Skip to main content
NCBI home page
Environmental Microbiology Reports logoLink to Environmental Microbiology Reports
. 2023 Dec 9;16(1):e13219. doi: 10.1111/1758-2229.13219

Conserved infections and reproductive phenotypes of Wolbachia symbionts in Asian tortrix moths

Hiroshi Arai 1,✉, Masatoshi Ueda 1, Tatsuya Hirano 1, Naoya Akizuki 1, Shiou‐Ruei Lin 2, Duong Kieu Hanh 3, Jaka Widada 4, Muhammad Saifur Rohman 4, Madoka Nakai 1, Yasuhisa Kunimi 1, Le Van Vang 3, Arman Wijonarko 5, Maki N Inoue 1,✉
PMCID: PMC10866051  PMID: 38070178

Abstract

Wolbachia is a ubiquitous endosymbiotic bacterium that manipulates insect reproduction. A notable feature of Wolbachia is male killing (MK), whereby sons of infected females are killed during development; however, the evolutionary processes by which Wolbachia acquired the MK ability remain unclear. The tea tortrix moth Homona magnanima (Tortricidae) harbours three non‐MK Wolbachia strains (wHm‐a, wHm‐b and wHm‐c) and an MK strain wHm‐t. Although wHm‐t and wHm‐c are closely related, only wHm‐t has an MK‐associated prophage region. To understand the evolutionary processes underlying the emergence of MK wHm‐t, we examined Wolbachia infections and phenotypes in 62 tortricid species collected from 39 localities across Japan, Taiwan, Vietnam and Indonesia. PCR assays detected wHm‐c relatives in 51 species and triple infection of wHm‐a, wHm‐b and wHm‐c in 31 species. Apart from Taiwanese H. magnanima, no species exhibited the MK phenotype and were positive for the wHm‐t‐specific prophage. While wHm‐t infection was dominant in Taiwanese H. magnanima, wHm‐a, wHm‐b and wHm‐c were dominant in Japanese H. magnanima populations. These results suggest that wHm‐a, wHm‐b and wHm‐c strains descended from a common ancestor with repeated infection loss and that wHm‐t evolved from the wHm‐c acquiring MK ability in allopatric populations of H. magnanima.

By analysing tortrix moths collected from Japan (JPN), Taiwan (TWN), Vietnam (VNM) and Indonesia (IDN), we reveal a conserved Wolbachia infection in Asian tortrix moths. Furthermore, we show distinct infection patterns of male‐killing (MK) and non‐MK Wolbachia strains in Homona magnanima populations. We conclude that the Wolbachia strains are descended from a common ancestor with repeated loss of infection and that the MK strain wHm‐t has evolved from its closely related wHm‐c strain in allopatric populations of H. magnanima.

graphic file with name EMI4-16-e13219-g004.jpg

INTRODUCTION

A maternally inherited intracellular bacterium, Wolbachia (Alphaproteobacteria), is found in at least 40% of all insect species, making it one of the most widespread endosymbionts (Rasgon et al., 2006; Stouthamer et al., 1999; Werren et al., 2008; Zug & Hammerstein, 2012). Wolbachia has achieved evolutionary success by manipulating host reproduction through various means that enhance endosymbiont transmission. These manipulations of the host reproduction and development include cytoplasmic incompatibility (CI), male killing (MK), parthenogenesis and feminisation, each of which seemingly affects the biological features, distribution and evolution of the host (Charlat & Merçot, 2003; Charlat et al., 2007; Jiggins, 2003; Narita et al., 2007; Rokas, 2000; Turelli & Hoffmann, 1991; Werren et al., 2008). For instance, MK directly skews the sex ratio of the host population towards females, allowing Wolbachia to spread the infection across the host population (Werren et al., 2008).

For decades, Wolbachia‐induced MK has drawn the attention of basic and applied biologists. One unresolved question is how Wolbachia acquired the MK ability through evolutionary processes. Wolbachia occasionally transmits horizontally among arthropods but is primarily transmitted from female hosts to their offspring (Duron et al., 2008; Vavre et al., 1999; Werren et al., 2008). Previous studies have suggested that sister taxa of host species harbour closely related Wolbachia (Baldo et al., 2006; Kageyama et al., 2004; Watanabe et al., 2011; Watanabe et al., 2012). For instance, closely related MK‐inducing Wolbachia strains are conserved among Ostrinia moths (Kageyama et al., 2004; Muro et al., 2023). In this case, an ancestral Wolbachia strain likely acquired MK properties and was descended from its host species. In contrast, closely related Wolbachia strains do not necessarily exhibit similar phenotypes (Arai et al., 2020; Metcalf et al., 2014). The phylogenetic relationship between MK Wolbachia strains and their host is not always concordant, suggesting that Wolbachia independently acquired their MK abilities multiple times (Baldo et al., 2006; Bleidorn & Gerth, 2018; Werren et al., 2008; Zhou et al., 1998). To understand the evolution of an MK Wolbachia strain, it is critical to determine whether MK Wolbachia descended from the ancestral host species or whether Wolbachia acquired an MK ability independently in the host.

Here, to clarify the evolutionary processes through which a Wolbachia strain wHm‐t acquired MK abilities in the oriental tea tortrix moth Homona magnanima (Tortricidae, Lepidoptera), we report the comprehensive analysis of Wolbachia infections and phenotypes in Tortricidae, including H. magnanima and 61 tortricid species, collected from 39 populations across Japan, Taiwan, Vietnam and Indonesia. We previously reported that H. magnanima was co‐infected with three Wolbachia strains in several Japanese populations (Arai et al., 2019; Takamatsu et al., 2021). Among them, wHm‐a exhibited no apparent effects on the host; wHm‐b induced CI that impaired the development of offspring of infected males and non‐infected females, while wHm‐c promoted host fecundity by increasing the pupal weight of the hosts (Arai et al., 2019; Ueda et al., 2023). In contrast, Taiwanese H. magnanima harbours an MK strain, wHm‐t, which is closely related to the non‐MK strain wHm‐c (Arai et al., 2020). More recently, we identified an MK‐associated prophage region that is present in wHm‐t but absent in wHm‐c (Arai et al., 2023). In the current study, we report (i) the conserved infections of Wolbachia wHm‐a, wHm‐b and wHm‐c relatives among Asian tortricids and (ii) the restricted distribution of the MK wHm‐t in Taiwanese H. magnanima. Our investigations provide insights into the evolutionary processes by which a non‐MK Wolbachia acquired the MK ability and how Wolbachia strains have persisted in their host populations.

EXPERIMENTAL PROCEDURES

Insects

H. magnanima and other tortricids were collected from damaged tea leaves by hand or using UV light and sex pheromones (Sumitomo Chemical Co., Ltd., Tokyo, Japan) in Japan, Vietnam and Indonesia. Taiwanese H. magnanima were previously obtained by Arai et al. (2020). The species name of the collected tortricids was determined based on morphological characters described in Kishida (2011), Tortricid.net (http://www.tortricidae.com/identification.asp), and BOLD database (https://www.boldsystems.org/index.php/TaxBrowser_Home). Samples were stocked in ethanol at −35°C until analysis.

Larvae were reared individually until eclosion with an artificial diet INSECTA LF (Nosan Co. Ltd., Yokohama, Japan) at room temperature (20–26°C) under 14–16 L:8–10D conditions. Adults were mated in a plastic bag (20 × 30 cm), and wax paper was placed to obtain egg masses. A collected egg mass was placed on sliced INSECTA LF in a plastic container (20 × 30 × 10 cm) for mass rearing. The sex ratio ([number of males/number of females] among enclosed adults) was determined.

DNA extraction, PCR and sanger sequencing

DNA was extracted as described by Arai et al. (2019) or with DNA zol (Molecular Research Center, Inc., OH, USA) following the manufacturer's protocol. Wolbachia wsp gene and conserved Lepidopteran COI gene were amplified with Emerald Amp Max Master Mix (TaKaRa Bio. Co. Ltd., Shiga, Japan) with specific primer sets, COI: LepF (5′‐ATTCAACCAATCATAAAGATATTGG‐3′) and LepR (5′‐TAAACTTCTGGATGTCCAAAAAATCA‐3′) (Hajibabaei et al., 2006); wsp: wspF81 (5′‐TGGTCCAATAAGTGATGAAGAAAC‐3′) and wspR691 (5′‐TGGAGTAGCGTTTAATTTTT‐3′) (Zhou et al., 1998). To distinguish Wolbachia genotypes, primers for wHm‐a: F321 (5′‐CCTAAACAAAAATAATGTTACAG‐3′) and R565 (5′‐TTTGATCATTCACAGCGT‐3′); wHm‐b: F176 (5′ GGTGCTAAAAAGAAGACTGCGG‐3′) and R667 (5′‐CCCCCTTGTCTTTGCTTGC‐3′); wHm‐c: F188 (5′‐CATATAAATCAGGTAAGGACAAC‐3′) and R603 (5′‐CACCAGCTTTTGCTTGATA‐3′), were employed. PCR conditions were as follows: 2 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at annealing temperature (50°C for wHm‐a, 55°C for wHm‐c and COI, 60°C for wHm‐b and universal wsp), 30 s at 72°C and 3 min at 72°C. The presence or absence of the wHm‐t‐specific prophage region in field‐collected tortricid species was assessed using PCR by amplifying a Hm‐oscar gene with the following primers: WHMT_00358_f (5′‐ATGATTGAAGATAGAAATGTTCCTTTATCC‐3′) and WHMT_00358_r (5′‐CTACCTACCGCCTTTACCTTTGCTA‐3′) with the Emerald Amp Max Master Mix (TaKaRa) at 94°C for 3 min, 35 cycles of 94°C for 30 s, 62°C for 30 s, 72°C for 3 min and final extension at 72°C for 7 min.

PCR products were purified using the Qiaquick PCR purification kit (Qiagen, Hilden, Germany) and sequenced as described by Arai et al. (2019). Purified wsp amplicons of Wolbachia in Homona species were ligated with the pGEM‐T easy vector (Promega, Madison, WI, USA) and transfected into JM109 competent cells. Plasmid DNAs extracted from eight JM109 clones using the Pure Yield Plasmid Miniprep System (Promega, Madison, WI, USA) were sequenced as described by Arai et al. (2019).

Constructions of the mitochondrial genome of H. magnanima

The mitochondrial genome of a tortricid, Choristoneura fumiferana (accession number: NC_037395.1), retrieved from the NCBI database, was used as a reference to identify mitochondrial reads from sequence reads of H. magnanima (DRA013595, BioProject: PRJDB13119) using BLASTn search. A complete mitochondrial genome was constructed through contig alignments and read mappings using minimap2 (Li, 2018), followed by manual cyclisation. Resequencing data of H. magnanima obtained from Japanese and Taiwanese populations (DRA013650, BioProject: PRJDB13119) were mapped to the mitochondrial genome of H. magnanima using minimap2, and consensus sequences were obtained using SAMtools (Li et al., 2009).

Phylogenetic analysis

Newly sequenced wsp fragments (Wolbachia) and mitochondrial genomes (H. magnanima) and COI fragments (tortricids) were aligned using ClustalW (Thompson et al., 1994). Wolbachia wsp sequences of Baldo et al. (2006) were retrieved to construct a Wolbachia phylogenetic tree. For phylogenetic analysis, the maximum likelihood method with bootstrap re‐sampling of 1000 replications was performed in MEGA 7 (Kumar et al., 2016). Haplotype network analysis was conducted on mitochondrial COI sequences of H. magnanima using DnaSP6 (Rozas et al., 2017) and Network (Bandelt et al., 1999).

Statistical analysis

To examine whether Wolbachia infections correlate with host sex, GLMM was performed using the lme4 package (Bates et al., 2015) in R 4.0.0, assuming binomial error based on the presence/absence of the respective endosymbionts within an individual H. magnanima as shown by Takamatsu et al. (2021). In statistical modelling, we considered the infection status (i.e., Wolbachia presence or absence) as a fixed factor. Based on the GLMM, an analysis of variance (ANOVA) was conducted to evaluate the significance of the individual model terms.

RESULTS

Asian tortricids generally harboured wHm‐a, wHm‐b and wHm‐c relatives but lacked a female‐biased sex ratio

We collected more than 1300 tortricid samples, which were classified based on morphological characters described by Kishida (2011) and mitochondrial COI sequences, if available, in the BOLD database. In addition to H. magnanima (991 individuals), 61 tortricid species (357 individuals) were identified, although we were not able to clarify the species' name in some samples (e.g., Archips sp. 1, Table S1). Among them, 58 species were positive for Wolbachia (with 50–100% frequency, Table S1). Of these, 48, 45 and 54 were positive for wHm‐a, wHm‐b and wHm‐c, respectively (Table S1). Similar to H. magnanima (Takamatsu et al., 2021), triple infections predominated (33 species), followed by dual infections with wHm‐a and wHm‐c (16 species), wHm‐a and wHm‐b (4 species) and wHm‐b and wHm‐c (8 species). Although no apparent topological concordance was observed between the Wolbachia wsp phylogeny and the tortricid COI phylogeny, many of the Wolbachia strains in tortricids shared highly homologous wsp sequences with those of either wHm‐a, wHm‐b or wHm‐c in H. magnanima (Figure 1). The genus Homona typically harboured wHm‐c but frequently lost wHm‐a and wHm‐b strains (Table S1; Figure 1). Homona coffearia and Homona issikii were co‐infected with wHm‐c and other Wolbachia strains that were not identified from H. magnanima. Notably, males of 44 tortricid species harboured wHm‐c (Table S1), and nine tortricid species harbouring wHm‐c type Wolbachia did not exhibit a female‐biased sex ratio (Figure 2). To clarify whether the tortricid species harbour wHm‐t, we detected the Hm‐oscar gene in the MK‐associated prophage WOwHm‐t76 region that is present in wHm‐t but absent in wHm‐c (Arai et al., 2023). Apart from the Taiwanese H. magnanima, no tortricid was positive for the Hm‐oscar gene (Table S1).

FIGURE 1.

FIGURE 1

Open in a new tab

Phylogeny of Wolbachia strains identified from tortricids. The wsp sequences of Wolbachia strains in tortricids were aligned with those of other Wolbachia strains reported by Baldo et al. (2006). The mitochondrial COI sequences of tortricids were also shown. The phylogenetic tree was constructed using the maximum likelihood method based on the Tamura–Nei model with 1000 bootstrap replicates.

FIGURE 2.

FIGURE 2

Open in a new tab

Sex ratios of tortricid species harbouring Wolbachia strains. Wolbachia infections are shown as A (wHm‐a), B (wHm‐b), C (wHm‐c), and T (wHm‐t). The sex ratio of each tortricid species is shown with red (female) and blue (male) bars. The numbers of female and male individuals are indicated within parentheses.

Distinct Wolbachia infection status among populations and between H. magnanima sexes

Taiwanese H. magnanima harboured only the wHm‐c relatives (i.e., wHm‐t), whereas most Japanese populations harboured wHm‐a, wHm‐b and wHm‐c (Figure 3, Table S1). Strikingly, Japanese H. magnanima males and females showed distinct infection patterns for wHm‐a (generalised linear mixed model [GLMM], p < 0.001) and wHm‐b (p < 0.001) but not wHm‐c (p = 0.44), wherein wHm‐a, wHm‐b and wHm‐c were 40.3%, 16.0% and 87.5% for males (n = 424; Figure 3A), and 76.7%, 91.9% and 85.4% for females, respectively (n = 459; Figure 3B). Triple infection was predominant in females (n = 290, 63.2% of the total individuals), whereas wHm‐c single infection was predominant in males (218, 51.1%).

FIGURE 3.

FIGURE 3

Open in a new tab

Distributions and infection status of Wolbachia strains in Japanese and Taiwanese H. magnanima. Pie charts of Wolbachia prevalence in males (A) and females (B). Taiwanese wHm‐t strain is shown as a wHm‐c type strain. ABC: wHm‐a, wHm‐b, and wHm‐c triple infection; AB: wHm‐a and wHm‐b dual infection; BC: wHm‐b and wHm‐c dual infection; CA: wHm‐a and wHm‐c dual infection; A: wHm‐a single infection; B: wHm‐b single infection; C: wHm‐c single infection; ND: not detected. Wolbachia prevalence data in Shimada and Taiwan were obtained from Takamatsu et al. (2021) and Arai et al. (2020), respectively.

Taiwanese and Japanese H. magnanima harboured distinct mitochondrial haplotypes

Among 130 wild‐caught individuals of H. magnanima, the mitochondrial COI (599 bp) was polymorphic at six nucleotide sites, forming six haplotypes (Figure 4A). Taiwanese H. magnanima (n = 30) and a male individual collected from Yonaguni Island, which is closer to Taiwan (111 km away) than to Okinawa Island (509 km away), had the haplotype T. Of the remaining five haplotypes, haplotype J1 (n = 71) dominated most of the Japanese regions (mainland to Okinawa Island). Both haplotypes J1 and J2 were identified in the Tokyo and Shizuoka populations. Minor mitochondrial haplotypes (J3 to J5) were identified in Toyama (haplotype J3, n = 3) and Tanegashima (haplotype J4, n = 1; haplotype J5, n = 1). Furthermore, phylogenetic analysis using de novo assembled H. magnanima mitochondrial genomes (16,529 bp in length) confirmed more apparent divergent patterns among populations, divided into two distinct clades (Figure 4B). In addition, MK matrilines (n = 12) and non‐MK matrilines (n = 9) established from a Taiwanese H. magnanima population showed no apparent genetic divergence in mitochondrial sequences (Figure 4B).

FIGURE 4.

FIGURE 4

Open in a new tab

The mitochondrial haplotypes of Homona magnanima. (A) Distributions of the six H. magnanima mitochondrial COI haplotypes. Navy: haplotype J1; blue: haplotype J2; Navy with dots: haplotype J3; Navy with the horizontal line: haplotype J4; Navy with the diagonal line: haplotype J5; Red: haplotype T. Numbers of individuals are shown in parentheses. The H. magnanima COI haplotype network is highlighted by broken lines. (B) Haplotype network and phylogeny of H. magnanima mitochondria genome (16,529 bp). Red circle: Taiwanese individuals; blue circle: Japanese individuals; red letter: MK line; blue letter: non‐MK line or male individual. The numbers of Mutated positions are shown as black bars. A phylogenetic tree was constructed using the maximum likelihood method (based on the Hasegawa–Kishino–Yano model) with 1000 bootstrap replicates. A: wHm‐a, B: wHm‐b, C: wHm‐c; T: wHm‐t; ND: undetected.

DISCUSSION

Evolutionary processes by which Wolbachia achieved MK in H. magnanima

Here we showed that Wolbachia relatives of wHm‐a, wHm‐b and wHm‐c were conserved among Asian tortricids, suggesting that these strains descended from a common tortricid ancestor. We also confirmed that wHm‐c relatives in tortricid species were negative for the wHm‐t‐specific prophage gene and did not induce MK. Apart from H. magnanima, MK in tortricids has only been reported in a severe pear pest Epiphyas postvittana, which is distributed in Australasia (Geier et al., 1978, Figure 5A). Although MK factors in E. postvittana are currently unknown, the different distributions of H. magnanima (East Asia) and E. postvittana (Australia) suggest that they have acquired MK independently. In H. magnanima, Japanese and Taiwanese populations had different mitochondrial genotypes. Furthermore, there was no genetic divergence between the MK and non‐MK Taiwanese host lines. These results suggest that the MK trait of wHm‐t has emerged relatively recently, at least after the Taiwanese H. magnanima had diverged from the Japanese populations. The triply infected H. magnanima (ancestor of the Taiwanese population) had probably lost wHm‐a and wHm‐b, as is frequently observed in other species of the genus Homona. Thereafter, we suspect that the ancestral wHm‐c type Wolbachia in H. magnanima acquired an MK ability (i.e., the MK‐associated prophage region WOwHm‐t76; Arai et al., 2023) through a bacteriophage integration, giving rise to the MK‐inducing wHm‐t (Figure 5B).

FIGURE 5.

FIGURE 5

Open in a new tab

Distribution and male killing (MK) acquisition scenarios of Wolbachia in Tortricidae. (A) Overview of Wolbachia infections, distributions, and MK in the Homona species examined in this study. The Wallace line (broken grey line) is a border of organisms between Asian and Australian regions. (B) Evolutionary scenarios of the MK wHm‐t. While Wolbachia strains have descended from the ancestral host, wHm‐t has evolved from wHm‐c through phage infection in H. magnanima. Cytoplasmic incompatibility (CI) may have limited the distribution of wHm‐t infected hosts, as crosses between wHm‐t infected females (shown as T) and triply‐infected males (shown as ABC) are lethal. JPN: Japan; VNM: Vietnam; IDN: Indonesia; TWN: Taiwan. (C) A putative evolutionary process of the Japanese and Taiwanese H. magnanima. Ancient H. magnanima diverged in mainland China, and triple‐infected H. magnanima that entered the Japanese archipelago via the Korea–Tsushima route (shown as orange arrows) formed the Japanese population. H. magnanima infected with wHm‐t was not expelled in Taiwan (Taoyuan).

Sex‐linked infection patterns of non‐MK Wolbachia in H. magnanima

We found that wHm‐a and wHm‐b show distinct infection patterns between male and female H. magnanima. Both strains possess the CI causative genes cifA and cifB (Arai et al., 2023), although wHm‐a does not currently induce CI in contrast to wHm‐b (Arai et al., 2019). Similar differences in Wolbachia infection patterns between the sexes have been reported in several insects, such as Diptera (Drosophila pseudotakahashii and Aedes albopictus), Coleoptera (Polygraphus proximus) and Siphonaptera (Synosternus cleopatrae) (Bykov et al., 2020; Cohen et al., 2015; Dobson et al., 2002; Dutton & Sinkins, 2004; Flatau et al., 2018; Richardson et al., 2019; Xi et al., 2005; Xi et al., 2006). For example, females of A. albopictus carry CI‐inducing Wolbachia strains wAlbA and wAlbB, but males often lack wAlbA or carry it at very low densities (Dobson et al., 2002; Dutton & Sinkins, 2004; Xi et al., 2005; Xi et al., 2006). Although the evolutionary history of the distinct Wolbachia infection patterns between males and females remains unknown, it may reflect a host response to Wolbachia‐induced reproductive manipulations such as CI. CI‐inducing Wolbachia causes lethality in offspring when infected males mate with uninfected females (Werren et al., 2008). Furthermore, as observed in the A. albopictus‐Wolbachia (wAlbA, wAlbB and wMel) system, multiple infections of CI‐inducing Wolbachia can reduce host fitness by leading to self‐incompatibility (Ant & Sinkins, 2018). Theory suggests that mutation(s) can evolve to suppress the proliferation and/or functions of CI‐inducing Wolbachia (Koehncke et al., 2009). If CI‐inducing Wolbachia cannot be eliminated from the host, low frequencies of CI‐inducing Wolbachia in males and high frequencies in females are assumed to be adaptive for host insects to produce viable offspring. We speculate that H. magnanima has developed mechanisms to control CI‐inducing Wolbachia strains through evolutionary processes. Although the underlying mechanisms are unknown, we hypothesise that differences in the male and female environments (e.g., metabolites and/or tissues) regulate Wolbachia–Wolbachia interactions and their proliferation, resulting in distinct infection patterns between the sexes.

Alternatively, this phenomenon may be a strategy of Wolbachia rather than the host. It is possible that Wolbachia adopted a strategy of allocating resources to females rather than males. In D. pseudotakahashii, Wolbachia expresses strong CI (a long‐lasting sperm modification effect) at extremely low titers in adult males (Richardson et al., 2019). The different infection patterns of Wolbachia between the sexes may be an evolutionarily acquired strategy of Wolbachia—low levels of Wolbachia being allocated to males only to induce CI, while high levels of Wolbachia to females to secure a stable infection. In H. magnanima, wHm‐a and wHm‐b may have systems to transmit to female siblings rather than males by recognising female‐specific features such as the W chromosome. Further investigation is warranted to elucidate the underlying mechanisms and whether this phenomenon occurs in other host Wolbachia systems.

Formation of the current distribution of Wolbachia and H. magnanima

Wolbachia impacts genetic differentiation and distribution in insects (Kondo et al., 2005; Narita et al., 2007; Miyata et al., 2017; Miyata et al., 2020; Rokas, 2000; Turelli & Hoffmann, 1991). It is known that CI traits have led to the rapid spread of Wolbachia in Drosophila simulans, reducing the diversity of mitochondrial haplotypes in infected populations (Hale & Hoffmann, 1990; Ballad et al., 1996). In this study, we showed that a mitochondrial COI haplotype and three Wolbachia strains (wHm‐a, wHm‐b and wHm‐c) were highly conserved among Japanese H. magnanima. We speculate that the CI‐inducing wHm‐b led to the spread of the triply infected H. magnanima and its mitochondria haplotype across Japan, followed by the emergence of the minor haplotypes in Japanese H. magnanima. In contrast to most Japanese populations, Taiwanese H. magnanima does not harbour wHm‐a or wHm‐b and has a homogeneous mitochondrial sequence. Notably, a Wolbachia‐free male collected from Yonaguni Island had the Taiwanese mitochondrial haplotype. These findings suggest that the Taiwan–Yonaguni and mainland–Okinawa Island populations of H. magnanima have different origins and have been isolated over a long period. We speculate that the triply infected H. magnanima spread from mainland Japan across the Tokara Strait—a geographical boundary located between Yakushima Island and Amami‐Oshima Island (Tojo et al., 2017)—to Okinawa Island. The Kerama Strait (Hachisuka Line, Figure 5C) has probably served as the geographical boundary between the H. magnanima populations of Taiwan–Yonaguni and mainland–Okinawa Island. Given that wHm‐t does not confer any fitness advantages to H. magnanima (Arai et al., 2020), the wHm‐t infected host struggles to coexist with the triply infected host that retains the fitness advantages of wHm‐c and the CI traits of wHm‐b (Arai et al., 2019). Therefore, wHm‐t infected hosts are likely to be eliminated by competition from triply infected hosts when they coexist in the same population. We propose that the triple infection of wHm‐a, wHm‐b and wHm‐c have determined the limited distribution of the MK strain wHm‐t.

CONCLUSIONS

Our study demonstrated that Wolbachia relatives of wHm‐a, wHm‐b and wHm‐c are widely conserved among Asian tortricids but do not induce MK in their hosts. Furthermore, Japanese and Taiwanese H. magnanima exhibit genetic divergence and distinct Wolbachia infection patterns. These results suggest that the Wolbachia strains are derived from a common ancestor, whereas the MK wHm‐t has evolved from a non‐MK wHm‐c strain in the ancestral Taiwanese H. magnanima that lacked wHm‐a and wHm‐b infections. This work is relevant in that we presented the evolutionary process of Wolbachia by examining 62 tortricid species collected from 39 localities across East and Southeast Asia. However, we must note that the phylogeny and infection dynamics of Wolbachia may be more complicated because the genus Tortricidae is a large taxon with more than 10,000 species in diverse environments around the world (http://www.tortricidae.com/catalogue.asp). Further studies on Wolbachia in tortrix moths and other insects should clarify the dynamics of the acquisition process of the MK phenotype.

AUTHOR CONTRIBUTIONS

Hiroshi Arai: Conceptualization (lead); data curation (lead); formal analysis (lead); funding acquisition (equal); investigation (lead); methodology (lead); project administration (equal); resources (equal); supervision (equal); validation (equal); visualization (equal); writing – original draft (equal); writing – review and editing (equal). Masatoshi Ueda: Data curation (supporting); investigation (supporting); methodology (supporting); resources (supporting); validation (supporting); writing – review and editing (supporting). Tatsuya Hirano: Investigation (supporting); methodology (supporting); resources (supporting); writing – review and editing (supporting). Naoya Akizuki: Investigation (supporting); writing – review and editing (supporting). Shiou‐Ruei Lin: Conceptualization (supporting); investigation (equal); project administration (supporting); resources (equal); supervision (supporting); validation (supporting); writing – original draft (supporting); writing – review and editing (equal). Duong Kieu Hanh: Investigation (supporting); methodology (supporting); project administration (supporting); resources (supporting); writing – review and editing (supporting). Jaka Widada: Investigation (supporting); project administration (supporting); supervision (supporting); writing – review and editing (supporting). Muhammad Saifur Rohman: Investigation (supporting); methodology (supporting); project administration (supporting); supervision (supporting); writing – review and editing (supporting). Madoka Nakai: Funding acquisition (supporting); investigation (supporting); writing – review and editing (supporting). Yasuhisa Kunimi: Conceptualization (supporting); data curation (supporting); investigation (supporting); project administration (supporting); resources (supporting); supervision (supporting); validation (supporting); writing – review and editing (supporting). Le Van Vang: Conceptualization (equal); investigation (supporting); project administration (supporting); resources (equal); supervision (equal); writing – review and editing (supporting). Arman Wijonarko: Conceptualization (supporting); funding acquisition (supporting); investigation (supporting); methodology (supporting); project administration (supporting); resources (equal); supervision (equal); writing – review and editing (equal). Maki Inoue: Conceptualization (equal); funding acquisition (equal); project administration (lead); supervision (lead); writing – review and editing (equal).

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflicts of interest.

Supporting information

TABLE S1: Wolbachia infection status of the field‐collected tortricids.

Click here for additional data file. (21.8KB, xlsx)

ACKNOWLEDGEMENTS

We thank PT Pagilaran (Yogyakarta, Indonesia) for insect collections in Indonesia. We also thank Masashi Nomura (Chiba University), Mai N. Miyata (Fukui University) and Shunsuke Kakinuma (Tokyo University of Agriculture and Technologies) for their assistance with field samplings in Japan. The authors wish to acknowledge support from the Japan Society for the Promotion of Science (JSPS) Research Fellowships for Young Scientists [Grant Number 19J13123 and 21J00895], JSPS Fund for the Promotion of Joint International Research (Fostering Joint International Research (B)) [Grant Number 21KK0105], and the JSPS Overseas Challenge Program for Young Researchers (2019) with RISTEK Foreign Research Permit [1539057329].

Arai, H. , Ueda, M. , Hirano, T. , Akizuki, N. , Lin, S.‐R. , Hanh, D.K. et al. (2024) Conserved infections and reproductive phenotypes of Wolbachia symbionts in Asian tortrix moths. Environmental Microbiology Reports, 16(1), e13219. Available from: 10.1111/1758-2229.13219

Contributor Information

Hiroshi Arai, Email: dazai39papilio@gmail.com.

Maki N. Inoue, Email: makimaki@cc.tuat.ac.jp.

DATA AVAILABILITY STATEMENT

The sequence data were deposited in GenBank under accession numbers LC741220 to LC741253 and LC741449. The Homona magnanima were collected from Tea Research and Extension Station (Taoyuan City, Taiwan) and were imported with permission from the Ministry of Agriculture, Forestry and Fisheries (No. 27—Yokohama Shokubou 891 and No. 297—Yokohama Shokubou 1326). A research collaboration was developed with scientists from the countries providing genetic samples; all collaborators are included as co‐authors, and the research results have been shared with the provider communities and the broader scientific community. Our group is committed to international scientific partnerships and institutional capacity building.

REFERENCES

  1. Ant, T.H. & Sinkins, S.P. (2018) A Wolbachia triple‐strain infection generates self‐incompatibility in Aedes albopictus and transmission instability in Aedes aegypti . Parasites & Vectors, 11, 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arai, H. , Anbutsu, H. , Nishikawa, Y. , Kogawa, M. , Ishii, K. , Hosokawa, M. et al. (2023) Combined actions of bacteriophage‐encoded genes in Wolbachia‐induced male lethality. Iscience, 26, 106842. Available from: 10.1016/j.isci.2023.106842 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arai, H. , Hirano, T. , Akizuki, N. , Abe, A. , Nakai, M. , Kunimi, Y. et al. (2019) Multiple infection and reproductive manipulations of Wolbachia in Homona magnanima (Lepidoptera: Tortricidae). Microbial Ecology, 77, 257–266. [DOI] [PubMed] [Google Scholar]
  4. Arai, H. , Lin, S.R. , Nakai, M. , Kunimi, Y. & Inoue, M.N. (2020) Closely related male‐killing and nonmale‐killing Wolbachia strains in the oriental tea tortrix Homona magnanima . Microbial Ecology, 79, 1011–1020. [DOI] [PubMed] [Google Scholar]
  5. Baldo, L. , Bordenstein, S. , Wernegreen, J.J. & Werren, J.H. (2006) Widespread recombination throughout Wolbachia genomes. Molecular Biology and Evolution, 23, 437–449. [DOI] [PubMed] [Google Scholar]
  6. Ballad, J.W. , Hatzidakis, J. , Karr, T.L. & Kreitman, M. (1996) Reduced variation in Drosophila simulans mitochondrial DNA. Genetics, 144, 1519–1528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bandelt, H.J. , Forster, P. & Röhl, A. (1999) Median‐joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution, 16, 37–48. [DOI] [PubMed] [Google Scholar]
  8. Bates, D. , Mächler, M. , Bolker, B. & Walker, S. (2015) Fitting linear mixed‐effects models using lme4. Journal of Statistical Software, 67, 1–48. [Google Scholar]
  9. Bleidorn, C. & Gerth, M. (2018) A critical re‐evaluation of multilocus sequence typing (MLST) efforts in Wolbachia . FEMS Microbiology Ecology, 94, fix163. Available from: 10.1093/femsec/fix163 [DOI] [PubMed] [Google Scholar]
  10. Bykov, R. , Kerchev, I. , Demenkova, M. , Ryabinin, A. & Ilinsky, Y. (2020) Sex‐specific Wolbachia infection patterns in populations of Polygraphus proximus Blandford (Coleoptera; Curculionidae: Scolytinae). Insects, 11, 547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Charlat, S. , Hornett, E.A. , Fullard, J.H. , Davies, N. , Roderick, G.K. , Wedell, N. et al. (2007) Extraordinary flux in sex ratio. Science, 317, 214. [DOI] [PubMed] [Google Scholar]
  12. Charlat, S. , Hurst, G.D.D. & Merçot, H. (2003) Evolutionary consequences of Wolbachia infections. Trends in Genetics, 19, 217–223. [DOI] [PubMed] [Google Scholar]
  13. Cohen, C. , Toh, E. , Munro, D. , Dong, Q.F. & Hawlena, H. (2015) Similarities and seasonal variations in bacterial communities from the blood of rodents and from their flea vectors. The ISME Journal, 9, 1662–1676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dobson, S.L. , Marsland, E.J. & Rattanadechakul, W. (2002) Mutualistic Wolbachia infection in Aedes albopictus: accelerating cytoplasmic drive. Genetics, 160, 1087–1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Duron, O. , Bouchon, D. , Boutin, S. , Bellamy, L. , Zhou, L. , Engelstädter, J. et al. (2008) The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biology, 6, 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dutton, T.J. & Sinkins, S.P. (2004) Strain‐specific quantification of Wolbachia density in Aedes albopictus and effects of larval rearing conditions. Insect Molecular Biology, 13, 317–322. [DOI] [PubMed] [Google Scholar]
  17. Flatau, R. , Segoli, M. , Khokhlova, I. & Hawlena, H. (2018) Wolbachia's role in mediating its flea's reproductive success differs according to flea origin. FEMS Microbiology Ecology, 94, fiy157. [DOI] [PubMed] [Google Scholar]
  18. Geier, P.W. , Briese, D.T. & Lewis, T. (1978) The light‐brown apple moth, Epiphyas postvittana (Walker) 2. Uneven sex ratios and a condition contributing to them in the field. Australian Journal of Ecology, 3, 467–488. [Google Scholar]
  19. Hajibabaei, M. , Smith, M.A. , Janzen, D.H. , Rodriguez, J.J. , Whitfield, J.B. & Hebert, P.D.N. (2006) A minimalist barcode can identify a specimen whose DNA is degraded. Molecular Ecology Notes, 6, 959–964. [Google Scholar]
  20. Hale, L.R. & Hoffmann, A.A. (1990) Mitochondrial DNA polymorphism and cytoplasmic incompatibility in natural populations of Drosophila simulans . Evolution, 44, 1383–1386. [DOI] [PubMed] [Google Scholar]
  21. Jiggins, F.M. (2003) Male‐killing Wolbachia and mitochondrial DNA: selective sweeps, hybrid introgression and parasite population dynamics. Genetics, 164, 5–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kageyama, D. , Nishimura, G. , Ohno, S. , Takanashi, T. , Hoshizaki, S. & Ishikawa, Y. (2004) Wolbachia infection and an all‐female trait in Ostrinia orientalis and Ostrinia zaguliaevi . Entomologia Experimentalis et Applicata, 111, 79–83. [Google Scholar]
  23. Kishida, Y. (2011) Tortricidae. In: Kishida, Y. (Ed.) The standard of moths in Japan 1. Tokyo, Japan: Gakken Education Publishing. [Google Scholar]
  24. Koehncke, A. , Telschow, A. , Werren, J.H. & Hammerstein, P. (2009) Life and death of an influential passenger: Wolbachia and the evolution of CI‐modifiers by their hosts. PLoS One, 4, e4425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kondo, N. , Shimada, M. & Fukatsu, T. (2005) Infection density of Wolbachia endosymbiont affected by co‐infection and host genotype. Biology Letters, 1, 488–491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kumar, S. , Stecher, G. & Tamura, K. (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33, 1870–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li, H. (2018) Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics, 34, 3094–3100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Li, H. , Handsaker, B. , Wysoker, A. , Fennell, T. , Ruan, J. , Homer, N. et al. (2009) The sequence alignment/map format and SAMtools. Bioinformatics, 25, 2078–2079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Metcalf, J.A. , Jo, M. , Bordenstein, S.R. , Jaenike, J. & Bordenstein, S.R. (2014) Recent genome reduction of Wolbachia in Drosophila recens targets phage WO and narrows candidates for reproductive parasitism. PeerJ, 2, e529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Miyata, M. , Konagaya, T. , Yukuhiro, K. , Nomura, M. & Kageyama, D. (2017) Wolbachia‐induced meiotic drive and feminization is associated with an independent occurrence of selective mitochondrial sweep in a butterfly. Biology Letters, 13, 20170153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Miyata, M.N. , Nomura, M. & Kageyama, D. (2020) Wolbachia have made it twice: hybrid introgression between two sister species of Eurema butterflies. Ecology and Evolution, 10, 8323–8330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Muro, T. , Hikida, H. , Fujii, T. , Kiuchi, T. & Katsuma, S. (2023) Two complete genomes of male‐killing Wolbachia infecting Ostrinia moth species illuminate their evolutionary dynamics and association with hosts. Microbial Ecology, 86, 1740–1754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Narita, S. , Nomura, M. , Kato, Y. , Yata, O. & Kageyama, D. (2007) Molecular phylogeography of two sibling species of Eurema butterflies. Genetica, 131, 241–253. [DOI] [PubMed] [Google Scholar]
  34. Rasgon, J.L. , Gamston, C.E. & Ren, X. (2006) Survival of Wolbachia pipientis in cell‐free medium. Applied and Environmental Microbiology, 72, 6934–6937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Richardson, K.M. , Griffin, P.C. , Lee, S.F. , Ross, P.A. , Endersby‐Harshman, N.M. , Schiffer, M. et al. (2019) A Wolbachia infection from Drosophila that causes cytoplasmic incompatibility despite low prevalence and densities in males. Heredity, 122, 428–440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rokas, I. (2000) Wolbachia as a speciation agent. Trends in Ecology & Evolution, 15, 44–45. [DOI] [PubMed] [Google Scholar]
  37. Rozas, J. , Ferrer‐Mata, A. , Sánchez‐DelBarrio, J.C. , Guirao‐Rico, S. , Librado, P. , Ramos‐Onsins, S.E. et al. (2017) DnaSP 6: DNA sequence polymorphism analysis of large data sets. Molecular Biology and Evolution, 34, 3299–3302. [DOI] [PubMed] [Google Scholar]
  38. Stouthamer, R. , Breeuwer, J.A. & Hurst, G.D.D. (1999) Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annual Review of Microbiology, 53, 71–102. [DOI] [PubMed] [Google Scholar]
  39. Takamatsu, T. , Arai, H. , Abe, N. , Nakai, M. , Kunimi, Y. & Inoue, M.N. (2021) Coexistence of two male‐killers and their impact on the development of oriental tea tortrix Homona magnanima . Microbial Ecology, 81, 193–202. [DOI] [PubMed] [Google Scholar]
  40. Thompson, J.D. , Higgins, D.G. & Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tojo, K. , Sekiné, K. , Takenaka, M. , Isaka, Y. , Komaki, S. , Suzuki, T. et al. (2017) Species diversity of insects in Japan: their origins and diversification processes. Entomological Science, 20, 357–381. [Google Scholar]
  42. Turelli, M. & Hoffmann, A.A. (1991) Rapid spread of an inherited incompatibility factor in California Drosophila . Nature, 353, 440–442. [DOI] [PubMed] [Google Scholar]
  43. Ueda, M. , Arai, H. , Masaike, K. , Nakai, M. & Inoue, M.N. (2023) Distinct effects of three Wolbachia strains on fitness and immune traits in Homona magnanima . Heredity, 130, 22–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Vavre, F. , Fleury, F. , Lepetit, D. , Fouillet, P. & Boulétreau, M. (1999) Phylogenetic evidence for horizontal transmission of Wolbachia in host‐parasitoid associations. Molecular Biology and Evolution, 16, 1711–1723. [DOI] [PubMed] [Google Scholar]
  45. Watanabe, M. , Miura, K. , Hunter, M.S. & Wajnberg, E. (2011) Superinfection of cytoplasmic incompatibility‐inducing Wolbachia is not additive in Orius strigicollis (Hemiptera: Anthocoridae). Heredity, 106, 642–648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Watanabe, M. , Tagami, Y. , Miura, K. , Kageyama, D. & Stouthamer, R. (2012) Distribution patterns of Wolbachia endosymbionts in the closely related flower bugs of the genus Orius: implications for coevolution and horizontal transfer. Microbial Ecology, 64, 537–545. [DOI] [PubMed] [Google Scholar]
  47. Werren, J.H. , Baldo, L. & Clark, M.E. (2008) Wolbachia: master manipulators of invertebrate biology. Nature Reviews. Microbiology, 6, 741–751. [DOI] [PubMed] [Google Scholar]
  48. Xi, Z. , Dean, J.L. , Khoo, C. & Dobson, S.L. (2005) Generation of a novel Wolbachia infection in Aedes albopictus (Asian tiger mosquito) via embryonic microinjection. Insect Biochemistry and Molecular Biology, 35, 903–910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Xi, Z. , Khoo, C.C. & Dobson, S.L. (2006) Interspecific transfer of Wolbachia into the mosquito disease vector Aedes albopictus . Proceedings of the Royal Society B, 273, 1317–1322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhou, W. , Rousset, F. & O'Neill, S. (1998) Phylogeny and PCR–based classification of Wolbachia strains using wsp gene sequences. Proceedings of the Royal Society B, 265, 509–515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zug, R. & Hammerstein, P. (2012) Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One, 7, e38544. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

TABLE S1: Wolbachia infection status of the field‐collected tortricids.

Click here for additional data file. (21.8KB, xlsx)

Data Availability Statement

The sequence data were deposited in GenBank under accession numbers LC741220 to LC741253 and LC741449. The Homona magnanima were collected from Tea Research and Extension Station (Taoyuan City, Taiwan) and were imported with permission from the Ministry of Agriculture, Forestry and Fisheries (No. 27—Yokohama Shokubou 891 and No. 297—Yokohama Shokubou 1326). A research collaboration was developed with scientists from the countries providing genetic samples; all collaborators are included as co‐authors, and the research results have been shared with the provider communities and the broader scientific community. Our group is committed to international scientific partnerships and institutional capacity building.

Articles from Environmental Microbiology Reports are provided here courtesy of Wiley

RESOURCES