.
    elife-93517-fig4-data6.xlsx (12.9KB, xlsx)
    Figure 5—source data 1. Source data related to Figure 5A.
    elife-93517-fig5-data1.xlsx (25.1KB, xlsx)
    Figure 5—source data 2. Source data related to Figure 5B.
    elife-93517-fig5-data2.xlsx (12.2KB, xlsx)
    Figure 5—source data 3. Source data related to Figure 5C.
    elife-93517-fig5-data3.zip (9.8MB, zip)
    Figure 5—source data 4. Source data related to Figure 5D.
    elife-93517-fig5-data4.xlsx (110.7KB, xlsx)
    Figure 5—source data 5. Source data related to Figure 5E.
    elife-93517-fig5-data5.xlsx (11KB, xlsx)
    Figure 5—source data 6. Source data related to Figure 5F.
    elife-93517-fig5-data6.xlsx (25.2KB, xlsx)
    MDAR checklist
    elife-93517-mdarchecklist1.docx (100.6KB, docx)

    Data Availability Statement

    RNA sequencing datasets have been deposited to GSE database with an accession number GSE183087. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the iProX partner repository with the dataset identifier PXD028189. Data analysis scripts are available on GitHub (copy archived at Zheng, 2022). Source data files have been provided for Figures 1B, 1D, 1E, 2D, 2E, 3B, 3C, Figure 4, and Figure 5.

    The following datasets were generated:

    Zheng X, Wu C, Yan S. 2022. The thiolation modification of tRNA is essential for plant immunity. NCBI Gene Expression Omnibus. GSE183087

    Zheng X, Yan S. 2021. The thiolation modification of tRNA is essential for plant immunity. ProteomeXchange. PXD028189

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES