Pioneer and PRDM transcription factors coordinate bivalent epigenetic states to safeguard cell fate

Satoshi Matsui; Marissa Granitto; Morgan Buckley; Katie Ludwig; Sandra Koigi; Joseph Shiley; William J Zacharias; Christopher N Mayhew; Hee-Woong Lim; Makiko Iwafuchi

doi:10.1016/j.molcel.2023.12.007

. Author manuscript; available in PMC: 2025 Feb 1.

Published in final edited form as: Mol Cell. 2024 Jan 10;84(3):476–489.e10. doi: 10.1016/j.molcel.2023.12.007

Pioneer and PRDM transcription factors coordinate bivalent epigenetic states to safeguard cell fate

Satoshi Matsui ¹, Marissa Granitto ¹, Morgan Buckley ¹, Katie Ludwig ¹, Sandra Koigi ¹, Joseph Shiley ¹, William J Zacharias ³, Christopher N Mayhew ¹, Hee-Woong Lim ^2,^*, Makiko Iwafuchi ^1,^4,^*

PMCID: PMC10872272 NIHMSID: NIHMS1953637 PMID: 38211589

SUMMARY

Pioneer transcription factors (TFs) regulate cell fate by establishing transcriptionally primed and active states. However, cell fate control requires the coordination of both lineage-specific gene activation and repression of alternative lineage programs, a process that is poorly understood. Here, we demonstrate that the pioneer TF FOXA coordinates with PRDM1 TF to recruit Nucleosome Remodeling and Deacetylation (NuRD) complexes and Polycomb Repressive Complexes (PRC), which establish highly occupied, accessible nucleosome conformation with bivalent epigenetic states, thereby prevent precocious and alternative-lineage gene expression during human endoderm differentiation. Similarly, the pioneer TF OCT4 coordinates with PRDM14 to form bivalent enhancers and repress cell differentiation programs in human pluripotent stem cells, suggesting that this may be a common and critical function of pioneer TFs. We propose that pioneer and PRDM TFs coordinate to safeguard cell fate through epigenetic repression mechanisms.

eTOC Blurb

Matsui et al. revealed pioneer transcription factor FOXA and OCT4’s unexpected role in repressing precocious gene expression and alternative-lineage programs, thereby safeguarding cell fate. The mechanism involves cooperation between pioneer transcription factors and PRDM transcription factors to recruit repressive epigenetic complexes and establish bivalent chromatin domains.

Graphical Abstract:

graphic file with name nihms-1953637-f0001.jpg

INTRODUCTION

Pioneer transcription factors (TFs) possess unique abilities to bind their target sites on closed chromatin, locally open chromatin, and facilitate the recruitment of other TFs and chromatin modifiers¹. Pioneer TFs play a crucial role in initiating gene regulatory programs and establishing developmental competence to appropriately differentiate into specific developmental lineages¹. For instance, during endoderm differentiation, the archetypical pioneer TF FOXA opens chromatin locally and recruits a Trithorax complex to deposit H3K4me1 active marks at endoderm-specific enhancers, thereby priming transcription of endoderm genes^2–5. Furthermore, the coordinated pioneering activities of Oct4, Sox2, and Klf4, along with c-Myc, enable reprogramming of somatic cells into pluripotent stem cells^6,7, revolutionizing developmental and regenerative biology research. Similarly, the pioneering activities of FOXA, together with HNF1A and HNF4A, can transdifferentiate fibroblasts and peripheral blood into hepatocyte-like cells^8,9. However, a major challenge lies in achieving sufficient transcriptional repression of the original cell type, as inadequate repression often leads to the formation of “dead-end” cells or hybrid cells^10,11, thus limiting translational applications. While substantial progress has been made in understanding the mechanisms underlying lineage-specific gene activation, the mechanisms of repression remain less explored. Therefore, it is crucial to understand how alternative lineage programs are normally repressed during development.

Cell differentiation is influenced by the epigenetic landscape, wherein histone post-translational modifications can facilitate or restrict transcription. Polycomb repressive complex 1 (PRC1) and PRC2 establish repressive chromatin domains by ubiquitinylating K119 on histone H2A (H2AK119ub1) and methylating K27 on histone H3 (H3K27me3), respectively, to help prevent ectopic gene expression^12–15. Polycomb chromatin domains exist in a bivalent epigenetic state, with active Trithorax histone modifications (H3K4me1/2/3) forming a transcriptionally poised state that is primed for lineage-specific transcription but remain silenced until activated by appropriate signals^16–20. It has been suggested that the poised state is particularly important for dynamic developmental gene regulation, where activation and repression alternate within a short time window²¹. How bivalent epigenetic domains are established during cell differentiation remains a central, unresolved, question.

To address the interplay between pioneer TFs and epigenetic regulatory mechanisms during cell differentiation, we investigated the role of FOXA in human endoderm differentiation and of OCT4 (encoded by POU5F1) in pluripotent stem cells. In our new CRISPR interference model, which targeted the three redundant FOXA genes, we observed not only the anticipated loss of endoderm gene expression but also the de-repression and ectopic expression of genes typically expressed in alternative lineages or during later stages of endoderm differentiation. Through proteomics and cistrome analyses, we gained insight into the repressive mechanisms by which FOXA cooperates with PRDM1 TF to recruit NuRD and PRC complexes to establish bivalent enhancers. Similarly, OCT4 coordinates with PRDM14 to form bivalent enhancers and repress cell differentiation programs in pluripotent stem cells. Our findings reveal an unexpected but critical mechanism whereby pioneer TFs, in cooperation with PRDM TFs, prevent precocious and alternative-lineage gene expression by employing epigenetic repression to safeguard cell fate.

RESULTS

Pioneer TF FOXA prevents alternative-lineage and precocious gene expression during human foregut endoderm development.

The FOXA family of TFs is encoded by three genes, FOXA1, FOXA2, and FOXA3, which are redundantly required for liver development from the embryonic endoderm^22,23. To assess the impact of depleting FOXA1/A2/A3 on epigenetic and gene regulation in endoderm development, we established a doxycycline (Dox) inducible CRISPR interference (CRISPRi) system in human pluripotent stem cells (hPSCs) to knock down all three FOXA genes simultaneously (Figure 1A)²⁴. A Dox-inducible deactivated Cas9 (dCas9) was fused to a KRAB repression domain and integrated into the AAVS locus in hPSCs, and gRNAs targeting FOXA1/A2/A3 gene loci were transduced into the host hPSCs (Figure 1A). We then purified three clones and used an endoderm differentiation protocol to generate homogenous cell populations of mesendoderm (ME), definitive endoderm (DE), foregut (FG), and liver bud progenitor (LBP) from hPSCs (Figure 1B, S1A)²⁵. Dox treatment of FOXA1/A2/A3-CRISPRi (FOXA-TKD) hPSCs at the initiation of endoderm differentiation resulted in > 95% gene knockdown efficiency for all FOXA genes at the foregut stage, a period in which all FOXA genes are robustly expressed under Doxfree control conditions (Figure 1B, S1A, S1B).

RNA-seq analyses revealed genes that are differentially expressed in FOXA-TKD foregut cells (1792 up- and 767 down-regulated) (Figure 1C, Table S1). Down-regulated genes were enriched for foregut-related Gene Ontology (GO) terms, including “Morphogenesis of an epithelium”. Upregulated/de-repressed genes were enriched for alternative mesodermal and ectodermal lineage GO terms (“Regulation of neuron differentiation”, “Angiogenesis”, “Muscle organ development”, “Epithelial to mesenchymal transition”) (Figure 1C). Genes normally expressed at later stages of endoderm differentiation for liver and pancreas specification (e.g., TBX3, PROX1, and SOX9) were also de-repressed in the FOXA-TKD foregut cells. These genes were characterized by the GO term “Cell morphogenesis involved in differentiation”. As a negative control, neuroectoderm cells which normally do not express FOXA genes were subjected to Dox-induced FOXA-TKD, and the impact on global gene expression was negligible, as expected (Figure S1C). Thus, we discovered that FOXA TFs are required for preventing precocious and alternative-lineage gene expression in the foregut endoderm.

To determine potential direct target genes of the FOXA TFs, we performed FOXA1 and FOXA2 CUT&RUN sequencing in control foregut cells. We identified 6115 FOXA chromatin binding peaks (combined FOXA1 and FOXA2 peaks), including those proximal to the known target genes, HNF1B and HNF4A (Figure S2A). Given that FOXA family of TFs functions redundantly, we used the combined FOXA peaks for downstream analysis. De novo motif analysis of FOXA peaks confirmed top enrichment of the FOXA binding motif, followed by known FOXA co-binding TF motifs (e.g., SOX, GATA, HNF1) (Figure 1D). To associate FOXA peaks with potential direct target genes, we used the Genomic Regions Enrichment of Annotations Tool (GREAT)²⁶ and identified 1167 FOXA peaks associated with 576 FOXA-TKD-mediated upregulated genes (hypergeometric P-value = 1.6e-35) and 1011 FOXA peaks associated with 411 FOXA-TKD-mediated down-regulated genes (hypergeometric P-value = 2.47e-96) (Figure 1E). FOXA’s role in gene activation is consistent with their canonical pioneering activity. Since the mechanisms by which they repress precocious and alternative-lineage gene expression are unclear, we performed de novo motif analysis of FOXA peaks for the differentially expressed genes in FOXA-TKD. PR domain zinc finger 1 (PRDM1) TF-binding motifs were most significantly enriched at FOXA peaks associated with FOXA-TKD-mediated gene de-repression (Figure 1F). PRDM1 (BLIMP1) TF is a known tumor suppressor and a repressor in primordial germ cell^27–29 and immune cell differentiation^30,31. Notably, this is the first indication of the potential involvement of PRDM1 in endoderm differentiation in cooperation with FOXA.

FOXA recruits PRDM1 to prevent precocious and alternative-lineage gene expression.

To address the role of PRDM1 in endodermal differentiation, we generated a Dox-inducible PRDM1-CRISPRi/KD foregut model and observed compromised foregut gene expression, with 249 up-regulated and 1397 down-regulated genes (Table S1). Importantly, 85% of the up-regulated genes were also up-regulated in FOXA-TKD foregut cells (212/249, hypergeometric P-value <1e-100), while 30% of the down-regulated genes were down-regulated in the FOXA-TKD foregut cells (420/1397, hypergeometric P-value <1e-100) (Figure 2A). These results indicate that both FOXA and PRDM1 are necessary to repress target genes for safegurding endoderm differentiation.

Figure 2. — **(A)** Intersections of differentially expressed genes in *FOXA*-TKD and *PRDM1*-KD foregut. P value of the overlap by hypergeometric test. **(B)** Differential PRDM1 ChIP-seq analysis comparing *FOXA*-TKD versus control in foregut (n=2 replicates from 2 independent *FOXA*-CRISPRi clones; FDR < 0.05 by exact test using EdgeR). **(C)** Top *de novo* motifs enriched at PRDM1 differential and unchanged peaks upon *FOXA*-TKD by HOMER (n=2 replicates). P values by binomial test. **(D)** Averaged profiles of PRDM1 ChIP-seq, FOXA1 and FOXA2 CUT&RUN in control (green lines) and *FOXA*-TKD (gray lines) foregut at differential and unchanged PRDM1 peaks upon *FOXA-*TKD (n=2 replicates). FOXA1 and FOXA2 CUT&RUN and PRDM1 ChIP-seq tracks in control foregut at *GLI2* loci in RPM scale. **(E)** Association of FOXA-dependent PRDM1 peaks with potential target genes by GREAT. GO terms and representative target genes are shown. P values by binomial test from GREAT. See also Figure S2.

To test whether PRDM1 is recruited by FOXA in endoderm differentiation, we performed PRDM1 ChIP-seq in control and FOXA-TKD foregut cells. We found that PRDM1 binding peaks were significantly decreased at 1975 PRDM1 binding sites (PRDM1-lost peaks), unchanged at 3644 sites, and increased at 108 sites (PRDM1-gained peaks) upon FOXA-TKD (Figure 2B). De novo motif analysis confirmed top enrichment of the PRDM1 binding motif at all PRDM1 binding peak groups (Figure 2C). Notably, the FOXA binding motif was specifically enriched only at the PRDM-lost peaks (Figure 2C). Concordantly, FOXA1 and FOXA2 CUT&RUN peaks were specifically enriched only at the PRDM1-lost peaks (Figure 2D, S2B), suggesting FOXA-dependent PRDM1 recruitment at these sites. To characterize the potential target genes of FOXA-dependent PRDM1 binding sites, we curated PRDM1-lost peaks that overlapped with FOXA peaks and associated this particular group of peaks with target genes by GREAT (Figure 2E). The target genes were enriched for alternative-lineage GO terms (e.g., “positive regulation of hemopoiesis” and “positive regulation of leukocyte differentiation”) and GO terms related to later-stage liver development (e.g., “regulation of epithelial cell migration”) (Figure 2E). The representative target genes are shown in Figure 2E, all of which were de-repressed in FOXA-TKD foregut cells (Table S1). RNA-seq heatmaps for all potential target genes displayed a more de-repressed trend upon FOXA-TKD (Figure S2C). These results indicate that FOXA recruits PRDM1 to prevent precocious and alternative-lineage gene expression for endoderm differentiation.

FOXA and PRDM1 interact with NuRD complex and establish highly occupied, accessible nucleosome conformation.

To further explore FOXA-PRDM1-mediated repression mechanisms, we performed rapid immunoprecipitation mass spectrometry of endogenous proteins (RIME) assay³² in foregut cells for identifying repressive factors that interact with chromatin-bound FOXA2 and PRDM1. Notably, both FOXA2-RIME and PRDM1-RIME interactomes captured co-repressor complex, Nucleosome Remodeling and Deacetylation (NuRD) members (HDAC1/2, GATAD2A, MBD3, CHD4, MTA in both FOXA2-RIME and PRDM1-RIME; RBBP4/7 in FOXA2-RIME) and SALL4 transcription repressor (Figure 3A, Table S2). NuRD complex has been shown to control nucleosome positioning, density, and PRC2 recruitment to control access of DNA-binding proteins and fine-tune gene expression^33–35. SALL4 is known to interact with NuRD complex and PRC2^36–39. To test whether NuRD complex and SALL4 are recruited to FOXA-dependent PRDM1 binding sites, we performed ChIP-seq for SALL4 and key NuRD components, GATAD2A and HDAC2. We detected their marked enrichment at FOXA-dependent PRDM1 binding sites (PRDM1-lost peaks), which were lost in FOXA-TKD foregut cells (Figure 3B, S3A). These results suggest that FOXA and PRDM1 cooperate to recruit SALL4 and NuRD complexes for gene repression.

Figure 3. — **(A)** Volcano plots of the quantitative results of the FOXA2-RIME and PRDM1-RIME in foregut. Repressive TFs and subunits of NuRD complex are labeled (n=2 replicates). **(B)** Averaged profiles of ChIP-seq for SALL4, GATAD2A, HDAC2 in control (green lines) and *FOXA*-TKD (gray lines) foregut (n=2 replicates) at differential and unchanged PRDM1 peaks upon *FOXA-*TKD. **(C)** Averaged profiles of low-MNase-seq and high-MNase seq in control (green lines) and *FOXA*-TKD (gray lines) foregut (n=2 replicates) at PRDM1-lost peaks overlapped with FOXA peaks (centered by FOXA peaks; n=605). See also Figure S3.

To assess nucleosome organization, we performed low-MNase-seq and high-MNase-seq experiments (Figure S3B), which allowed us to profile accessible/fragile nucleosomes and stable nucleosomes, respectively^40,41. Our analysis revealed 3 highly enriched nucleosomal peaks in the low-MNase-seq plot and a depletion in the high-MNase-seq plot at the FOXA-PRDM1 binding sites in control foregut cells (Figure 3C, green plots), representing highly occupied, accessible nucleosome conformation. Importantly, this distinctive nucleosomal feature was abolished upon FOXA-TKD (Figure 3C, gray plots). These findings support the involvement of the chromatin remodeling function of NuRD complex in FOXA-mediated gene repression.

FOXA and PRDM1 cooperate to promote the recruitment of Polycomb repressive complexes and establish bivalent enhancers.

Given that NuRD complex can occupy gene regulatory regions bivalently marked by H3K4me3 and H3K27me3⁴², we next analyzed the epigenetic features of the FOXA-dependent PRDM1 binding sites by performing ChIP-seq or CUT&RUN for two Polycomb repressive histone modifications, H2AK119ub1 (PRC1 mark) and H3K27me3 (PRC2 mark), and two Trithorax active histone modifications, H3K4me1 (enhancer preference) and H3K4me3 (promoter preference). Intriguingly, the FOXA-dependent PRDM1 binding sites (PRDM1-lost sites) displayed a unique bivalent epigenetic signature compared with the other PRDM1 sites: higher Polycomb marks (H2AK119ub1, H3K27me3) and H3K4me1 marks, but lower H3K4me3 marks (Figure 4A, S3C). The bias for H3K4me1 mark rather than H3K4me3 mark suggests that these sites are putative enhancers. Indeed, the majority (97%) of the PRDM1-lost sites are located outside of promoters (−1,000 bp to +100 bp of transcription start sites) (Figure S4A). Importantly, upon FOXA-TKD, the H2AK119ub1 marks were markedly decreased to background level at the FOXA-dependent PRDM1 binding sites (PRDM1-lost sites), whereas other marks were modestly reduced (Figure 4A, S3C).

Figure 4. — **(A-B)** Averaged profiles of ChIP-seq for H2AK119ub1, RING1B, and RYBP, and CUT&RUN for H3K27me3, H3K4me1, and H3K4me3 in control (green lines) and *FOXA*-TKD (gray lines) foregut (n=2 replicates) at differential and unchanged PRDM1 peaks upon *FOXA*-TKD. **(C)** co-immunoprecipitation (IP) western blot (WB) analysis between FOXA2, PRDM1, and PRC1 components (RING1B/RNF2 and RYBP). **(D)** RT-qPCR in control (Dox-) and *PRC*1(*RING1 and RING1B/RNF2*)-CRISPRi/KD (Dox for 3 days) foregut and **(E)** in control (DMSO) and EZH2 inhibitor (GSK126) treated foregut (for 2 days) (n=3 replicates, Means ± SEM, *p<0.05, **p<0.01, ***p<0.001, and ns= not significant based on two-tailed un-paired t-test). See also Figures S4 – S6.

To further assess the cooperative action between FOXA and PRDM1 in establishing this unique epigenetic feature, we compared the enrichment of these epigenetic marks at “FOXA-PRDM1 co-bound sites” versus “FOXA-/PRDM1-only-bound sites” (Figure S4B). As FOXA and PRDM1 binding was substantially increased from definitive endoderm (DE) to foregut stage, we observed a significant increase in PRC1 mark H2AK119ub1 and a modest increase in PRC2 mark H3K27me3 at FOXA-PRDM1 co-bound sites, while no such increase was observed at FOXA-/PRDM1-only-bound sites (Figure S4B). In contrast, H3K4me1 marks were increased at both FOXA-PRDM1-co-bound sites and FOXA-only-bound sites (Figure S4B). The implications are that FOXA cooperates with PRDM1 for de novo deposition of PRC marks, especially PRC1 mark, H2AK119ub1, while also facilitating the deposition of H3K4me1 marks independently of PRDM1. This cooperative action promotes establishing the bivalent enhancers during the differentiation from definitive endoderm to the foregut stage.

We noted that the enrichments of ChIP-seq signal for PRC1 subunits, RING1B (RNF2) and RYBP, were decreased to background level upon FOXA-TKD at the FOXA-dependent PRDM1 binding sites (PRDM1-lost sites) but not at the other PRDM1 sites (Figure 4B, S4C). To confirm their physical interactions, we performed co-immunoprecipitation (co-IP) of endogenous foregut nuclear extracts treated with Benzonase nuclease to minimize the possibility that detected interactions are simply due to proximity on DNA⁴³. co-IP demonstrated physical interactions between FOXA2 and PRDM1, FOXA2 and RING1B, and PRDM1 and RYBP (Figure 4C, S4D). These data indicate that FOXA and PRDM1 collaborate in the efficient recruitment of PRCs to establish Polycomb domains.

We further curated FOXA-dependent PRDM1 binding sites into two distinct categories: robust H3K27me3 and H2AK119ub1 double-positive sites and H2AK119ub1 single-positive sites (Figure S5A). We found that the robust double-positive sites exhibit a higher enrichment of FOXA, PRDM1, PRC1 subunits, and H2AK119ub1 ChIP-seq signals in comparison to the H2AK119ub1 single-positive sites (Figure S5A). The level of accumulation of H2AK119ub1 marks was higher at these FOXA-PRDM1 binding sites (enhancers) than the associated promoters, while H3K27me3 mark exhibited similar levels at both enhancers and promoters (Figure S5B). Additionally, the robust double-positive sites contain a unique DNA motif for LEF/TCF transcription factors (Figure S5C). LEF/TCF, FOXA, and PRDM1 are known to interact with the transcriptional co-repressor TLE^44–46. Notably, we captured TLE1/3 in FOXA2-RIME proteomics assays (Table S2). These results suggest that robust H3K27me3 deposition requires stable recruitment of PRC1 and H2AK119ub marks, potentially regulated by the interplay of FOXA, PRDM1, and additional TFs.

Finally, to assess the role of PRCs in FOXA-PRDM1-mediated gene repression, we generated a Dox-inducible PRC1 (RING1 and RING1B/RNF2)-CRISPRi/KD foregut model (Figure S6A) and inhibited PRC2 activity using the EZH2 inhibitor GSK126 (Figure S6B). We focused on the FOXA-PRDM1 target genes associated with the FOXA-PRDM1 bound enhancers marked by both H2AK119ub1 and H3K27me3 (CER1, LEF1, LRP11) and those marked solely by H2AK119ub1 (WLS, SEMA3E). PRC1-KD resulted in de-repression for WLS, SEMA3E, and CER1, and a de-repression trend for LEF1 and LRP11 without reaching statistical significance (Figure 4D). In contrast, EZH2/PRC2 inhibition led to de-repression only in genes associated with both H2AK119ub1 and H3K27me3, while genes associated solely with H2AK119ub remained unaffected (Figure 4E). These results further highlight the essential role of PRCs in FOXA-PRDM1-mediated gene repression.

FOXA binding directly facilitates the recruitment of PRDM1 and epigenetic repressor for gene repression.

To validate the direct effect of FOXA and PRDM1 binding events in recruiting co-factors for gene repression, we established FOXA and PRDM1 binding site blocking systems, Dox-inducible CRISPRd hPSC lines (Figure 5A, S7A). For CRISPRd, dCas9 without KRAB specifically and sterically hinders the target binding site⁴⁷. We designed a gRNA to fully cover a FOXA binding motif (FOXA-CRISPRd) and a PRDM1 binding motif (PRDM1-CRISPRd) within the co-bound peak at the ZEB2 locus, while ensuring it doesn’t interfere with the other binding motif (Figure 5A, S7A). To ensure that dCas9 binding at the FOXA motif in FOXA-CRISPRd cells does not physically hinder the PRDM1 binding motif (53 bp apart), and vice versa, we also established a control-CRISPRd hPSC line. This line employs a control gRNA that targets a site located 36 bp away from the PRDM1 binding motif (Figure S7A). Despite the control gRNA’s proximity to the PRDM1 motif, due to the limitation of PAM sequences, we confirmed that the control-CRISPRd does not affect PRDM1 binding (nor FOXA binding) by performing PRDM1 and FOXA2 ChIP-qPCR (Figure S7B). These data indicate that FOXA-CRISPRd exclusively blocks the FOXA binding motif without physically hindering the PRDM1 binding motif, and vice versa.

Figure 5. — **(A)** ChIP-seq and CUT&RUN tracks in foregut at target genomic locus of Dox-inducible FOXA-CRISPRd and PRDM1-CRISPRd. **(B)** FOXA2, PRDM1, RING1B, H2AK119ub1 ChIP-qPCR enrichment in control and FOXA-CRISPRd foregut and **(C)** PRDM1-CRISPRd foregut. (n=2 replicates, Means ± SD, *p<0.05, **p<0.01, ***p<0.001, and ns= not significant based on one-way ANOVA and Dunnett’s test; n=4 replicates, Means ± SEM, **p<0.01 based on two-tailed un-paired t-test). **(D)** RT-qPCR of ZEB2 gene in control and FOXA-CRISPRd foregut (n=3 replicates, Means ± SEM, *p<0.05, ***p<0.001 on one-way ANOVA and Dunnett’s test). **(E)** A model explaining the FOXA and PRDM1-mediated establishment of bivalent enhancers for gene repression. See also Figure S7.

To confirm the FOXA-CRISPRd blocking effect on FOXA binding events by dCas9, we performed ChIP-qPCR for FOXA2 and dCas9 proteins at the target site in FOXA-CRISPRd foregut cells with a dox induction time course of 2 and 3 days (Figure 5B, S7C). In control experiments, we employed isogenic CRISPRd cells without doxycycline treatment. FOXA2 binding gradually decreased over the time course, while dCas9 binding concomitantly increased (Figure 5B, S7C). Notably, ChIP-qPCR of PRDM1 and RING1B revealed that their recruitment was impaired by FOXA-CRISPRd blocking (Figure 5B). We observed a decrease of H2AK119ub1 ChIP-qPCR signal in FOXA-CRISPRd, but the lack of statistical significance could be potentially due to residual FOXA, PRDM1, and RING1B binding events and/or insufficient sample size (n=2) for the observed effect size (Figure S7D). To improve CRISPRd efficiency, we generated a second FOXA-CRIPSRd_v2 line with a constitutively active U6 promoter for driving gRNA expression, while maintaining the same target gRNA sequence and same Dox-inducible dCas9 expression system. Although FOXA-CRIPSRd_v2 did not improve FOXA blocking efficiency (Fig. S7E), the additional samples generated underwent H2AK119ub1 ChIP-qPCR experiment (Fig. S7D). The ChIP-qPCR analysis of 4 samples increased the statistical power to 80%, based on the effect size observed in the original FOXA-CRISPRd data, rendering the reduction of H2AK119ub1 marks statistically significant (Figure 5B). Intriguingly, PRDM1-CRISPRd showed similar results to FOXA-CRISPRd, with reductions of RING1B binding and H2AK119ub1 mark. However, PRDM1-CRISPRd did not affect FOXA binding (Figure 5C). These results further resolve the sequence of events; FOXA first recruits PRDM1 (and not the reverse), which in turn facilitates the recruitment of PRC1.

Finally, RT-qPCR assay of the target gene, ZEB2, in FOXA-CRISPRd and PRDM1-CRISPRd foregut cells demonstrated that the gradual de-repression correlated with the dox induction time course (Figure 5D). Altogether, we found that FOXA binding is directly involved in the recruitment of PRDM1 and epigenetic repressor complexes for preventing alternative-lineage gene expression (Figure 5E).

OCT4 and PRDM14 recruit PRC1/H2AK119ub1 for poising early developmental genes.

We next asked whether our observations with FOXA and PRDM1 are limited to these specific factors or whether other pioneer TFs collaborate with PRDM TFs to regulate bivalent epigenetic states and repress alternative-lineage genes. We, therefore, examined the pluripotent pioneer TF, OCT4 (encoded by POU5F1), which has been reported to co-localize with 50% of the H3K4me3 and H3K27me3 marked bivalent chromatin domains in hPSCs and interacted with the PRC1 component RING1B^20,48. Since PRDM14 has been reported to form a complex with PRCs^49–54, we evaluated whether OCT4 could coordinate with PRDM14 to regulate bivalent epigenetic states for gene repression. We generated Dox-inducible OCT4-CRISPRi/KD hPSCs, as we did for FOXA-CRISPRi (Figure 1A), and confirmed 60% mRNA but no protein knockdown at day-1 post dox, 80% mRNA and 65% protein knockdown by day-2 (OCT4-KD-d2), and more than 95% mRNA and 95% protein knockdown by day-3 post dox (OCT4-KD-d3) (Figure S8A). To test whether PRDM14 co-localized with and was recruited by OCT4, we performed PRDM14 ChIP-seq in control and OCT4-KD-d2 hPSCs. We found that PRDM14 binding peaks significantly overlapped with published OCT4 binding peaks⁵⁵ in hPSCs (Figure 6A, n=569, hypergeometric P-value <1e-100). De novo motif analysis of the 2067 PRDM14 binding peaks confirmed top enrichment of the PRDM14 binding motif, followed by the OCT4:SOX2 binding motif (Figure 6A). A subset of PRDM14 binding peaks (n=130) were reduced in OCT4-KD-d2 hPSCs (Figure S8B), suggesting that OCT4 plays a limited role in PRDM14 recruitment.

We next characterize the OCT4-PRDM14 co-bound genomic sites. 92% of the OCT4-PRDM14 co-bound sites are located outside of promoter regions (−1,000 bp to +100 bp of TSS) (Figure S8C), suggesting that the majority of these sites are putative enhancers. OCT4-PRDM14 co-bound sites were enriched with Polycomb marks H2AK119ub1 and H3K27me3, as well as the active mark H3K4me1, indicating a bivalent epigenetic state (Figure 6B, green plots), similar to what we observed for FOXA-dependent PRDM1 sites (Figure 4A). In contrast, OCT4- or PRDM14-only bound sites showed monovalent states, with either H3K4me1 or Polycomb marks, respectively (Figure 6B). Polycomb marks were more enriched at OCT4-PRDM14 co-bound sites than at PRDM14-only sites, suggesting combinatorial recruitment of PRCs by OCT4 and PRDM14. H2AK119ub1 modifications at OCT4-PRDM14 co-bound sites were substantially and progressively reduced starting at OCT4-KD-d2, paralleling the OCT4 reduction (Figure 6B). In contrast, the H3K27me3 marks were only reduced at OCT4-KD-d3 (Figure 6B), suggesting that H2AK119ub1 deposition is more sensitive to OCT4 levels than H3K27me3. The H3K4me1 mark was not affected by OCT4-KD-d3 in hPSCs, indicating that, unlike FOXA, OCT4 is not required for H3K4me1 deposition (Figure 6B). Accordingly, we observed a loss of RING1B ChIP-seq signals at OCT4-PRDM14 co-bound sites in OCT4-KD-d2 hPSCs, and to a lesser extent at PRDM14-only bound sites (Figure 6C). By contrast, RYBP ChIP-seq signals were unaffected (Figure 6C), suggesting their recruitment is OCT4-independent. Co-IP experiments of hPSC endogenous nuclear extract treated with Benzonase nuclease supported physical interactions between OCT4, PRDM14, and RING1B (Figure 6D). Collectively, our data suggest that, in hPSCs, OCT4 and PRDM14 cooperate to recruit the PRC1 for H2AK119ub1 deposition at bivalent putative enhancers.

To characterize the target genes of OCT4-PRDM14 co-bound bivalent sites, GREAT association analysis was performed (Figure 6E). The potential target genes were enriched for embryonic development-related GO terms (e.g., “regionalization” and “regulation of embryonic development”) (Figure 6E). The representative GO genes, including key mesendoderm (ME) genes (GSC, EOMES, EVX1), are shown in Figure 6E, all of which were de-repressed in OCT4-KD hPSCs (Table S1). RNA-seq heatmaps for all potential target genes displayed a more de-repressed trend upon OCT4-TKD (Figure S8D). Expression changes of these target genes in OCT4-KD were cell-culture context dependent (Figure 6F). Although mesendoderm genes were de-repressed in OCT4-KD hPSCs, they were not fully induced in response to mesendoderm differentiation signal in OCT4-KD cells (Figure 6F). These results suggest that OCT4 and PRDM14 prevent spontaneous developmental gene activation in hPSCs while priming for timely activation in response to differentiation cues.

DISCUSSION

Understanding how alternative lineage programs are restricted provides valuable insights into developmental competence in cell differentiation, regeneration, and tumorigenesis. The current dogma is that pioneer TFs establish primed and active epigenetic states to initiate new transcriptional programs. However, our study has uncovered an unconventional role for the pioneer TFs FOXA and OCT4 (and by proxy, other pioneer TFs) in preventing inappropriate and precocious gene expression. This repressive function is carried out by the combinatorial binding of the pioneer and PRDM TFs, followed by the locus- and lineage-specific recruitment of epigenetic repressors (PRC and NuRD complexes) to establish highly occupied, accessible nucleosome confirmation marked by PRC modifications (H2AK119ub1 and H3K27me3) and active H3K4me1 modification. While a previous study demonstrated FOXA’s interaction with a H3K4me1 methyltransferase³², our study is the first to demonstrate the cooperation between FOXA and PRDM1 in the efficient recruitment of NuRD and PRC1 complexes, potentially followed by PRC2 recruitment in NuRD- and H2AK119ub-dependent manner^12–15,42

Bivalent epigenetic domains have been identified not only in a pluripotent state but also in fetal and adult tissues¹⁷. Bivalency can serve as a common mechanism for tightly and dynamically regulating gene expression by priming for transcription, while at the same time keeping genes shut off until an appropriate signal is received. Although the dynamic nature of bivalent epigenetic domains has been documented during cell differentiation^17,56, most studies have focused on the trajectories of bivalent to monovalent resolution. It remained largely unknown how bivalent domains are dynamically established during cell differentiation. Our study has uncovered the unexpected involvement of FOXA and PRDM1 in the dynamic establishment of lineage-specific bivalent enhancers during endoderm differentiation. Furthermore, our findings shed light on the distinct mechanisms underlying the recruitment of PRCs to enhancers compared to promoters. While the PRC recruitment to promoters has been extensively studied and largely explained by generic mechanisms, including methylation-sensitive DNA binding proteins at hypomethylated CpG-rich promoters¹³, our study reveals the lineage- and locus-specific recruitment mechanisms for enhancers. This finding aligns with the lineage-specific regulatory roles of enhancers, complimenting the general transcriptional roles of promoters⁵⁷.

We postulate that pioneer TFs leverage lineage-specific repressive TFs and co-repressors, which contribute to lineage-specific gene repression depending on target genes and biological contexts. For instance, the co-binding of Foxa2 and Rfx1 has been shown to represses Cdx2 expression in adult mouse liver⁵⁸. Foxa also recruits co-repressor protein Grg3/TLE3 to establish stably closed chromatin domains, thereby facilitating gene silencing in hepatocytes⁴⁵. While we have mainly focused on the impact of co-binding factors and the combinations of DNA motifs that dictate the TF bindings, the decision of a pioneer TF to activate or repress its target genes can be multifaceted. Potential additional factors for this biological decision include distributions of TF binding motifs (spacing, directionality), pre-existing chromatin states (accessibility, nucleosome organization, epigenetic modifications), 3D chromatin interactions, and nuclear localizations (e.g., Lamina-associated domains). Overall, it is not surprising that pioneer TF-mediated gene repression plays a crucial role in safeguarding cell fate, operating as a critical common mechanism across diverse biological contexts. A comprehensive understanding of the mechanisms underlying pioneer TF-mediated gene repression will greatly enhance the precise manipulation of cell fate in cellular programming and reprogramming.

Limitations of the Study

In this study, we have revealed unexpected roles of FOXA in repressing alternative-lineage and precocious gene expression, while simultaneously activating endodermal genes during human endoderm differentiation. We showed that this repressive function is carried out through cooperation with the PRDM1, which recruits NuRD and Polycomb repressive complexes to establish repressive chromatin domains. However, this mechanism cannot account for all FOXA-mediated gene repression events, as PRDM1-KD de-repressed a portion of FOXA target genes (Figure 2A). We hypothesize that additional partner TFs and repressive co-factors are also involved in FOXA-mediated gene repression mechanisms. For example, our de novo Motif analysis and FOXA-RIME assay have provided potential additional factors, such as RFX, LEF/TCF, and SALL TFs, as well as HDAC-containing repressor complexes. Future studies include further dissection of FOXA-mediated gene repression mechanisms.

The decision of pioneer TF to activate or repress its target genes can be multifaceted, which is not comprehensively addressed in this present report. The direct measurement of transcriptional outcome driven by a pioneer TF-bound enhancers through perturbation-based massive parallel reporter assay can provide us with a more comprehensive syntax to elucidate the bidirectional activity. Integrations of multi-layered chromatin states and organization can also address this important question.

STAR METHODS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Makiko Iwafuchi (makiko.iwafuchi@cchmc.org).

Materials Availability

Unique and stable reagents generated in this study are available upon request.

Data and Code Availability

Raw data from Figures 4, 6, S1, S3, S4, S6, and S8 were deposited on Mendeley at http://dx.doi.org/10.17632/tz24fxbfgn.1. All sequencing data are available through GEO accession number GSE215436.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Human induced pluripotent stem cell (hPSC) culture

Human induced pluripotent stem cells (72.3, male, RRID: CVCL_A1BW) were obtained from the CCHMC Pluripotent Stem Cell Facility (PSCF)⁵⁹ and cultured in feeder-free condition with mTeSR1 (85850, STEMCELL Technologies) and on a hESC-qualified Matrigel (354277, Corning) or Cultrex Stem Cell Qualified Reduced Growth Factor Basement Membrane Extract (3434-010-02, Biotechne) coated plate. All hPSCs were cultured in 5% CO₂, 37°C and humidified incubator. Spontaneously differentiated cells were manually removed before passage and differentiation. For passaging, hPSC colonies were dissociated with Gentle Cell Dissociation Reagent (07174, STEM CELL Technologies) into small cell clusters and seeded on Matrigel or Culturex coated culture plates and cultured in mTeSR1. 72.3 hPSCs were distributed by the PSCF from a quality controlled, cryopreserved bank prepared at ~p30. Cells were documented to be mycoplasma-free, harbor a normal G-banded karyotype, and identity was confirmed by STR profiling. CRISPRi and CRISPRd hPSC lines are listed in the Key Resources table.

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
FOXA1	Abcam	Cat#ab55178; RRID:AB_941631
FOXA2	Abnova	Cat#H00003170-M01; RRID:AB_530050
FOXA2	Millipore	Cat#07-633; RRID:AB_390153
PRDM1	Cell Signaling Technology	Cat#9115S; RRID:AB_2169699
OCT4/POU5F1	R&D systems	Cat#AF1759; RRID:AB_354975
PRDM14	Abcam	Cat#ab187881; RRID:N/A
SALL4	Cell Signaling Technology	Cat#8459S; RRID:AB_10949321
RING1B/RNF2	Bethyl	Cat#A302-869A; RRID:AB_10632773
RYBP	Millipore	Cat#AB3637; RRID:AB_2285466
GATAD2A	Bethyl	Cat#A302-357A; RRID:AB_1907235
HDAC2	Bethyl	Cat#A300-705A; RRID:AB_533399
H3K4me1	Millipore	Cat#07-436; RRID:AB_310614
H3K4me3	Millipore	Cat#07-473; RRID:AB_1977252
H2AK119ub1	Cell Signaling Technology	Cat#8240S; RRID:AB_10891618
H3K27me3	Cell Signaling Technology	Cat#9733; RRID:AB_2616029
H3K27me3	Millipore	Cat#07-449; RRID:AB_310624
HA-tag	Cell Signaling Technology	Cat#3724; RRID:AB_1549585
VINCULIN	Sigma-Aldrich	Cat#V9131; RRID:AB_477629
Anti-Mouse IgG_HRP	GE Healthcare Cytiva	Cat#NA931; RRID:AB_772210
Anti-Rabbit IgG_HRP	GE Healthcare Cytiva	Cat#NA934; RRID:AB_772206
TrueBlot Anti-Goat IgG_HRP	Rockland	Cat#18-8814-31; RRID:AB_2610843
TrueBlot Anti-Rabbit IgG_HRP	Rockland	Cat#18-8816-33; RRID:AB_2610848
StarBright^™ Blue 700 Goat Anti-Rabbit IgG	BioRad	Cat#12004162; RRID:AB_2721073
StarBright^™ Blue 520 Goat Anti-Mouse IgG	BioRad	Cat#12005867; RRID:AB_2934034
Bacterial and virus strains
NEB^® 5-alpha Competent E. coli	NEB	Cat#C2987H
NEB^® Stable Competent E. coli	NEB	Cat#C3040H
NEB^® 10-beta Competent E. coli	NEB	Cat#C3019H
Lentivirus-pLV-hUbC-EGFP-sgRNA.FOXA1/2/3_CRISPRi	CCHMC viral vector core	N/A
Lentivirus-pLV-hUbC-EGFP-sgRNA.OCT4_CRISPRi	CCHMC viral vector core	N/A
Lentivirus-pLV-hUbC-EGFP-sgRNA.PRDM1_CRISPRi	This study	N/A
Lentivirus-pLV-hUbC-EGFP-sgRNA.PRC1 (RING1 and RING1B/RNF2) CRISPRi	This study	N/A
Lentivirus-FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd	This study	N/A
Lentivirus-FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd	This study	N/A
Lentivirus-FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd	This study	N/A
Lentivirus-LRG-sgRNA.FOXA2-ZEB2_CRISPRd_v2	This study	N/A
Chemicals, peptides, and recombinant proteins
mTeSR1	STEMCELL Technologies	Cat#07174
IMDM, GlutaMAX^™ Supplement	Thermo Fisher Scientific	Cat#31980097
Ham’s F-12 Nutrient Mix, GlutaMAX^™ Supplement	Thermo Fisher Scientific	Cat#31765092
DMEM/F-12, HEPES	Thermo Fisher Scientific	Cat#11330032
DMEM, high glucose	Thermo Fisher Scientific	Cat#11965118
Schneider’s Drosophila Medium	Thermo Fisher Scientific	Cat#21720024
Opti-MEM^™ Reduced Serum Medium	Thermo Fisher Scientific	Cat#31985062
FBS	Thermo Fisher Scientific	Cat#10437-028
KnockOut^™ Serum Replacement	Thermo Fisher Scientific	Cat#10828028
Chemically Defined Lipid Concentrate	Thermo Fisher Scientific	Cat#11905031
Poly(vinyl alcohol)	Sigma-Aldrich	Cat#363170
1-Thioglycerol	Sigma-Aldrich	Cat#M6145
Insulin solution from bovine pancreas	Sigma-Aldrich	Cat#I0516-5ML
Transferrin	Sigma-Aldrich	Cat#T3309-100MG
Corning^® Matrigel^® hESC-Qualified Matrix	Corning	Cat#354277
Cultrex Stem Cell Qualified Reduced Growth Factor Basement Membrane Extract	Biotechne	Cat#3434-010-02
Gentle Cell Dissociation Reagent	STEMCELL Technologies	Cat#07174
Accutase	STEMCELL Technologies Sigma-Aldrich	Cat#07922 Cat#A6964-500ML
CloneR	STEMCELL Technologies	Cat#05888
Y27632	STEMCELL Technologies	Cat#72304
ActivinA	Shenandoah Cell Guidance Systems	Cat#800-0 Cat#GFH6
CHIR99021	Sigma-Aldrich	Cat#SML1046-25MG
PI-103	Tocris Bioscience	Cat#2930-1
LDN193189	Sigma-Aldrich	Cat#SML0559-5MG
A83-01	Sigma-Aldrich	Cat#SML0788-5MG
ATRA	Sigma-Aldrich	Cat#R2625-100MG
bFGF	Thermo Fisher Scientific	Cat#PHG0261
BMP4	R&D systems	Cat#314-BP-050
Forskolin	Sigma-Aldrich	Cat#F3917-10MG
SB431542	Sigma-Aldrich	Cat# S4317-5MG
XAV931	Sigma-Aldrich	Cat#X3004-5MG
Doxycycline	Sigma-Aldrich	Cat#D9891-5G
Polybrene Infection / Transfection Reagent	Sigma-Aldrich	Cat#TR-1003-G
GSK126	Cayman	Cat#15415
Plasmomcin	InvivoGen	Cat#ant-mpp
Penicillin-Streptomycin	Thermo Fisher Scientific	Cat#15140122
DSP	Thermo Fisher Scientific	Cat#22585
PFA	Electron Microscopy Sciences Fisher Scientific	Cat#15710 Cat#F79-500
UltraPure^™ Glycine	Thermo Fisher Scientific	Cat#15527013
Benzonase	Millipore	Cat#70664
RNaseA	Thermo Fisher Scientific	Cat#EN0531
Protease K	Roche	Cat#03115828001
Digitonin	Sigma-Aldrich	Cat#300410
pA-MNase	Laboratory of William Zachrias	N/A
MNase	Worthington	Cat#LS004798
PMSF	Sigma-Aldrich	Cat#P7626-1G
cOmplete^™ Protease Inhibitor Cocktail	Roche	Cat#11836170001
Critical commercial assays
Lenti-X concentrator	Takara Bio	Cat#631231
Aurum Total RNA Lysis Solution	BioRad	Cat#7326802
Aurum^™ Total RNA Mini Kit	BioRad	Cat#7326820
iScript^™ cDNA Synthesis Kit	BioRad	Cat#1708890
PowerUp^™ SYBR^™ Green Master Mix	Thermo Fisher Scientific	Cat#A25742
Dynabeads^™ Protein G for Immunoprecipitation	Thermo Fisher Scientific	Cat#10004D
BioMag^®Plus Concanavalin A	Bangs Laboratories	Cat#BP531
NEBNext Ultra II DNA Library Prep Kit for Illumina	NEB	Cat#E7645
AMPure XP Beads	Beckman Coulter	Cat#A63880
MagBind Magnetic Beads	Omega	Cat#M1378-01
Deposited data
ChIP-seq	This study	GSE215436
CUT&RUN	This study	GSE215436
MNase-seq	This study	GSE215436
RNA-seq	This study	GSE215436
Raw gel image data in Mendeley Data	This study	http://dx.doi.org/10.17632/tz24fxbfgn.1.
Experimental models: Cell lines
hPSC (72.3)	CCHMC Pluripotent Stem Cell Facility	RRID: CVCL_A1BW
Dox-inducible CRISPRi, host hPSC (72.3)	This study	N/A
Dox-inducible FOXA1/A2/A3-CRISPRi hPSC	This study	N/A
Dox-inducible OCT4-CRISPRi hPSC	This study	N/A
Dox-inducible PRDM1-CRISPRi hPSC	This study	N/A
Dox-inducible PRC1 (RING1 and RING1B/RNF2)- CRISPRi hPSC	This study	N/A
Dox-inducible CRISPRd, host hPSC (72.3)	This study	N/A
Dox-inducible FOXA-CRISPRd (ZEB2 locus) hPSC	This study	N/A
Dox-inducible PRDM1-CRISPRd (ZEB2 locus) hPSC	This study	N/A
Dox-inducible Control-CRISPRd (ZEB2 locus) hPSC	This study	N/A
Dox-inducible FOXA2-CRISPRd_v2 (ZEB2 locus) hPSC	This study	N/A
Oligonucleotides
CRISPRi and CRISPRd gRNAs	IDT	Table S3
Primers for RT-qPCR and ChIP-qPCR	IDT	Table S4
Recombinant DNA
pAAVS1-NDi-CRISPRi (Gen 1)	Mandegar et al.,²⁴	Addgene plasmid #73497
pHR-PGK-ABI-dCas9-P2A-mCherry	Wang et al.,⁸¹	Addgene plasmid #121513
sgRNA-T2 (Targeting AAV1 locus) 5’-GGGGCCACTAGGGACAGGAT-3’	Oceguera-Yanez et al., 60	N/A
pX459M2-HF-AAVS1	Ran et al., Chen et al.,^61,62	N/A
pmU6-gRNA	Kabadi et al.,⁶⁵	Addgene plasmid #53187
phU6-gRNA	Kabadi et al.,⁶⁵	Addgene plasmid #53188
phH1-gRNA	Kabadi et al.,⁶⁵	Addgene plasmid #53186
ph7SK-gRNA	Kabadi et al.,⁶⁵	Addgene plasmid #53189
pLV GG hUbC-dsRED	Kabadi et al.,⁶⁵	Addgene plasmid #84034
H2B-GFP (EGFP)	Kanda et al.,⁸²	Addgene plasmid #11680
FgH1tUTG	Aubrey et al.,⁸³	Addgene plasmid #70183
LRG	Shi et al.,⁸⁴	Addgene plasmid #65656
psPAX2	Laboratory of Didier Trono	Addgene plasmid #12260
pMD2.G	Laboratory of Didier Trono	Addgene plasmid #12259
pLV-hUbC-EGFP-sgRNA.FOXA1/A2/A3_CRISPRi	This study	N/A
pLV-hUbC-EGFP-sgRNA.OCT4_CRISPRi	This study	N/A
pLV-hUbC-EGFP-sgRNA.PRDM1_CRISPRi	This study	N/A
pLV-hUbC-EGFP-sgRNA.PRC1 (RING1 and RING1B/RNF2) CRISPRi	This study	N/A
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd	This study	N/A
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd	This study	N/A
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd	This study	N/A
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2	This study	N/A
Software and algorithms
R studio v1.4.1717	RStudio	https://posit.co/download/rstudio-desktop/
R v3.6.3	N/A	https://cran.r-project.org/
bedtools v2.27.0	Quinlan et al.,⁷⁷	https://bedtools.readthedocs.io/en/latest/
ucsctools v380	N/A	https://hgdownload.soe.ucsc.edu/admin/exe/
ImageMagick v7.0.7	N/A	https://imagemagick.org
STAR v2.5	Dobin et al.,⁷⁰	https://github.com/alexdobin/STAR
bwtool v1.0.1	Pohl et al.,⁷⁹	https://github.com/CRG-Barcelona/bwtool
cutadapt v2.1.0	Martin et al.,⁸⁵	https://cutadapt.readthedocs.io/en/stable/
fastqc v0.11.7	N/A	https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
homer v4.11	Heinz et al.,⁷⁵	http://homer.ucsd.edu/homer/
picard v2.18.22	N/A	https://broadinstitute.github.io/picard/
samtools v1.14.0	Danecek et al.,⁸⁶	https://github.com/samtools/samtools
sratoolkit v2.10.8	N/A	https://github.com/ncbi/sra-tools
FeatureCounts/subread v1.6.2	Liao et al.,⁷¹	https://subread.sourceforge.net/
DESeq2 v1.22.2	Love et al.,⁷²	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
IGV v2.15.4	Thorvaldsdóttir et al.,⁸⁷	https://software.broadinstitute.org/software/igv/
MaxQuant v2.2.0	Cox et al.,⁸⁸	https://maxquant.net/maxquant/
Perseus v2.0.9	Tyanova et al.,⁸⁹	https://maxquant.net/perseus/
Enhancedvolcano v1.18.0	N/A	https://github.com/kevinblighe/EnhancedVolcano
G*Power v3.1.9.6	Faul et al.,⁹⁰	https://www.psychologie.hhu.de/arbeitsgruppen/allgemeine-psychologie-undarbeitspsychologie/gpower.html
GraphPad Prism v9.3.1 (350)	Dotmatics	https://www.graphpad.com/features

Open in a new tab

METHOD DETAILS

hPSC to Endoderm, Mesoderm, and Neuroectoderm differentiation

For hPSC differentiation, hPSCs were dissociated as single cells with Accutase (07922, STEMCELL Technologies; A6964-500ML, Sigma-Aldrich). Dissociated cells were plated on a Matrigel or Culturex coated culture plate and cultured in 10 uM Y27632 (72304, STEMCELL Technologies) containing mTeSR1 one day before differentiation.

Chemically defined basal media 2 (CDM2) and CDM3 were composed as previously reported⁶⁰, filtered through 0.22 um unit, and stored at −80°C until use. Once thawed, CDM2 was used within 2 weeks, and CDM3 was used within 3 weeks. Each differentiation protocol is shown below.

Endoderm differentiation

Endodermal induction was performed essentially as previously described^25,60. For mesendoderm (ME) induction, hPSCs were cultured in CDM2 supplemented with 100 ng/ml ActivinA (800-0, Shenandoah; or GFH6, Cell Guidance Systems), 2 uM CHIR99021 (SML1046-25MG, Sigma-Aldrich), and 50 nM PI103 (2930-1, Tocris Bioscience) for 24 hours. For definitive endoderm (DE) induction, ME cells were briefly washed with DMEM/F12 and cultured with CDM2 supplemented with 100 ng/ml ActivinA and 250 nM LDN193189 (SML0559-5MG, Sigma-Aldrich) for 24 hours. For foregut (FG) induction, DE cells were briefly washed with DMEM/F12 and cultured with CDM3 supplemented with 1 uM A83-01 (SML0788-5MG, Sigma-Aldrich), 2 uM ATRA (R2625-100MG, Sigma-Aldrich), 10 ng/ml bFGF (PHG0261, Thermo Fisher Scientific), and 30 ng/ml BMP4 (314-BP-050, R&D systems) for 24 hours. For Liver bud (LB) induction, FG cells were cultured in CDM3, supplemented with 10 ng/ml Activin A, 30 ng/ml BMP4, 1 μM Forskolin (F3917-10MG, Sigma-Aldrich) for 72 hours. Differentiation media was changed every 24 hours.

Paraxial mesoderm differentiation

Paraxial mesodermal induction was performed with some modification of the published protocol⁶¹. For mesendoderm (ME) differentiation, hPSCs were cultured in CDM2 supplemented with 100 ng/ml ActivinA, 2 uM CHIR99021, and 50 nM PI-103 for 24 hours. For paraxial mesoderm induction, ME cells were briefly washed with DMEM/F12 and cultured in CDM2 supplemented with 1 uM A83-01, 2 uM CHIR99021, and 250 nM LDN193189 for 24 hours.

Neuroectoderm differentiation

hPSCs were cultured in CDM2 supplemented with 10% KOSR (10828028, Thermo Fisher Scientific), 250 nM LDN193189, 10 uM SB431542 (S4317-5MG, Sigma-Aldrich), and 5 uM XAV931 (X3004-5MG, Sigma-Aldrich) for 3 days. Differentiation media was changed every day.

Generation of Dox-inducible CRISPRi and CRISPRd hPSC lines

Dox-inducible CRISPRi and CRISPRd host hPSCs were established essentially as previously described²⁴. For CRISPRi, plasmid pAAVS1-NDi-CRISPRi (Gen 1) was a kind gift of Dr. Bruce Conklin (73497, Addgene plasmid). For CRISPRd, a dCas9-KRAB cassette in the pAACS1-NDi-CRISPRi vector was replaced with an ABI-dCas9 cassette from a pHR-PGK-ABI-dCas9-P2A-mCherry vector (121513, Addgene plasmid). The gRNA sequence for targeting the AAVS1 locus (sgRNA-T2: GGGGCCACTAGGGACAGGAT)⁶² was subcloned into the pX459M2-HF vector, a modified version of the pX459 V2.0 vector (62988, Addgene plasmid) carrying an optimized gRNA scaffold, to generate plasmid pX459M2-HF-AAVS1^63,64. Briefly, 72.3 hPSCs were reverse transfected (TRANS-LT1, Mirus) with 2ug each of pX459M2-HF-AAVS1 and pAAVS1-NDi-CRISPRi (Gen 1). Clones that formed during 8 days of exposure to 100μg/mL G418 were manually excised, expanded, and genotyped. A clone containing bi-allelic knock-in of a cassette for constitutive expression of the third-generation modified rtTA protein (Tet-On 3G) and doxycycline-inducible KRAB-dCas9-P2A-mCherry or dCas9-P2A-mCherry into the AAVS1 locus was identified by Sanger sequencing and used for subsequent experiments. Dox-inducible CRISPRi and CRISPRd host hPSCs were distributed by the PSCF from a quality controlled, cryopreserved bank prepared at ~p50, transduced gRNA (see below), and used in experiments up to p73 (FOXA-CRISPRi), p79 (PRDM1-CRISPRi), p64 (OCT4-CRISPRi), p73 (PRC1-CRISPRi), p60 (FOXA-CRISPRd), p51 (PRDM1-CRISPRd), p60 (Control-CRISPRd), and p51 (FOXA-CRISPRd_v2). Cells were documented to be mycoplasma-free, harbor a normal G-banded karyotype, and identity was confirmed by STR profiling.

CRISPRi gRNA design and cloning into the gRNA-expression vector

gRNAs targeting FOXA1/A2/A3 loci (for FOXA-CRISPRi/TKD), PRDM1 locus (for PRDM1-CRISPRi/KD), RING1 and RING1B/RNF2 loci (for PRC1-CRISPRi/DKD) or OCT4 locus (for OCT4-CRISPRi/KD), were designed by a comprehensive algorithm to predict high efficiency for CRISPRi⁶⁵ or designed by CRISPOR (Table S3)⁶⁶. Two to four gRNAs per each CRISPRi target derived from independent RNA polymerase III promoters were cloned into a single lentivirus expression vector by a two-step Golden Gate cloning method, as previously described⁶⁷. Briefly, at step 1, annealed and phosphorylated oligos for each desired genomic target were cloned into pmU6-gRNA (53187, Addgene), phU6-gRNA (53188, Addgene), phH1-gRNA (53186, Addgene) or ph7SK-gRNA (53189, Addgene) plasmid by Golden gate assembly method. At step 2, plasmids from step 1 were cloned into pLV-GG-hUbC-EGFP (84034, Addgene; dsRED was replaced with EGFP from 11680, Addgene) by the Golden gate assembly method. The gRNA sequences are listed in Table S3.

Viral production, transduction, and establish FOXA-CRISPRi, PRDM1-CRISPRi, PRC1-CRISPRi and OCT4-CRISPRi monoclonal lines

The lentivirus was produced by the CCHMC viral vector core or in-house. Briefly, gRNA-expression lentivirus vector, packaging plasmid (psPAX2), and envelope plasmid (pMD2.G) were transfected to HEK293T cell by the polycation polyethyleneimine (PEI) transfection method. The viral supernatant was passed through a 0.45 um filter and concentrated to 1:66 with Lenti-X concentrator (631231, Takara Bio) in-house or to 1:255 by ultracentrifugation in the core.

Each Lentivirus was transduced to CRISPRi hPSCs by spin infection method⁶⁸. CRISPRi hPSCs were dissociated to single cells via Accutase. The dissociated cells were resuspended in the transduction medium (1 uL to 15 uL of lentivirus, 4 to 8 ug/ml Polybrane[STR-1003-G, Sigma-Aldrich], and 10 uM Y27632 [72304, STEMCELL Technologies] in mTeSR1), and centrifuged at 3200 xg for 30 to 90 min. The cell pellet was resuspended in mTeSR1 supplemented with 10 uM Y27632 and plated on the Matrigel-coated plate. The next day, culture media was changed to mTeSR1, and daily maintenance was performed until sub-confluence. EGFP-positive lentivirus transduced cells were sorted by Moflo XDP (Beckmann Coulter) or BD FACSAria II (BD Biosciences) and cloned from single cells by limiting dilution method. Clonal cells were cultured with mTeSR1 supplemented with 1x CloneR (05888, STEMCELL Technologies), Plasmomcin (1:500 [ant-mpp, InvivoGen]) and Penicillin-Streptomycin (1:100 [15140122, Thermo Fisher Scientific]) for 2 days. At day 3, Clonal cells were cultured in mTeSR1 supplemented with 1x CloneR. At day 4, 25% volume of 1x CloneR-supplemented mTeSR1 was added. On day 5 and after, culture media was changed to mTeSR1, and daily maintenance was performed. After the expansion of monoclonal lines, a minimum of 6 clones were tested for CRISPRi knockdown efficiency by RT-qPCR. To induce CRISPRi knockdown of target genes, cells were cultured in the presence of 500 nM to 2 uM doxycycline (D9891-5G, Sigma-Aldrich).

Inhibition of PRC2 activity using the EZH2 inhibitor GSK126

Cells were treated with 10 uM of GSK126 (15415, Cayman) or DMSO (control) from mesoendoderm (for 2 days) or definitive endoderm (for 1 days) stage to foregut stage.

CRISPRd gRNA design, cloning into the gRNA-expression vector, and establishing CRISPRd hPSC lines

gRNA targeting a FOXA or PRDM1 binding motif at FOXA-PRDM1 co-binding site in the ZEB2 gene locus was designed by CRISPOR⁶⁶ (Table S3). gRNA expression was derived by H1 or U6 RNA polymerase III promoter was cloned into a lentivirus vector FgH1tUTG (70183, Addgene plasmid) or LRG (65656, Addgene plasmid) by a Golden Gate cloning method. The gRNA sequences are listed in Table S3.

The lentivirus was produced and transduced to CRISPRd host hPSCs, as explained above. To induce FOXA-CRISPRd, PRDM1-CRISPRd, control-CRISPRd and FOXA-CRISPRd_v2 blocking, cells were cultured in the presence of 2 uM doxycycline (D9891-5G, Sigma-Aldrich).

Western blot assay

1 to 2.5 ug of nuclear protein in Laemmli Sample Buffer (J60015, Alfa Aesar) was denatured at 100°C for 5 min, run on 10, 12.5 or 15% SDS-PAGE gel at 60 V for 30 min and then 100 V for 2 hours, and transferred to 0.2 or 0.45 um pore size PVDF membrane (for chemiluminescence; LC2002, Thermo Fishir Scientific and IPSN07852, Millipore) or 0.2 um nitrocellulose membrane (for fluorescence; 1620112, BioRad) in wet tank transfer system with Mini Blot Module (Thermo Fishir Scientific) at 20 V (for chemiluminescence) or 10 V (for fluorescence) for 1 hour. The transferred membrane was briefly washed with TBST (0.1% Tween-20 in TBS for chemiluminescence) or TTBS (0.05% Tween-20 in TBS for fluorescence) and blocked with Blocking Buffer (5% Blotting-Grade Blocker [1706404, BioRad] or 5% BSA [A9647-50G, Sigma-Aldrich] in TBST for chemiluminescence or TBS for fluorescence) for 1 hour at room temperature. The blocked membrane was washed with TBST (for chemiluminescence) or TTBS (for fluorescence) at room temperature and incubated with primary antibody diluted with Blocking Buffer at 4°C overnight. The next day, the membrane was washed three to five with TBST or TTBS for 5 min at room temperature and incubated with a secondary antibody, diluted with 1% BSA in TBST (for chemiluminescence) or 5% Blotting-Grade Blocker in TBS (for fluorescence) for 1 hour at room temperature. The membrane was washed three to five with TBST or TTBS for 5 min at room temperature. The chemiluminescence signal was developed with ECL Select Western Blotting Detection Reagent (RPN2235, GE Healthcare) or Clarity^™ Western ECL Substrate (170–5061, BioRad) for 5 min. A chemiluminescence and fluorescence image was acquired by the ChemiDoc^™ MP imaging system (BioRad). Antibodies used in Western Blot Assay are listed in Table S5.

Co-Immunoprecipitation (co-IP)

We modified published co-IP protocols^43,69. Cultured cells were briefly washed with DMEM/F12 and crosslinked with 1.5 mM DSP (22585, Thermo Fisher Scientific) in PBS at room temperature for 30 min with gentle shaking. The crosslinking solution was aspirated, and the crosslinking reaction was quenched with 30 mM Tris-HCl (pH 7.4) in PBS for 20 min with gentle shaking. Crosslinked cells were briefly washed twice with ice-cold 1x PBS and scraped in ice-cold 0.01% PVA in 1x PBS. The cell suspension was transferred to a conical tube and centrifuged at 350 xg for 3–5 min at 4°C. The supernatant was removed, and the cell pellet was resuspended with ice-cold 0.01% PVA in 1x PBS and centrifuged at 800 xg for 3–5 min at 4°C. The supernatant was removed, and the cell pellet was snap frozen by dry ice. The cell pellet was stored at −80°C until going to the next step.

For nuclear protein extraction, the cell pellet was suspended with Cell Lysis Buffer (5 mM HEPES-NaOH [pH. 7.9], 10 mM KCl, 1 mM DTT, 0.5% NP-40, 1x protease inhibitor) and incubated on ice for 10 min. Then, the cell suspension was centrifuged at 1700 xg for 10 min at 4°C, and the supernatant was removed. The cell pellet was resuspended with Nuclear Lysis Buffer (100 mM NaCl, 25 mM HEPES-NaOH [pH. 7.9], 1 mM MgCl₂, 0.2 mM EDTA, 0.5% NP-40, 600 U/mL Benzonase [70664, Millipore], 1x protease inhibitor) and incubated for 4 hours at 4°C with rotation. The NaCl concentration of the nuclear lysate was adjusted to 200 mM and incubated for 30 min at 4°C with rotation. The nuclear lysate was centrifuged at maximum speed (16000 xg) for 30 min at 4°C. Take the appropriate volume of precleared lysate as an input. Incubate lysates with the appropriate amount of antibody (listed below) overnight at 4°C with rotation. For each immunoprecipitation (IP) reaction, 50 uL Dynabeads Protein-G beads (10004D, Thermo Fisher Scientific) were used. Dynabeads were washed twice with PBST (0.1% Tween-20 in PBS). Washed Dynabeads were resuspended with antibody-cell lysate and incubated for 2 hours at 4°C with rotation. Dynabeads were washed 5 times with IP-Wash Buffer (100 mM NaCl, 25 mM HEPES-NaOH [pH. 7.9], 1 mM MgCl₂, 0.2 mM EDTA, 0.5% NP-40, 1x protease inhibitor) at room temperature for 2 min with rotation. Dynabeads-bound antibody-proteins (IP samples) were eluted with 1x Laemmli Sample Buffer (1610737EDU, BioRad) for 20 min at 65°C while shaking at 1000 rpm in ThermoMixer F1.5 (Eppendorf). For denaturing IP and Input samples, add 1/20 volume of 2-mercaptoethanol and boil for 5 min at 98°C. Denatured IP and Input samples were stored at −20°C until use for Western Blot assay. Antibody information is listed in Table S6.

Chromatin Immunoprecipitation (ChIP)

Cells were crosslinked with 1% formaldehyde (F79–500, Fisher Scientific) in 1x PBS for 10 min at room temperature. The crosslinking reaction was stopped by adding 0.125 M glycine (15527013, Thermo Fisher Scientific) for 5 min at room temperature.

Crosslinked cells were centrifuged at 600 xg for 5 min at 4°C, and the supernatant was removed. The cell pellet was washed with ice-cold 1x PBS and centrifuged at 600 xg for 5 min at 4°C. Repeat the wash step (total twice). The cell pellet was frozen by dry ice and stored at −80°C.

Crosslinked human cells were resuspended with Lysis Buffer1 (10 mM Tris-HCl [pH. 8.0], 10 mM NaCl, 0.5% NP-40, and 1x Complete Protease Inhibitor EDTA free) and incubated for 10 min on ice. Cells were centrifuged at 665 xg for 5 min at 4°C, and the supernatant was removed. The cell pellet was resuspended with Lysis Buffer2 (50 mM Tris-HCl [pH. 8.0], 10 mM EDTA, 0.32% SDS, 1x Complete Protease Inhibitor EDTA free) and incubated for 10 min on ice. The cell lysate was diluted with IP Dilution Buffer (20 mM Tris-HCl [pH. 8.0], 150 mM NaCl, 2 mM EDTA, 1% TritonX-100, 1x Complete Protease Inhibitor EDTA free) and transferred into a milliTUBE ATA Fiber (Covaris). The cell lysate was sonicated by Covaris S220 (Covaris) for 3.5 min. The insoluble debris was removed by centrifuge at 12000 xg for 5 min at 4°C. Sonicated chromatin (supernatant) was transferred to a new tube and stored at −80°C.

25 to 86 uL Dynabeads Protein-G beads (10003D or 10004D, Thermo Fisher Scientific) were washed twice with PBS-T (0.02% Tween-20 in 1x PBS). Desired amounts of antibodies (Table S7) were conjugated to washed beads for 2 to 6 hours at 4°C with rotation. Meanwhile, Frozen chromatin was thawed on ice. A desired amount of chromatin (Table S7, determined by DNA amount) was diluted with IP dilution buffer in a 4:1 ratio. Antibody-conjugated Dynabeads were washed twice with IP Dilution Buffer (without Complete protease inhibitor EDTA free). Washed Dynabeads were resuspended with diluted chromatin and incubated overnight at 4°C with rotation. The next day, ChIPed beads were washed four times with the following washing buffers: FA Lysis Buffer (50 mM HEPES-KOH [pH. 7.5], 150 mM NaCl, 2 mM EDTA, 1% TritonX-100, 0.1% Sodium deoxycholate, 1x Complete protease inhibitor EDTA free); NaCl Buffer (50 mM HEPES-KOH [pH. 7.5], 500 mM NaCl, 2 mM EDTA, 1% TritonX-100, 0.1% Sodium deoxycholate); LiCl Buffer (100 mM Tris-HCl [pH. 8.0], 500 mM LiCl, 1% NP-40, 1% Sodium deoxycholate); and 10 mM Tris-HCl [pH. 8.0]. Chromatin was eluted with TES (50 mM Tris-HCl [pH. 8.0], 10 mM EDTA, 1% SDS) for 45 min (15 min × 3) at 65°C while shaking at 1000 rpm in ThermoMixer F1.5 (Eppendorf). The ChIP and Input chromatin were reverse crosslinked by adding NaCl (Final concentration of 200 mM) for 2 to 8 hours at 65°C. The reverse crosslinked chromatin samples were treated with 50 ng/ul RNaseA (EN0531, Thermo Fisher Scientific) for 0.5 to 1 hour at 37°C. Samples were treated with 0.2 mg/ml protease K (03115828001, Roche) for 2 to 4 hours at 37°C. Finally, DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. The DNA concentration was measured by Quantus fluorometer (Promega). Antibody and chromatin information are listed in Table S7.

CUT&RUN

20 uL of ConcanabalinA coated beads (BP531, Bangs Laboratories) were washed twice with Binding Buffer (20 mM HEPES-KOH [pH. 7.9], 10 mM KCl, 1 mM CaCl_2, and 1mM MnCl₂). Dissociated live cells were resuspended with Wash Buffer (20 mM HEPES-NaOH [pH. 7.5], 150 mM NaCl, 0.5 mM Spermidine, and 1x Complete Protease Inhibitor EDTA free) and mixed with washed beads. The mixture was rotated for 10–15 min at room temperature. We then resuspend cell-bound beads with 100 ul (for histone mark CUT&RUN) and 50 ul (for TF CUT&RUN) Antibody Buffer (2 mM EDTA in Digitonin Buffer [0.02% Digitonin in Wash Buffer]). Desired amounts of antibodies (Table S8) were added to cell-beads suspension and incubated overnight at 4°C with rotation. The next day, beads were washed twice with Digitonin Buffer. Washed beads were treated with 700 ng/ml pA-MNase in Digitonin Buffer for 1 hour at room temperature with rotation. Beads were washed twice with Digitonin Buffer. Washed beads were resuspended with 100 ul of Digitonin Buffer and placed on the cool block (BP361036, Fisher Scientific) for >10 min to cool down to 0°C. We then performed pA-MNase digestion by adding 2 ul of ice-cold 0.1 M CaCl₂ and incubating for 30 min on the cool block. To stop the pA-MNase reaction, 100 ul of 2x Stop Buffer (340 mM NaCl, 20 mM EDTA, 4 mM EGTA, 0.02% Digitonin, 0.05 mg/ml RNaseA, and 0.05 mg/ml Glycogen) was added. To release the CUT&RUN fragment, samples were incubated at 37°C for 30 min with shaking at 300 rpm in ThermoMixer F1.5 (Eppendorf). The beads were removed by centrifuge at 16000 xg for 5 min at 4°C and placed on a magnetic stand. Supernatant was transferred and treated with 0.1% SDS and 0.25 mg/ml proteinase K for 1 hour at 37°C. Finally, DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. The DNA concentration was measured by Quantus fluorometer (Promega). Antibody and cell number information are listed in Table S8.

MNase treatment and DNA purification

MNase treated DNA samples were prepared following with previous reports^40,41. Briefly, dissociated foregut cells were washed with Wash Buffer (20 mM HEPES-NaOH [pH. 7.5], 150 mM NaCl, 0.5 M Spermidine and 1x Complete Protease Inhibitor EDTA free), centrifuged at 600 xg for 3 min, and the supernatant was removed (twice). The cell pellet was resuspended with Digitonin Buffer (0.02% Digitonin in wash buffer). Cell suspension was divided into 1.0×10⁶ cells per reaction, added 13 U/mL (low) or 160 U/mL MNase (LS004798, Worthington), and incubated for exactly 5 min at 37°C while shaking at 300 rpm in ThermoMixer F1.5 (Eppendorf). MNase reaction was quenched by adding equal volumes of 2x Stop Buffer (340 mM NaCl, 20 mM EDTA, 4 mM EGTA, 0.02% Digitonin, 0.05 mg/ml RNaseA, and 0.05 mg/ml Glycogen). For RNase reaction, samples were incubated at 37°C for 30 min. Then, samples were treated with 0.5% SDS and 0.2 mg/mL Proteinase K for 2 hours at 37°C. Finally, DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. The DNA concentration was measured by nanodrop (Thermo Fisher Scientific). Mono- and sub-nucleosomal DNA fragments were selected and purified by MagBind Magnetic Beads (M1378-01, Omega). The purified DNA concentration was measured by Quantus fluorometer (Promega).

RT-qPCR and ChIP-qPCR

For RT-qPCR, 500 ng of total RNA was reverse transcribed with iScript^™ cDNA Synthesis Kit (1708890, BioRad). The synthesized cDNA was diluted in a 1:5 ratio with DNase-free water for RT-qPCR.

For ChIP-qPCR, ChIP and Input samples were diluted with DNase-free water. The serial dilutions of Input DNA were used for standard curve generation.

SYBR Green method (A25742, Thermo Fisher Scientific) was used for qPCR reaction in QuantStudio^™ 5 Real-Time PCR System (Thermo Fisher Scientific). For RT-qPCR, Relative gene expression was calculated by the 2^−ΔΔCt method. GAPDH was used as an internal control. For ChIP-qPCR, % Input was calculated using a standard curve and absolute quantification. Primer sequences are listed in Table S4.

Preparation and sequencing of ChIP-seq, CUT&RUN and MNase-seq libraries

We prepared multiplexed libraries of ChIP, Input for ChIP, CUT&RUN, and MNase-treated samples from two replicates (two independent CRISPRi clones) using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7645, NEB). The manufacturer’s protocol was employed with the following changes. After the adaptor ligation, we performed cleanup by AMPure XP Beads (A63880, Beckman Coulter) or MagBind Magnetic Beads (M1378-01, Omega) without size selection. After the RCR enrichment of the adaptor-ligated library, we performed two rounds of size selection by the magnetic beads.

RNA Sequencing (RNA-seq)

1 million cultured cells were dissociated into single cells with Accutase and were mixed with 100,000 Drosophila Schneider 2 (S2) cells for a spike-in control. Cells were pelleted and lysed with Aurum Total RNA Lysis Solution (7326802, BioRad). Total RNA was extracted by Aurum^™ Total RNA Mini Kit (7326820, BioRad) and sent to Novogene for library preparation and paired-end-150bp sequencing on an Illumina NovaSeq 6000.

RNA-seq data analysis

Sequencing reads were aligned to the hg38 and dm6 combined genome using STAR aligner⁷⁰. Only uniquely and concordantly aligned read pairs were used for downstream analysis. The read count mapped to each gene was measured using featureCounts⁷¹ with options ‘-O --fracOverlap 0.8’. For spike-in controlled analysis, reads mapped to drosophila genes were also counted using the same method. Differential gene expression analysis was performed using the Wald test of DESeq2⁷². Spike-in normalization was incorporated by calculating size factors using the ‘estimateSizeFactors’ function based on drosophila gene read counts. Human genes with fold-change (FC) > 1.5 and false discovery rate (FDR) < 0.05 were selected as differentially expressed genes for downstream analysis. Gene ontology (GO) analysis was done using EnrichR⁷³, where top significant GO terms by BH adjusted P value (raw P value from Fish exact test) were selected for presentation.

CUT&RUN, ChIP-seq, and MNase-seq data analysis

CUT&RUN Sequencing reads were aligned to the same genome reference as RNA-seq data for consistency using STAR aligner like RNA-seq with options ‘--alignSJDBoverhangMin 999 --alignIntronMax 1 --alignMatesGapMax 2000 --outFilterMultimapNmax 1 --outFilterMismatchNoverLmax 0.05’. Only uniquely and concordantly aligned read pairs were used for analysis. Read 1 and 2 were connected with each other to form a fragment. Downstream analysis was performed essentially as previously described⁷⁴. For transcription factor (TF) CUT&RUN, fragments with size < 120 bp were selected as originating from putative nucleosome-free regions. For histone modification (histone) CUT&RUN, fragments with size > 150bp were selected as originating from putative nucleosomal regions. Selected fragments were resized to 100bp to normalize bias from the sample-to-sample variabilities of fragment lengths. Peak calling was done using Homer⁷⁵ against a matching IgG control. Target-specific options were used for peak calling: ‘-style factor -center -size 200 -tbp 0 -fragLength 100’ for TF and ‘-style histone -tbp 0 -fragLength 100’ for histone. Peaks overlapping with ENCODE blacklist regions⁷⁶ were discarded. For TF, peaks with > 1rpm were retained for downstream analysis. Bigwig files were generated using bedtools⁷⁷ and UCSC toolkit⁷⁸ in RPM scale.

ChIP-seq sequencing reads were aligned to the same genome reference using STAR aligner with options ‘--alignSJDBoverhangMin 999 --alignIntronMax 1 --alignMatesGapMax 2000 --outFilterMultimapNmax 1 --outFilterMismatchNoverLmax 0.05’. Redundant fragments were deduplicated using Picard (https://broadinstitute.github.io/picard). BigWig files were generated similarly but without fragment length restriction. PRDM Peak calling was done using Homer against matching an input sample, and peaks > 0.7RPM were retained for downstream analysis.

Pioneer and PRDM factors were defined as “co-bound” if the distance between the peak centers is < 2kb. Putative target genes of TF-bound regions were defined by GREAT analysis²⁶, where significant GO terms were identified via binomial test. Genomic annotations of TF peaks were performed using Homer. All de novo motif searches were done using Homer within a 200-bp window. Differential analysis of PRDM1 and PRDM14 binding comparing control and KD was performed using edgeR by pooling and merging overlapping peaks from control and KD, and peaks with FDR < 0.05 by exact test were defined as gained or lost peaks.

Line plot and heatmap visualization of CUT&RUN and ChIP-seq data was done by extracting RPM-normalized stack-height profile from bigwig files using bwtool⁷⁹ and by drawing using customized R scripts. ChIP-seq data were input-subtracted before statistical testing or visualization.

MNase-seq sequencing data was analyzed similarly to CUT&RUN data. We created bigwig files focusing on fragments with > 150bp to investigate nucleosomal phasing.

Rapid immunoprecipitation mass spectrometry of endogenous proteins (RIME)

hPSC-derived foregut cells were washed with DMEM/F12 and were dissociated as single cells with Accutase (07922, STEMCELL Technologies; A6964-500ML, Sigma-Aldrich). The Accutase reaction was quenched with DMEM/F12 supplemented with 10% FBS. Dissociated cells were centrifuged at 350 xg for 5 min at room temperature. The cell pellet was resuspended with CDM3 media (see Endoderm Differentiation Method above). Resuspended cells were fixed by adding 10% volumes of 11% Methanol-free PFA (15710, Electron Microscopy Sciences) buffer (0.1 M NaCl, 1 mM EDTA, 50 mM HEPES) for exactly 8 min at room temperature with rotation. 1.0×10⁸ cells were the maximum number for 10 mL scale fixation. The fixation reaction was quenched by adding 550 uL of 2.5 M Glycine (final concentration of 0.125 M) and incubated for 5 min at room temperature with rotation. Cells suspension was centrifuged at 800 xg for 10 min at 4°C. Aspirate supernatant and wash pellet twice with 0.5% NP40 in 1xPBS and centrifuge at 800 xg for 10 min at 4°C. At the second wash, 100 uL of 0.1M PMSF was added. After the 2nd wash, aspirate supernatant and snap-freeze the cell pellet with dry ice. The fixed cell pellets were sent to ActiveMotif for RIME assays with IgG control, FOXA2 (07-633, Millipore, Lot #2971828), and PRDM1 (9115BF, Cell Signaling Technology) antibodies (two replicates per target).

RIME data analysis

Raw data were processed by using MaxQuant v.2.2.0 (https://maxquant.net/maxquant/). Reference of human peptides was obtained from the UniProt database (https://www.uniprot.org/). We performed label-free quantification (LFQ) with the following parameter: Peptide Spectrum Match (PSM) FDR < 0.01; Protein FDR < 0.01. We also set “Match Between Run” to reduce the missing value. Differential protein enrichment analysis was performed by Perseus v2.0.9 (https://maxquant.net/perseus/). For statistical analysis, we used a two-tailed t-test with the following parameters to set the non-linear cut-off value: Number of randomization 250; FDR < 0.05; S0=0.1⁸⁰. The protein of interest with statistical significance was plotted by Enhancedvolcano v1.18.0 (https://github.com/kevinblighe/EnhancedVolcano). Differential protein enrichment data for FOXA2-RIME and PRDM1-RIME was shown in Table S2.

Quantification and statistical analysis

Details of statistics tests, sample sizes, biological replicates, and error bars are indicated in the figure legends. Data were derived from independent clones for FOXA-CRISPRi and OCT4-CRISPRi cell lines or independent experimental repeats for PRC1-CRISPRi, CRISPRd, and 72.3 hPSC lines. G*Power software was used to estimate sample size. All statistical tests for RT-qPCR, ChIP-qPCR, and Western blotting were performed by GraphPad Prism9. The two-tailed unpaired t-test was performed to assess the differences between two groups. Ordinary one-way ANOVA or repeated measures ANOVA was used to assess the difference among more than two groups. For proteomics analysis, details of statistics tests were indicated in “RIME data analysis.” We used Perseus software for the statistical test, and the detailed statistical values are shown in Table S2.

Details of statistical tests regarding high throughput sequencing data are in the Method Details sections, including de novo motif search, differential gene expression analysis, differential PRDM binding analysis, GO analysis, and GREAT analysis.

Supplementary Material

NIHMS1953637-supplement-1.pdf^{(8MB, pdf)}

NIHMS1953637-supplement-2.xlsx^{(5.9MB, xlsx)}

NIHMS1953637-supplement-3.xlsx^{(1.8MB, xlsx)}

Highlights.

FOXA recruits PRDM1 to prevent alternative-lineage and precocious gene expression.
FOXA and PRDM1 interact with NuRD, establishing accessible nucleosome conformation.
FOXA and PRDM1 promote the recruitment of PRC1 to establish bivalent enhancers.
OCT4 and PRDM14 promote the recruitment of PRC1 for poising developmental genes.

Acknowledgments:

We thank D. Haslam, B. Gebelein, B. Conklin, and A. Barski for sharing equipment and materials; Y-C. Hu, J. Tchieu, and K. Loh for technical advice; B. Gebelein, V. Hwa, A. Zorn, R. Kopan, K. Zaret, G. Mirizio, G. Riddihoug for helpful comments and editing on the paper; the Digestive Disease Research Core Center in CCHMC (Pluripotent Stem Cell Facility, Genome Editing Core, DNA sequencing Core, Research Flow Cytometry Core, Viral Vector Production Core). This work was supported by Japan Society for the Promotion of Science Foundation (Postdoctoral Fellowship to SM), Uehara Memorial Foundation (Postdoctoral Fellowship to SM), the Cincinnati Children’s Research Foundation (Trustee Awards and Center for Pediatric Genomics Pilot Awards to MI and HL), and National Institutes of Health (P30 DK078392 and 1R01GM143161 to MI).

Footnotes

Publisher's Disclaimer: This is a pdf file of an unedited manuscript that has been accepted for publication. as a service to our customers we are providing this early version of the manuscript. the manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Table S1. RNA-seq differentially expressed genes in FOXA-TKD foregut, PRDM1-KD foregut, and OCT4-KD hPSCs, Related to Figures 1C, 2A, and 6E.

Table S2. RIME protein enrichment data for FOXA2-RIME and PRDM1-RIME in control foregut, Related to Figure 3A.

Declaration of Interests: Authors declare that they have no competing interests.

REFERENCES

1.Iwafuchi-Doi M, and Zaret KS (2014). Pioneer transcription factors in cell reprogramming. Genes Dev 28, 2679–2692. 10.1101/gad.253443.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Wang A, Yue F, Li Y, Xie R, Harper T, Patel NA, Muth K, Palmer J, Qiu Y, Wang J, et al. (2015). Epigenetic Priming of Enhancers Predicts Developmental Competence of hESC-Derived Endodermal Lineage Intermediates. Cell Stem Cell 16, 386–399. 10.1016/j.stem.2015.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Genga RMJ, Kernfeld EM, Parsi KM, Parsons TJ, Ziller MJ, and Maehr R (2019). Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development. Cell Rep 27, 708–718.e10. 10.1016/j.celrep.2019.03.076. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Lee K, Cho H, Rickert RW, Li QV, Pulecio J, Leslie CS, and Huangfu D (2019). FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation. Cell Rep 28, 382–393.e7. 10.1016/j.celrep.2019.06.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Geusz RJ, Wang A, Lam DK, Vinckier NK, Alysandratos KD, Roberts DA, Wang J, Kefalopoulou S, Ramirez A, Qiu Y, et al. (2021). Sequence logic at enhancers governs a dual mechanism of endodermal organ fate induction by FOXA pioneer factors. Nat Commun 12, 1–19. 10.1038/s41467-021-26950-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Takahashi K, and Yamanaka S (2006). Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 126, 663–676. 10.1016/j.cell.2006.07.024. [DOI] [PubMed] [Google Scholar]
7.Soufi A, Donahue G, and Zaret KS (2012). Facilitators and impediments of the pluripotency reprogramming factors’ initial engagement with the genome. Cell 151, 994–1004. 10.1016/j.cell.2012.09.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Horisawa K, and Suzuki A (2020). Direct cell-fate conversion of somatic cells: Toward regenerative medicine and industries. Proc Jpn Acad Ser B Phys Biol Sci 96, 131–158. 10.2183/PJAB.96.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Inada H, Udono M, Matsuda-Ito K, Horisawa K, Ohkawa Y, Miura S, Goya T, Yamamoto J, Nagasaki M, Ueno K, et al. (2020). Direct reprogramming of human umbilical vein- and peripheral blood-derived endothelial cells into hepatic progenitor cells. Nat Commun 11, 5292. 10.1038/s41467-020-19041-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Morris SA, Cahan P, Li H, Zhao AM, San Roman AK, Shivdasani RA, Collins JJ, and Daley GQ (2014). Dissecting Engineered Cell Types and Enhancing Cell Fate Conversion via CellNet. Cell 158, 889–902. 10.1016/j.cell.2014.07.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Cahan P, Li H, Morris SA, Lummertz da Rocha E, Daley GQ, and Collins JJ (2014). CellNet: Network Biology Applied to Stem Cell Engineering. Cell 158, 903–915. 10.1016/j.cell.2014.07.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Kim JJ, and Kingston RE (2022). Context-specific Polycomb mechanisms in development. Nat Rev Genet. 10.1038/s41576-022-00499-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Blackledge NP, and Klose RJ (2021). The molecular principles of gene regulation by Polycomb repressive complexes. Nat Rev Mol Cell Biol 22, 815–833. 10.1038/s41580-021-00398-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Piunti A, and Shilatifard A (2021). The roles of Polycomb repressive complexes in mammalian development and cancer. Nat Rev Mol Cell Biol 22. 10.1038/s41580-021-00341-1. [DOI] [PubMed] [Google Scholar]
15.Yu J, Lee C, Oksuz O, Stafford JM, and Reinberg D (2019). PRC2 is high maintenance. Genes Dev, 1–33. 10.1101/gad.325050.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Kuroda MI, Kang H, De S, and Kassis JA (2020). Dynamic Competition of Polycomb and Trithorax in Transcriptional Programming. Annu Rev Biochem 89, 235–253. 10.1146/annurev-biochem-120219-103641. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Blanco E, González-Ramírez M, Alcaine-Colet A, Aranda S, and Di Croce L (2020). The Bivalent Genome: Characterization, Structure, and Regulation. Trends in Genetics 36, 118–131. 10.1016/j.tig.2019.11.004. [DOI] [PubMed] [Google Scholar]
18.Schuettengruber B, Bourbon H-M, Di Croce L, and Cavalli G (2017). Genome Regulation by Polycomb and Trithorax: 70 Years and Counting. Cell 171, 34–57. 10.1016/j.cell.2017.08.002. [DOI] [PubMed] [Google Scholar]
19.Rada-Iglesias A, Bajpai R, Swigut T, Brugmann S. a., Flynn R. a., and Wysocka J (2011). A unique chromatin signature uncovers early developmental enhancers in humans. Nature 470, 279–283. 10.1038/nature09692. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315–326. 10.1016/j.cell.2006.02.041. [DOI] [PubMed] [Google Scholar]
21.Blanco E, González-Ramírez M, Alcaine-Colet A, Aranda S, and Di Croce L (2020). The Bivalent Genome: Characterization, Structure, and Regulation. Trends in Genetics 36, 118–131. 10.1016/j.tig.2019.11.004. [DOI] [PubMed] [Google Scholar]
22.Reizel Y, Morgan A, Gao L, Lan Y, Manduchi E, Waite EL, Wang AW, Wells A, and Kaestner KH (2020). Collapse of the hepatic gene regulatory network in the absence of FoxA factors. Genes Dev, 1–12. 10.1101/gad.337691.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Lee CS, Friedman JR, Fulmer JT, and Kaestner KH (2005). The initiation of liver development is dependent on Foxa transcription factors. Nature 435, 944–947. 10.1038/nature03649. [DOI] [PubMed] [Google Scholar]
24.Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, et al. (2016). CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell 18, 541–553. 10.1016/j.stem.2016.01.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Ang LT, Tan AKY, Autio MI, Goh SH, Choo SH, Lee KL, Tan J, Pan B, Lee JJH, Lum JJ, et al. (2018). A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells. Cell Rep 22, 2094–2106. 10.1016/j.celrep.2018.01.087. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM, and Bejerano G (2010). GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol 28, 495–501. 10.1038/nbt.1630. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Kurimoto K, Yabuta Y, Hayashi K, Ohta H, Kiyonari H, Mitani T, Moritoki Y, Kohri K, Kimura H, Yamamoto T, et al. (2015). Quantitative dynamics of chromatin remodeling during germ cell specification from mouse embryonic stem cells. Cell Stem Cell 16, 517–532. 10.1016/j.stem.2015.03.002. [DOI] [PubMed] [Google Scholar]
28.Irie N, Weinberger L, Tang WWC, Kobayashi T, Viukov S, Manor YS, Dietmann S, Hanna JH, and Surani MA (2015). SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate. Cell 160, 253–268. 10.1016/j.cell.2014.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Ohinata Y, Payer B, O’Carroll D, Ancelin K, Ono Y, Sano M, Barton SC, Obukhanych T, Nussenzweig M, Tarakhovsky A, et al. (2005). Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436, 207–213. 10.1038/nature03813. [DOI] [PubMed] [Google Scholar]
30.Martins G, and Calame K (2008). Regulation and functions of Blimp-1 in T and B lymphocytes. Annu Rev Immunol 26, 133–169. 10.1146/annurev.immunol.26.021607.090241. [DOI] [PubMed] [Google Scholar]
31.Minnich M, Tagoh H, Bönelt P, Axelsson E, Fischer M, Cebolla B, Tarakhovsky A, Nutt SL, Jaritz M, and Busslinger M (2016). Multifunctional role of the transcription factor Blimp-1 in coordinating plasma cell differentiation. Nat Immunol 17, 331–343. 10.1038/ni.3349. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Jozwik KM, Chernukhin I, Serandour AA, Nagarajan S, and Carroll JS (2016). FOXA1 Directs H3K4 Monomethylation at Enhancers via Recruitment of the Methyltransferase MLL3. Cell Rep 17, 2715–2723. 10.1016/j.celrep.2016.11.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Vermunt MW, Luan J, Zhang Z, Thrasher AJ, Huang A, Saari MS, Khandros E, Beagrie RA, Zhang S, Vemulamada P, et al. (2023). Gene silencing dynamics are modulated by transiently active regulatory elements. Mol Cell 83, 715–730.e6. 10.1016/j.molcel.2023.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Bornelöv S, Reynolds N, Xenophontos M, Gharbi S, Johnstone E, Floyd R, Ralser M, Signolet J, Loos R, Dietmann S, et al. (2018). The Nucleosome Remodeling and Deacetylation Complex Modulates Chromatin Structure at Sites of Active Transcription to Fine-Tune Gene Expression. Mol Cell 71, 56–72.e4. 10.1016/j.molcel.2018.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Signolet J, and Hendrich B (2015). The function of chromatin modifiers in lineage commitment and cell fate specification. FEBS Journal 282, 1692–1702. 10.1111/febs.13132. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Pantier R, Chhatbar K, Quante T, Skourti-Stathaki K, Cholewa-Waclaw J, Alston G, Alexander-Howden B, Lee HY, Cook AG, Spruijt CG, et al. (2021). SALL4 controls cell fate in response to DNA base composition. Mol Cell 81, 845–858.e8. 10.1016/j.molcel.2020.11.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Lu J, Jeong H, Kong N, Yang Y, Carroll J, Luo HR, Silberstein LE, Ma Y, and Chai L (2009). Stem cell factor SALL4 represses the transcriptions of PTEN and SALL1 through an epigenetic repressor complex. PLoS One 4, 1–13. 10.1371/journal.pone.0005577. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Lauberth SM, and Rauchman M (2006). A conserved 12-amino acid motif in Sall1 recruits the nucleosome remodeling and deacetylase corepressor complex. Journal of Biological Chemistry 281, 23922–23931. 10.1074/jbc.M513461200. [DOI] [PubMed] [Google Scholar]
39.Oliviero G, Brien GL, Waston A, Streubel G, Jerman E, Andrews D, Doyle B, Munawar N, Wynne K, Crean J, et al. (2016). Dynamic protein interactions of the polycomb repressive complex 2 during differentiation of pluripotent cells. Molecular and Cellular Proteomics 15, 3450–3460. 10.1074/mcp.M116.062240. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Iwafuchi-Doi M, Donahue G, Kakumanu A, Watts JA, Mahony S, Pugh BF, Lee D, Kaestner KH, and Zaret KS (2016). The Pioneer Transcription Factor FoxA Maintains an Accessible Nucleosome Configuration at Enhancers for Tissue-Specific Gene Activation. Mol Cell 62, 79–91. 10.1016/j.molcel.2016.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Lim H-W, and Iwafuchi M (2023). Profiling Accessible Chromatin and Nucleosomes in the Mammalian Genome. Methods Mol Biol 2599, 59–68. 10.1007/978-1-0716-2847-8 [DOI] [PubMed] [Google Scholar]
42.Reynolds N, Salmon-Divon M, Dvinge H, Hynes-Allen A, Balasooriya G, Leaford D, Behrens A, Bertone P, and Hendrich B (2012). NuRD-mediated deacetylation of H3K27 facilitates recruitment of Polycomb Repressive Complex 2 to direct gene repression. EMBO Journal 31, 593–605. 10.1038/emboj.2011.431. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Mukherjee S, Luedeke DM, McCoy L, Iwafuchi M, and Zorn AM (2022). SOX transcription factors direct TCF-independent WNT/β-catenin responsive transcription to govern cell fate in human pluripotent stem cells. Cell Rep 40, 111247. 10.1016/j.celrep.2022.111247. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Hurlstone A, and Clevers H (2002). T-cell factors: Turn-ons and turn-offs. Preprint, 10.1093/emboj/21.10.2303 10.1093/emboj/21.10.2303. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Sekiya T, and Zaret KS (2007). Repression by Groucho/TLE/Grg proteins: genomic site recruitment generates compacted chromatin in vitro and impairs activator binding in vivo. Mol Cell 28, 291–303. 10.1016/j.molcel.2007.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Ren B, Chee KJ, Kim TH, and Maniatis T (1999). PRDI-BF1/Blimp-1 repression is mediated by corepressors of the Groucho family of proteins. Genes Dev 13, 125–137. 10.1101/gad.13.1.125. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Shariati SA, Dominguez A, Xie S, Wernig M, Qi LS, and Skotheim JM (2019). Reversible Disruption of Specific Transcription Factor-DNA Interactions Using CRISPR/Cas9. Mol Cell 74, 622–633.e4. 10.1016/j.molcel.2019.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Endoh M, Endo TA, Endoh T, Fujimura YI, Ohara O, Toyoda T, Otte AP, Okano M, Brockdorff N, Vidal M, et al. (2008). Polycomb group proteins Ring1A/B are functionally linked to the core transcriptional regulatory circuitry to maintain ES cell identity. Development 135, 1513–1524. 10.1242/dev.014340. [DOI] [PubMed] [Google Scholar]
49.Yamamoto M, Suwa Y, Sugiyama K, Okashita N, Kawaguchi M, Tani N, Matsubara K, Nakamura A, and Seki Y (2020). PRDM14-CtBP1/2-PRC2 complex regulates transcriptional repression during transition from primed to naïve pluripotency. J Cell Sci, jcs.240176. 10.1242/jcs.240176. [DOI] [PubMed] [Google Scholar]
50.Ma Z, Swigut T, Valouev A, Rada-Iglesias A, and Wysocka J (2011). Sequence-specific regulator Prdm14 safeguards mouse ESCs from entering extraembryonic endoderm fates. Nat Struct Mol Biol 18, 120–128. 10.1038/nsmb.2000. [DOI] [PubMed] [Google Scholar]
51.Yamaji M, Ueda J, Hayashi K, Ohta H, Yabuta Y, Kurimoto K, Nakato R, Yamada Y, Shirahige K, and Saitou M (2013). PRDM14 Ensures Naive Pluripotency through Dual Regulation of Signaling and Epigenetic Pathways in Mouse Embryonic Stem Cells. Cell Stem Cell 12, 368–382. 10.1016/j.stem.2012.12.012. [DOI] [PubMed] [Google Scholar]
52.Nady N, Gupta A, Ma Z, Swigut T, Koide A, Koide S, and Wysocka J (2015). ETO family protein Mtgr1 mediates Prdm14 functions in stem cell maintenance and primordial germ cell formation. Elife 4, 1–28. 10.7554/eLife.10150. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Tu S, Narendra V, Yamaji M, Vidal SE, Rojas LA, Wang X, Kim SY, Garcia BA, Tuschl T, Stadtfeld M, et al. (2016). Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature 534, 387–390. 10.1038/nature18004. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Chia NY, Chan YS, Feng B, Lu X, Orlov YL, Moreau D, Kumar P, Yang L, Jiang J, Lau MS, et al. (2010). A genome-wide RNAi screen reveals determinants of human embryonic stem cell identity. Nature 468, 316–320. 10.1038/nature09531. [DOI] [PubMed] [Google Scholar]
55.Gifford CA, Ziller MJ, Gu H, Trapnell C, Donaghey J, Tsankov A, Shalek AK, Kelley DR, Shishkin AA, Issner R, et al. (2013). Transcriptional and epigenetic dynamics during specification of human embryonic stem cells. Cell 153, 1149–1163. 10.1016/j.cell.2013.04.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Xie R, Everett LJ, Lim H, Patel NA, Schug J, Kroon E, Kelly OG, Wang A, D’Amour KA, Robins AJ, et al. (2013). Dynamic chromatin remodeling mediated by polycomb proteins orchestrates pancreatic differentiation of human embryonic stem cells. Cell Stem Cell 12, 224–237. 10.1016/j.stem.2012.11.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Buecker C, and Wysocka J (2012). Enhancers as information integration hubs in development: Lessons from genomics. Trends in Genetics 28, 276–284. 10.1016/j.tig.2012.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Watts JA, Zhang C, Klein-Szanto AJ, Kormish JD, Fu J, Zhang MQ, and Zaret KS (2011). Study of FoxA Pioneer Factor at Silent Genes Reveals Rfx-Repressed Enhancer at Cdx2 and a Potential Indicator of Esophageal Adenocarcinoma Development. PLoS Genet 7, e1002277. 10.1371/journal.pgen.1002277. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.McCracken KW, Catá EM, Crawford CM, Sinagoga KL, Schumacher M, Rockich BE, Tsai Y-H, Mayhew CN, Spence JR, Zavros Y, et al. (2014). Modelling human development and disease in pluripotent stem-cell-derived gastric organoids. Nature 516, 400–404. 10.1038/nature13863. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Loh KM, Ang LT, Zhang J, Kumar V, Ang J, Auyeong JQ, Lee KL, Choo SH, Lim CYY, Nichane M, et al. (2014). Efficient endoderm induction from human pluripotent stem cells by logically directing signals controlling lineage bifurcations. Cell Stem Cell 14, 237–252. 10.1016/j.stem.2013.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Loh KM, Chen A, Koh PW, Deng TZ, Sinha R, Tsai JM, Barkal AA, Shen KY, Jain R, Morganti RM, et al. (2016). Mapping the Pairwise Choices Leading from Pluripotency to Human Bone, Heart, and Other Mesoderm Cell Types. Cell 166, 451–467. 10.1016/j.cell.2016.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Oceguera-Yanez F, Kim S II, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, et al. (2016). Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods 101, 43–55. 10.1016/j.ymeth.2015.12.012. [DOI] [PubMed] [Google Scholar]
63.Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, and Zhang F (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281–2308. 10.1038/nprot.2013.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–1491. 10.1016/j.cell.2013.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, et al. (2016). Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. Elife 5, 1–20. 10.7554/eLife.19760. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Concordet JP, and Haeussler M (2018). CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res 46, W242–W245. 10.1093/nar/gky354. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Kabadi AM, Ousterout DG, Hilton IB, and Gersbach CA (2014). Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res 42, 1–11. 10.1093/nar/gku749. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Kodaka Y, Asakura Y, and Asakura A (2017). Spin infection enables efficient gene delivery to muscle stem cells. Biotechniques 63, 72–76. 10.2144/000114576. [DOI] [PMC free article] [PubMed] [Google Scholar]
69.Cattoglio C, Pustova I, Walther N, Ho JJ, Hantsche-Grininger M, Inouye CJ, Hossain MJ, Dailey GM, Ellenberg J, Darzacq X, et al. (2019). Determining cellular CTCF and cohesin abundances to constrain 3D genome models. Elife 8, 1–24. 10.7554/elife.40164. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Liao Y, Smyth GK, and Shi W (2014). FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930. 10.1093/bioinformatics/btt656. [DOI] [PubMed] [Google Scholar]
72.Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Koplev S, Jenkins SL, Jagodnik KM, Lachmann A, et al. (2016). Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res 44, W90–W97. 10.1093/nar/gkw377. [DOI] [PMC free article] [PubMed] [Google Scholar]
74.Skene PJ, and Henikoff S (2017). An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife 6, 1–35. 10.7554/eLife.21856. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, and Glass CK (2010). Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576–589. 10.1016/j.molcel.2010.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
76.ENCDOE (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57–74. 10.1038/nature11247. [DOI] [PMC free article] [PubMed] [Google Scholar]
77.Quinlan AR, and Hall IM (2010). BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Kent WJ, Zweig AS, Barber G, Hinrichs AS, and Karolchik D (2010). BigWig and BigBed: Enabling browsing of large distributed datasets. Bioinformatics 26, 2204–2207. 10.1093/bioinformatics/btq351. [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Pohl A, and Beato M (2014). bwtool: a tool for bigWig files. Bioinformatics 30, 1618–1619. 10.1093/bioinformatics/btu056. [DOI] [PMC free article] [PubMed] [Google Scholar]
80.Schessner JP, Voytik E, and Bludau I (2022). A practical guide to interpreting and generating bottom-up proteomics data visualizations. Proteomics 22, 1–18. 10.1002/pmic.202100103. [DOI] [PubMed] [Google Scholar]
81.Wang H, Xu X, Nguyen CM, Liu Y, Gao Y, Lin X, Daley T, Kipniss NH, La Russa M, and Qi LS (2018). CRISPR-Mediated Programmable 3D Genome Positioning and Nuclear Organization. Cell 175, 1405–1417.e14. 10.1016/j.cell.2018.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
82.Kanda T, Sullivan KF, and Wahl GM (1998). Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Current Biology, 8, 377–385. 10.1016/s0960-9822(98)70156-3. [DOI] [PubMed] [Google Scholar]
83.Aubrey BJ, Kelly GL, Kueh AJ, Brennan MS, O’Connor L, Milla L, Wilcox S, Tai L, Strasser A, and Herold MJ (2015). An Inducible Lentiviral Guide RNA Platform Enables the Identification of Tumor-Essential Genes and Tumor-Promoting Mutations InVivo. Cell Rep 10, 1422–1432. 10.1016/j.celrep.2015.02.002. [DOI] [PubMed] [Google Scholar]
84.Shi J, Wang E, Milazzo JP, Wang Z, Kinney JB, and Vakoc CR (2015). Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat Biotechnol 33, 661–667. 10.1038/nbt.3235. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17, 10. 10.14806/ej.17.1.200. [DOI] [Google Scholar]
86.Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, and Davies RM (2021). Twelve years of SAMtools and BCFtools. Gigascience 10. 10.1093/gigascience/giab008. [DOI] [PMC free article] [PubMed] [Google Scholar]
87.Thorvaldsdóttir H, Robinson JT, and Mesirov JP (2013). Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192. 10.1093/bib/bbs017. [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Cox J, Neuhauser N, Michalski A, Scheltema RA, Olsen JV, and Mann M (2011). Andromeda: A peptide search engine integrated into the MaxQuant environment. J Proteome Res 10, 1794–1805. 10.1021/pr101065j. [DOI] [PubMed] [Google Scholar]
89.Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, and Cox J (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Preprint at Nature Publishing Group, 10.1038/nmeth.3901 10.1038/nmeth.3901. [DOI] [PubMed] [Google Scholar]
90.Erdfelder E, Faul F, Buchner A, and Lang AG (2009). Statistical power analyses using G*Power 3.1: Tests for correlation and regression analyses. Behav Res Methods 41, 1149–1160. 10.3758/BRM.41.4.1149. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS1953637-supplement-1.pdf^{(8MB, pdf)}

NIHMS1953637-supplement-2.xlsx^{(5.9MB, xlsx)}

NIHMS1953637-supplement-3.xlsx^{(1.8MB, xlsx)}

Data Availability Statement

Raw data from Figures 4, 6, S1, S3, S4, S6, and S8 were deposited on Mendeley at http://dx.doi.org/10.17632/tz24fxbfgn.1. All sequencing data are available through GEO accession number GSE215436.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

[R1] 1.Iwafuchi-Doi M, and Zaret KS (2014). Pioneer transcription factors in cell reprogramming. Genes Dev 28, 2679–2692. 10.1101/gad.253443.114. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] 2.Wang A, Yue F, Li Y, Xie R, Harper T, Patel NA, Muth K, Palmer J, Qiu Y, Wang J, et al. (2015). Epigenetic Priming of Enhancers Predicts Developmental Competence of hESC-Derived Endodermal Lineage Intermediates. Cell Stem Cell 16, 386–399. 10.1016/j.stem.2015.02.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] 3.Genga RMJ, Kernfeld EM, Parsi KM, Parsons TJ, Ziller MJ, and Maehr R (2019). Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development. Cell Rep 27, 708–718.e10. 10.1016/j.celrep.2019.03.076. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] 4.Lee K, Cho H, Rickert RW, Li QV, Pulecio J, Leslie CS, and Huangfu D (2019). FOXA2 Is Required for Enhancer Priming during Pancreatic Differentiation. Cell Rep 28, 382–393.e7. 10.1016/j.celrep.2019.06.034. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] 5.Geusz RJ, Wang A, Lam DK, Vinckier NK, Alysandratos KD, Roberts DA, Wang J, Kefalopoulou S, Ramirez A, Qiu Y, et al. (2021). Sequence logic at enhancers governs a dual mechanism of endodermal organ fate induction by FOXA pioneer factors. Nat Commun 12, 1–19. 10.1038/s41467-021-26950-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R6] 6.Takahashi K, and Yamanaka S (2006). Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 126, 663–676. 10.1016/j.cell.2006.07.024. [DOI] [PubMed] [Google Scholar]

[R7] 7.Soufi A, Donahue G, and Zaret KS (2012). Facilitators and impediments of the pluripotency reprogramming factors’ initial engagement with the genome. Cell 151, 994–1004. 10.1016/j.cell.2012.09.045. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R8] 8.Horisawa K, and Suzuki A (2020). Direct cell-fate conversion of somatic cells: Toward regenerative medicine and industries. Proc Jpn Acad Ser B Phys Biol Sci 96, 131–158. 10.2183/PJAB.96.012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R9] 9.Inada H, Udono M, Matsuda-Ito K, Horisawa K, Ohkawa Y, Miura S, Goya T, Yamamoto J, Nagasaki M, Ueno K, et al. (2020). Direct reprogramming of human umbilical vein- and peripheral blood-derived endothelial cells into hepatic progenitor cells. Nat Commun 11, 5292. 10.1038/s41467-020-19041-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] 10.Morris SA, Cahan P, Li H, Zhao AM, San Roman AK, Shivdasani RA, Collins JJ, and Daley GQ (2014). Dissecting Engineered Cell Types and Enhancing Cell Fate Conversion via CellNet. Cell 158, 889–902. 10.1016/j.cell.2014.07.021. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] 11.Cahan P, Li H, Morris SA, Lummertz da Rocha E, Daley GQ, and Collins JJ (2014). CellNet: Network Biology Applied to Stem Cell Engineering. Cell 158, 903–915. 10.1016/j.cell.2014.07.020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] 12.Kim JJ, and Kingston RE (2022). Context-specific Polycomb mechanisms in development. Nat Rev Genet. 10.1038/s41576-022-00499-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] 13.Blackledge NP, and Klose RJ (2021). The molecular principles of gene regulation by Polycomb repressive complexes. Nat Rev Mol Cell Biol 22, 815–833. 10.1038/s41580-021-00398-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] 14.Piunti A, and Shilatifard A (2021). The roles of Polycomb repressive complexes in mammalian development and cancer. Nat Rev Mol Cell Biol 22. 10.1038/s41580-021-00341-1. [DOI] [PubMed] [Google Scholar]

[R15] 15.Yu J, Lee C, Oksuz O, Stafford JM, and Reinberg D (2019). PRC2 is high maintenance. Genes Dev, 1–33. 10.1101/gad.325050.119. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] 16.Kuroda MI, Kang H, De S, and Kassis JA (2020). Dynamic Competition of Polycomb and Trithorax in Transcriptional Programming. Annu Rev Biochem 89, 235–253. 10.1146/annurev-biochem-120219-103641. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] 17.Blanco E, González-Ramírez M, Alcaine-Colet A, Aranda S, and Di Croce L (2020). The Bivalent Genome: Characterization, Structure, and Regulation. Trends in Genetics 36, 118–131. 10.1016/j.tig.2019.11.004. [DOI] [PubMed] [Google Scholar]

[R18] 18.Schuettengruber B, Bourbon H-M, Di Croce L, and Cavalli G (2017). Genome Regulation by Polycomb and Trithorax: 70 Years and Counting. Cell 171, 34–57. 10.1016/j.cell.2017.08.002. [DOI] [PubMed] [Google Scholar]

[R19] 19.Rada-Iglesias A, Bajpai R, Swigut T, Brugmann S. a., Flynn R. a., and Wysocka J (2011). A unique chromatin signature uncovers early developmental enhancers in humans. Nature 470, 279–283. 10.1038/nature09692. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R20] 20.Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315–326. 10.1016/j.cell.2006.02.041. [DOI] [PubMed] [Google Scholar]

[R21] 21.Blanco E, González-Ramírez M, Alcaine-Colet A, Aranda S, and Di Croce L (2020). The Bivalent Genome: Characterization, Structure, and Regulation. Trends in Genetics 36, 118–131. 10.1016/j.tig.2019.11.004. [DOI] [PubMed] [Google Scholar]

[R22] 22.Reizel Y, Morgan A, Gao L, Lan Y, Manduchi E, Waite EL, Wang AW, Wells A, and Kaestner KH (2020). Collapse of the hepatic gene regulatory network in the absence of FoxA factors. Genes Dev, 1–12. 10.1101/gad.337691.120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] 23.Lee CS, Friedman JR, Fulmer JT, and Kaestner KH (2005). The initiation of liver development is dependent on Foxa transcription factors. Nature 435, 944–947. 10.1038/nature03649. [DOI] [PubMed] [Google Scholar]

[R24] 24.Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan AH, Miyaoka Y, Holmes K, Spencer CI, et al. (2016). CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs. Cell Stem Cell 18, 541–553. 10.1016/j.stem.2016.01.022. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Ang LT, Tan AKY, Autio MI, Goh SH, Choo SH, Lee KL, Tan J, Pan B, Lee JJH, Lum JJ, et al. (2018). A Roadmap for Human Liver Differentiation from Pluripotent Stem Cells. Cell Rep 22, 2094–2106. 10.1016/j.celrep.2018.01.087. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] 26.McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM, and Bejerano G (2010). GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol 28, 495–501. 10.1038/nbt.1630. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] 27.Kurimoto K, Yabuta Y, Hayashi K, Ohta H, Kiyonari H, Mitani T, Moritoki Y, Kohri K, Kimura H, Yamamoto T, et al. (2015). Quantitative dynamics of chromatin remodeling during germ cell specification from mouse embryonic stem cells. Cell Stem Cell 16, 517–532. 10.1016/j.stem.2015.03.002. [DOI] [PubMed] [Google Scholar]

[R28] 28.Irie N, Weinberger L, Tang WWC, Kobayashi T, Viukov S, Manor YS, Dietmann S, Hanna JH, and Surani MA (2015). SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate. Cell 160, 253–268. 10.1016/j.cell.2014.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R29] 29.Ohinata Y, Payer B, O’Carroll D, Ancelin K, Ono Y, Sano M, Barton SC, Obukhanych T, Nussenzweig M, Tarakhovsky A, et al. (2005). Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436, 207–213. 10.1038/nature03813. [DOI] [PubMed] [Google Scholar]

[R30] 30.Martins G, and Calame K (2008). Regulation and functions of Blimp-1 in T and B lymphocytes. Annu Rev Immunol 26, 133–169. 10.1146/annurev.immunol.26.021607.090241. [DOI] [PubMed] [Google Scholar]

[R31] 31.Minnich M, Tagoh H, Bönelt P, Axelsson E, Fischer M, Cebolla B, Tarakhovsky A, Nutt SL, Jaritz M, and Busslinger M (2016). Multifunctional role of the transcription factor Blimp-1 in coordinating plasma cell differentiation. Nat Immunol 17, 331–343. 10.1038/ni.3349. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] 32.Jozwik KM, Chernukhin I, Serandour AA, Nagarajan S, and Carroll JS (2016). FOXA1 Directs H3K4 Monomethylation at Enhancers via Recruitment of the Methyltransferase MLL3. Cell Rep 17, 2715–2723. 10.1016/j.celrep.2016.11.028. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] 33.Vermunt MW, Luan J, Zhang Z, Thrasher AJ, Huang A, Saari MS, Khandros E, Beagrie RA, Zhang S, Vemulamada P, et al. (2023). Gene silencing dynamics are modulated by transiently active regulatory elements. Mol Cell 83, 715–730.e6. 10.1016/j.molcel.2023.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] 34.Bornelöv S, Reynolds N, Xenophontos M, Gharbi S, Johnstone E, Floyd R, Ralser M, Signolet J, Loos R, Dietmann S, et al. (2018). The Nucleosome Remodeling and Deacetylation Complex Modulates Chromatin Structure at Sites of Active Transcription to Fine-Tune Gene Expression. Mol Cell 71, 56–72.e4. 10.1016/j.molcel.2018.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] 35.Signolet J, and Hendrich B (2015). The function of chromatin modifiers in lineage commitment and cell fate specification. FEBS Journal 282, 1692–1702. 10.1111/febs.13132. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] 36.Pantier R, Chhatbar K, Quante T, Skourti-Stathaki K, Cholewa-Waclaw J, Alston G, Alexander-Howden B, Lee HY, Cook AG, Spruijt CG, et al. (2021). SALL4 controls cell fate in response to DNA base composition. Mol Cell 81, 845–858.e8. 10.1016/j.molcel.2020.11.046. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] 37.Lu J, Jeong H, Kong N, Yang Y, Carroll J, Luo HR, Silberstein LE, Ma Y, and Chai L (2009). Stem cell factor SALL4 represses the transcriptions of PTEN and SALL1 through an epigenetic repressor complex. PLoS One 4, 1–13. 10.1371/journal.pone.0005577. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] 38.Lauberth SM, and Rauchman M (2006). A conserved 12-amino acid motif in Sall1 recruits the nucleosome remodeling and deacetylase corepressor complex. Journal of Biological Chemistry 281, 23922–23931. 10.1074/jbc.M513461200. [DOI] [PubMed] [Google Scholar]

[R39] 39.Oliviero G, Brien GL, Waston A, Streubel G, Jerman E, Andrews D, Doyle B, Munawar N, Wynne K, Crean J, et al. (2016). Dynamic protein interactions of the polycomb repressive complex 2 during differentiation of pluripotent cells. Molecular and Cellular Proteomics 15, 3450–3460. 10.1074/mcp.M116.062240. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] 40.Iwafuchi-Doi M, Donahue G, Kakumanu A, Watts JA, Mahony S, Pugh BF, Lee D, Kaestner KH, and Zaret KS (2016). The Pioneer Transcription Factor FoxA Maintains an Accessible Nucleosome Configuration at Enhancers for Tissue-Specific Gene Activation. Mol Cell 62, 79–91. 10.1016/j.molcel.2016.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] 41.Lim H-W, and Iwafuchi M (2023). Profiling Accessible Chromatin and Nucleosomes in the Mammalian Genome. Methods Mol Biol 2599, 59–68. 10.1007/978-1-0716-2847-8 [DOI] [PubMed] [Google Scholar]

[R42] 42.Reynolds N, Salmon-Divon M, Dvinge H, Hynes-Allen A, Balasooriya G, Leaford D, Behrens A, Bertone P, and Hendrich B (2012). NuRD-mediated deacetylation of H3K27 facilitates recruitment of Polycomb Repressive Complex 2 to direct gene repression. EMBO Journal 31, 593–605. 10.1038/emboj.2011.431. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Mukherjee S, Luedeke DM, McCoy L, Iwafuchi M, and Zorn AM (2022). SOX transcription factors direct TCF-independent WNT/β-catenin responsive transcription to govern cell fate in human pluripotent stem cells. Cell Rep 40, 111247. 10.1016/j.celrep.2022.111247. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] 44.Hurlstone A, and Clevers H (2002). T-cell factors: Turn-ons and turn-offs. Preprint, 10.1093/emboj/21.10.2303 10.1093/emboj/21.10.2303. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R45] 45.Sekiya T, and Zaret KS (2007). Repression by Groucho/TLE/Grg proteins: genomic site recruitment generates compacted chromatin in vitro and impairs activator binding in vivo. Mol Cell 28, 291–303. 10.1016/j.molcel.2007.10.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] 46.Ren B, Chee KJ, Kim TH, and Maniatis T (1999). PRDI-BF1/Blimp-1 repression is mediated by corepressors of the Groucho family of proteins. Genes Dev 13, 125–137. 10.1101/gad.13.1.125. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] 47.Shariati SA, Dominguez A, Xie S, Wernig M, Qi LS, and Skotheim JM (2019). Reversible Disruption of Specific Transcription Factor-DNA Interactions Using CRISPR/Cas9. Mol Cell 74, 622–633.e4. 10.1016/j.molcel.2019.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] 48.Endoh M, Endo TA, Endoh T, Fujimura YI, Ohara O, Toyoda T, Otte AP, Okano M, Brockdorff N, Vidal M, et al. (2008). Polycomb group proteins Ring1A/B are functionally linked to the core transcriptional regulatory circuitry to maintain ES cell identity. Development 135, 1513–1524. 10.1242/dev.014340. [DOI] [PubMed] [Google Scholar]

[R49] 49.Yamamoto M, Suwa Y, Sugiyama K, Okashita N, Kawaguchi M, Tani N, Matsubara K, Nakamura A, and Seki Y (2020). PRDM14-CtBP1/2-PRC2 complex regulates transcriptional repression during transition from primed to naïve pluripotency. J Cell Sci, jcs.240176. 10.1242/jcs.240176. [DOI] [PubMed] [Google Scholar]

[R50] 50.Ma Z, Swigut T, Valouev A, Rada-Iglesias A, and Wysocka J (2011). Sequence-specific regulator Prdm14 safeguards mouse ESCs from entering extraembryonic endoderm fates. Nat Struct Mol Biol 18, 120–128. 10.1038/nsmb.2000. [DOI] [PubMed] [Google Scholar]

[R51] 51.Yamaji M, Ueda J, Hayashi K, Ohta H, Yabuta Y, Kurimoto K, Nakato R, Yamada Y, Shirahige K, and Saitou M (2013). PRDM14 Ensures Naive Pluripotency through Dual Regulation of Signaling and Epigenetic Pathways in Mouse Embryonic Stem Cells. Cell Stem Cell 12, 368–382. 10.1016/j.stem.2012.12.012. [DOI] [PubMed] [Google Scholar]

[R52] 52.Nady N, Gupta A, Ma Z, Swigut T, Koide A, Koide S, and Wysocka J (2015). ETO family protein Mtgr1 mediates Prdm14 functions in stem cell maintenance and primordial germ cell formation. Elife 4, 1–28. 10.7554/eLife.10150. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R53] 53.Tu S, Narendra V, Yamaji M, Vidal SE, Rojas LA, Wang X, Kim SY, Garcia BA, Tuschl T, Stadtfeld M, et al. (2016). Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature 534, 387–390. 10.1038/nature18004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] 54.Chia NY, Chan YS, Feng B, Lu X, Orlov YL, Moreau D, Kumar P, Yang L, Jiang J, Lau MS, et al. (2010). A genome-wide RNAi screen reveals determinants of human embryonic stem cell identity. Nature 468, 316–320. 10.1038/nature09531. [DOI] [PubMed] [Google Scholar]

[R55] 55.Gifford CA, Ziller MJ, Gu H, Trapnell C, Donaghey J, Tsankov A, Shalek AK, Kelley DR, Shishkin AA, Issner R, et al. (2013). Transcriptional and epigenetic dynamics during specification of human embryonic stem cells. Cell 153, 1149–1163. 10.1016/j.cell.2013.04.037. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R56] 56.Xie R, Everett LJ, Lim H, Patel NA, Schug J, Kroon E, Kelly OG, Wang A, D’Amour KA, Robins AJ, et al. (2013). Dynamic chromatin remodeling mediated by polycomb proteins orchestrates pancreatic differentiation of human embryonic stem cells. Cell Stem Cell 12, 224–237. 10.1016/j.stem.2012.11.023. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] 57.Buecker C, and Wysocka J (2012). Enhancers as information integration hubs in development: Lessons from genomics. Trends in Genetics 28, 276–284. 10.1016/j.tig.2012.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R58] 58.Watts JA, Zhang C, Klein-Szanto AJ, Kormish JD, Fu J, Zhang MQ, and Zaret KS (2011). Study of FoxA Pioneer Factor at Silent Genes Reveals Rfx-Repressed Enhancer at Cdx2 and a Potential Indicator of Esophageal Adenocarcinoma Development. PLoS Genet 7, e1002277. 10.1371/journal.pgen.1002277. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R59] 59.McCracken KW, Catá EM, Crawford CM, Sinagoga KL, Schumacher M, Rockich BE, Tsai Y-H, Mayhew CN, Spence JR, Zavros Y, et al. (2014). Modelling human development and disease in pluripotent stem-cell-derived gastric organoids. Nature 516, 400–404. 10.1038/nature13863. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R60] 60.Loh KM, Ang LT, Zhang J, Kumar V, Ang J, Auyeong JQ, Lee KL, Choo SH, Lim CYY, Nichane M, et al. (2014). Efficient endoderm induction from human pluripotent stem cells by logically directing signals controlling lineage bifurcations. Cell Stem Cell 14, 237–252. 10.1016/j.stem.2013.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] 61.Loh KM, Chen A, Koh PW, Deng TZ, Sinha R, Tsai JM, Barkal AA, Shen KY, Jain R, Morganti RM, et al. (2016). Mapping the Pairwise Choices Leading from Pluripotency to Human Bone, Heart, and Other Mesoderm Cell Types. Cell 166, 451–467. 10.1016/j.cell.2016.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R62] 62.Oceguera-Yanez F, Kim S II, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, et al. (2016). Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods 101, 43–55. 10.1016/j.ymeth.2015.12.012. [DOI] [PubMed] [Google Scholar]

[R63] 63.Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, and Zhang F (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281–2308. 10.1038/nprot.2013.143. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R64] 64.Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–1491. 10.1016/j.cell.2013.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R65] 65.Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, et al. (2016). Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. Elife 5, 1–20. 10.7554/eLife.19760. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] 66.Concordet JP, and Haeussler M (2018). CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res 46, W242–W245. 10.1093/nar/gky354. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] 67.Kabadi AM, Ousterout DG, Hilton IB, and Gersbach CA (2014). Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res 42, 1–11. 10.1093/nar/gku749. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R68] 68.Kodaka Y, Asakura Y, and Asakura A (2017). Spin infection enables efficient gene delivery to muscle stem cells. Biotechniques 63, 72–76. 10.2144/000114576. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R69] 69.Cattoglio C, Pustova I, Walther N, Ho JJ, Hantsche-Grininger M, Inouye CJ, Hossain MJ, Dailey GM, Ellenberg J, Darzacq X, et al. (2019). Determining cellular CTCF and cohesin abundances to constrain 3D genome models. Elife 8, 1–24. 10.7554/elife.40164. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R70] 70.Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, and Gingeras TR (2013). STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21. 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R71] 71.Liao Y, Smyth GK, and Shi W (2014). FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930. 10.1093/bioinformatics/btt656. [DOI] [PubMed] [Google Scholar]

[R72] 72.Love MI, Huber W, and Anders S (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R73] 73.Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Koplev S, Jenkins SL, Jagodnik KM, Lachmann A, et al. (2016). Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res 44, W90–W97. 10.1093/nar/gkw377. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R74] 74.Skene PJ, and Henikoff S (2017). An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife 6, 1–35. 10.7554/eLife.21856. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R75] 75.Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, and Glass CK (2010). Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576–589. 10.1016/j.molcel.2010.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R76] 76.ENCDOE (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57–74. 10.1038/nature11247. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R77] 77.Quinlan AR, and Hall IM (2010). BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R78] 78.Kent WJ, Zweig AS, Barber G, Hinrichs AS, and Karolchik D (2010). BigWig and BigBed: Enabling browsing of large distributed datasets. Bioinformatics 26, 2204–2207. 10.1093/bioinformatics/btq351. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R79] 79.Pohl A, and Beato M (2014). bwtool: a tool for bigWig files. Bioinformatics 30, 1618–1619. 10.1093/bioinformatics/btu056. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R80] 80.Schessner JP, Voytik E, and Bludau I (2022). A practical guide to interpreting and generating bottom-up proteomics data visualizations. Proteomics 22, 1–18. 10.1002/pmic.202100103. [DOI] [PubMed] [Google Scholar]

[R81] 81.Wang H, Xu X, Nguyen CM, Liu Y, Gao Y, Lin X, Daley T, Kipniss NH, La Russa M, and Qi LS (2018). CRISPR-Mediated Programmable 3D Genome Positioning and Nuclear Organization. Cell 175, 1405–1417.e14. 10.1016/j.cell.2018.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R82] 82.Kanda T, Sullivan KF, and Wahl GM (1998). Histone-GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Current Biology, 8, 377–385. 10.1016/s0960-9822(98)70156-3. [DOI] [PubMed] [Google Scholar]

[R83] 83.Aubrey BJ, Kelly GL, Kueh AJ, Brennan MS, O’Connor L, Milla L, Wilcox S, Tai L, Strasser A, and Herold MJ (2015). An Inducible Lentiviral Guide RNA Platform Enables the Identification of Tumor-Essential Genes and Tumor-Promoting Mutations InVivo. Cell Rep 10, 1422–1432. 10.1016/j.celrep.2015.02.002. [DOI] [PubMed] [Google Scholar]

[R84] 84.Shi J, Wang E, Milazzo JP, Wang Z, Kinney JB, and Vakoc CR (2015). Discovery of cancer drug targets by CRISPR-Cas9 screening of protein domains. Nat Biotechnol 33, 661–667. 10.1038/nbt.3235. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R85] 85.Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17, 10. 10.14806/ej.17.1.200. [DOI] [Google Scholar]

[R86] 86.Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, and Davies RM (2021). Twelve years of SAMtools and BCFtools. Gigascience 10. 10.1093/gigascience/giab008. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R87] 87.Thorvaldsdóttir H, Robinson JT, and Mesirov JP (2013). Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192. 10.1093/bib/bbs017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R88] 88.Cox J, Neuhauser N, Michalski A, Scheltema RA, Olsen JV, and Mann M (2011). Andromeda: A peptide search engine integrated into the MaxQuant environment. J Proteome Res 10, 1794–1805. 10.1021/pr101065j. [DOI] [PubMed] [Google Scholar]

[R89] 89.Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, and Cox J (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Preprint at Nature Publishing Group, 10.1038/nmeth.3901 10.1038/nmeth.3901. [DOI] [PubMed] [Google Scholar]

[R90] 90.Erdfelder E, Faul F, Buchner A, and Lang AG (2009). Statistical power analyses using G*Power 3.1: Tests for correlation and regression analyses. Behav Res Methods 41, 1149–1160. 10.3758/BRM.41.4.1149. [DOI] [PubMed] [Google Scholar]

PERMALINK

Pioneer and PRDM transcription factors coordinate bivalent epigenetic states to safeguard cell fate

Satoshi Matsui

Marissa Granitto

Morgan Buckley

Katie Ludwig

Sandra Koigi

Joseph Shiley

William J Zacharias

Christopher N Mayhew

Hee-Woong Lim

Makiko Iwafuchi

SUMMARY

eTOC Blurb

Graphical Abstract:

INTRODUCTION

RESULTS

Pioneer TF FOXA prevents alternative-lineage and precocious gene expression during human foregut endoderm development.

Figure 1. Pioneer TF FOXA prevents alternative-lineage and precocious gene expression during human foregut endoderm development.

FOXA recruits PRDM1 to prevent precocious and alternative-lineage gene expression.

Figure 2. FOXA recruits PRDM1 to prevent precocious and alternative-lineage gene expression.

FOXA and PRDM1 interact with NuRD complex and establish highly occupied, accessible nucleosome conformation.

Figure 3. FOXA and PRDM1 interact with NuRD complex and establish highly occupied, accessible nucleosome conformations.

FOXA and PRDM1 cooperate to promote the recruitment of Polycomb repressive complexes and establish bivalent enhancers.

Figure 4. FOXA and PRDM1 cooperate to promote the recruitment of Polycomb repressive complexes and establish bivalent enhancers.

FOXA binding directly facilitates the recruitment of PRDM1 and epigenetic repressor for gene repression.

Figure 5. FOXA binding directly facilitate the recruitment of PRDM1 and epigenetic repressor for gene repression.

OCT4 and PRDM14 recruit PRC1/H2AK119ub1 for poising early developmental genes.

Figure 6. OCT4 and PRDM14 recruit PRC1/H2AK119ub1 for poising early developmental genes.

DISCUSSION

Limitations of the Study

STAR METHODS

RESOURCE AVAILABILITY

Lead contact

Materials Availability

Data and Code Availability

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Human induced pluripotent stem cell (hPSC) culture

METHOD DETAILS

hPSC to Endoderm, Mesoderm, and Neuroectoderm differentiation

Endoderm differentiation

Paraxial mesoderm differentiation

Neuroectoderm differentiation

Generation of Dox-inducible CRISPRi and CRISPRd hPSC lines

CRISPRi gRNA design and cloning into the gRNA-expression vector

Viral production, transduction, and establish FOXA-CRISPRi, PRDM1-CRISPRi, PRC1-CRISPRi and OCT4-CRISPRi monoclonal lines

Inhibition of PRC2 activity using the EZH2 inhibitor GSK126

CRISPRd gRNA design, cloning into the gRNA-expression vector, and establishing CRISPRd hPSC lines

Western blot assay

Co-Immunoprecipitation (co-IP)

Chromatin Immunoprecipitation (ChIP)

CUT&RUN

MNase treatment and DNA purification

RT-qPCR and ChIP-qPCR

Preparation and sequencing of ChIP-seq, CUT&RUN and MNase-seq libraries

RNA Sequencing (RNA-seq)

RNA-seq data analysis

CUT&RUN, ChIP-seq, and MNase-seq data analysis

Rapid immunoprecipitation mass spectrometry of endogenous proteins (RIME)

RIME data analysis

Quantification and statistical analysis

Supplementary Material

Highlights.

Acknowledgments:

Footnotes

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases