RALY participates in nerve trauma-induced nociceptive hypersensitivity through triggering eIF4G2 gene expression in primary sensory neurons

Abstract

Background and Purpose:

Peripheral nerve trauma-induced dysregulation of pain-associated genes in the primary sensory neurons of dorsal root ganglion (DRG) contributes to neuropathic pain genesis. RNA-binding proteins participate in gene transcription. We hypothesized that RALY, an RNA-binding protein, participated in nerve trauma-induced dysregulation of DRG pain-associated genes and nociceptive hypersensitivity.

Methods and Results:

Immunohistochemistry staining showed that RALY was expressed exclusively in the nuclei of DRG neurons. Peripheral nerve trauma caused by chronic constriction injury (CCI) of unilateral sciatic nerve produced time-dependent increases in the levels of Raly mRNA and RALY protein in injured DRG. Blocking this increase through DRG microinjection of adeno-associated virus 5 (AAV5)-expressing Raly shRNA reduced the CCI-induced elevation in the amount of eukaryotic initiation factor 4 gamma 2 (eIF4G2) mRNA and eIF4G2 protein in injured DRG and mitigated the development and maintenance of CCI-induced nociceptive hypersensitivity, without altering basal (acute) response to noxious stimuli and locomotor activity. Mimicking DRG increased RALY through DRG microinjection of AAV5 expressing Raly mRNA upregulated the expression of eIF4G2 mRNA and eIF4G2 protein in the DRG and led to hypersensitive responses to noxious stimuli in the absence of nerve trauma. Mechanistically, CCI promoted the binding of RALY to the promoter of eIF4G2 gene and triggered its transcriptional activity.

Conclusion and Implications:

Our findings indicate that RALY participates in nerve trauma-induced nociceptive hypersensitivity likely through transcriptionally triggering eIF4G2 expression in the DRG. RALY may be a potential target in neuropathic pain management.

1. Introduction

Neuropathic pain is a complex chronic neurological disorder with an incidence of 7-10% of the general population in the United States and Europe (Bouhassira, Lanteri-Minet, Attal, Laurent, & Touboul, 2008; Cohen & Mao, 2014; Torrance, Smith, Bennett, & Lee, 2006). It is estimated that over 100 billion dollars annually are costed on neuropathic pain-related health care and productivity loss in America alone (Gaskin & Richard, 2012). Total estimated direct and indirect costs of neuropathic pain per patient were €10,313 in France (69% of the total cost), €14,446 in Germany (78%), €9,305 in Italy (69%), €10,597 in Spain (67%), and €9,685 in the UK (57%) (Liedgens, Obradovic, De Courcy, Holbrook, & Jakubanis, 2016). Current medications for the management of this disorder include anticonvulsants, antidepressants, and opioids, but most of the patients still complain of insufficient pain relief and/or severe side effects because these medications are nonspecific with regard to the cause of neuropathic pain (Mao, Gold, & Backonja, 2011; Vorobeychik, Gordin, Mao, & Chen, 2011). The characterizations of neuropathic pain in clinic include intermittent or ongoing spontaneous pain, often burning in nature and exaggerated pain in response to innocuous stimuli (allodynia) or noxious stimuli (hyperalgesia). These long-lasting nociceptive hypersensitivities likely result from the nerve injury-induced dysregulation of pain-associated genes in the sensory neurons of dorsal root ganglion (DRG) (S. Du et al., 2022; Li et al., 2020; L. Liang, Lutz, Bekker, & Tao, 2015; Lutz, Bekker, & Tao, 2014; Wu, Bono, & Tao, 2019). Exploring the mechanisms of how these genes are dysregulated may open a new door for therapeutic treatments of neuropathic pain.

RALY (hnRNP-Associated with Lethal Yellow; also called hnRNPCL2) is a member of the heterogeneous nuclear ribonucleoprotein family of RNA-binding proteins with critical roles in mRNA splicing and metabolism (Tenzer et al., 2013). Several recent works showed that RALY might be associated with the different expression of the target genes at the mRNA and protein levels through its interaction with poly-U stretches (Ray et al., 2013; Rossi et al., 2017). Indeed, the co-sediment of RALY with ribosomes and polysomes in the cytoplasm may be related to its regulated mRNA and protein levels (Cornella et al., 2017). In fact, RALY primarily localizes in the nucleus, where it regulates the transcription of many genes (Cornella et al., 2017). Our previous study showed that RALY was expressed predominantly in DRG neuronal nuclei and upregulated in injured DRG on day 7 after peripheral nerve trauma (Pan et al., 2021). Nevertheless, whether this increase participates in nerve trauma-induced dysregulation of DRG pain-associated genes and nociceptive hypersensitivity is unknown.

In the present study, we first examined the distribution pattern of RALY in DRG neurons under normal conditions and temporal changes in the expression of DRG RALY after peripheral nerve trauma caused by chronic constriction injury (CCI) of unilateral sciatic nerve or unilateral fourth lumbar (L4) spinal nerve ligation (SNL). We then assessed whether DRG increased RALY participated in the induction and maintenance of CCI-induced nociceptive hypersensitivity. We finally elucidated how this increase contributed to CCI-induced nociceptive hypersensitivity.

2. Methods

2.1. Animal preparations

The experimental procedures were approved by the Animal Care and Use Committee at Rutgers New Jersey Medical School and in accordance with the ethical guidelines of the US National Institutes of Health and the International Association for the Study of Pain. The CD1 mice (7-8 weeks) were purchased from Charles River Laboratories (Wilmington, MA). To minimize intra- and inter-individual variability of behavioral outcome measures, mice were trained for 1–2 days before behavioral testing was carried out. All efforts were made to minimize animal suffering and reduce the number of animals used. The experimenters were blinded to treatment condition during behavioral testing.

2.2. Neuropathic pain models

The CCI-induced neuropathic pain model was carried out with minor modification as described previously (S. Du et al., 2022; Pan et al., 2021). Briefly, mice were placed under anesthesia with isoflurane. Unilateral sciatic nerve was exposed and loosely ligated with 7-0 silk thread at three sites with an interval of about 1 mm proximal to trifurcation of the sciatic nerve. Sham animals received an identical surgery but without ligation.

SNL-induced neuropathic pain model in mice was performed as described previously (S. Du et al., 2022; Pan et al., 2021). Briefly, after the mice were anesthetized with isoflurane, the left fourth lumbar (L4) transverse process was identified and then was removed. The underlying L4 spinal nerve was carefully isolated and tightly ligated with a 7-0 silk suture under a surgical microscope. The ligated nerve was then transected just distal to the ligature. The skin and muscles were closed in layers. Sham animals received an identical surgery but without ligation and transection.

2.3. Behavioral tests

Mechanical test was carried out as described previously (S. Du et al., 2022; Pan et al., 2021). Briefly, the mice were placed individually in a Plexiglas chamber on an elevated mesh screen and allowed to habituate for 30 min. The calibrated von Frey filaments (0.07 g and 0.4 g, Stoelting Co.) were used to stimulate the hind paw for 1-2 s and repeated 10 times on both hind paws with 5 min interval. A quick withdrawal of the paw was regarded as a positive response. Paw withdrawal frequency was calculated as follows: (number of paw withdrawals/10 trials) × 100%.

Heat test was performed as described (S. Du et al., 2022; Pan et al., 2021). Briefly, paw withdrawal latency to noxious heat was measured with a Model 336 Analgesia Meter (IITC Inc. Life Science Instruments. Woodland Hills, CA). The mice were placed in a Plexiglas chamber on a glass plate. A beam of light was emitted from the light box and applied on the middle of the plantar surface of each hind paw. A quick lift of the hind paw was regarded as a signal to turn off the light. The length of lighting beam time was defined as the paw withdrawal latency. For each side, five trials with 5-min interval time were carried out. A cutoff time of 20 s was used to avoid tissue damage.

Cold test was carried out by measuring paw withdrawal latencies to noxious cold (0 °C) using a cold aluminum plate as described (S. Du et al., 2022; Pan et al., 2021). Briefly, each mouse was placed in a Plexiglas chamber on the plate with continuous temperature monitoring by a thermometer. The length of time between the placement and the sign of mouse jumping was defined as the paw jumping latency. Each trial was repeated three times at 10-min intervals. A cutoff time of 20 s was used to avoid tissue damage.

Conditional place preference test was carried out as described (S. Du et al., 2022; Pan et al., 2021). Briefly, an apparatus with two Plexiglas chambers connected with an internal door (Med Associates Inc.) was used. One of the chambers was made of rough floor and walls with black and white horizontal stripes and another one was composed of a smooth floor and walls with black and white vertical stripes. Movement of the mice and time spent in each chamber were monitored by photobeam detectors installed along the chamber walls and automatically recorded in MED-PC IV CPP software. Mice were first preconditioned for 30 min with full access to two chambers to habituate them to the environment. At the end of the preconditioning phase, the basal duration time spent in each chamber was recorded within 15 min to check whether mice had a preexisting chamber bias. Animals spending more than 80% or less than 20% of the total time in any chamber were excluded from further testing. The conditioning protocol was performed for the following 3 days with the internal door closed. The mice first received an intrathecal injection of saline (5 μl) specifically paired with one conditioning chamber in the morning. Six hours later, lidocaine (0.8 % in 5 μl of saline) was given intrathecally paired with another conditioning chamber in the afternoon. Injection order of saline and lidocaine every day was switched. On the test day (at least 20 hours later) after the conditioning, the mice were placed in one chamber with free access to both chambers. The duration of time spent in each chamber was recorded for 15 min. Difference scores were calculated through subtracting preconditioning time by test time spent in the lidocaine chamber.

Spontaneous paw lifting and flinching/licking were examined according to previous reports (Hegazy, Rezq, & Fahmy, 2020; Labuz & Machelska, 2013; Murai et al., 2016). In brief, a mouse was placed in an open-topped transparent glass chamber and allowed to move freely for 20 min before being observed. Frequency of paw lifting, frequency of flinching/licking and duration of flinching/licking were calculated over periods of 7 minutes. Paw lifting associated with locomotion, rearing or body repositioning was excluded. The average score for three trials was calculated.

Locomotor functional tests, including placing, grasping, and righting reflexes, were carried out after the pain behavioral tests described above were completed. For the placing reflex, the hind limbs were placed slightly lower than the forelimbs and the dorsal surfaces of the hind paws were brought into contact with the edge of a table. Then, whether the hind paws were placed on the table surface reflexively was recorded. For the grasping reflex, animals were placed on a wire grid, and then whether or not the hind paws grasped the wire on was recorded. For the righting reflex, animals were placed on its back on a flat surface, and it was recorded whether mouse could immediately assume the normal upright position. Each trial was repeated five times in a 5-min interval and the score for each test was recorded by counting times of each normal reflex.

2.4. DRG microinjection

DRG microinjection was carried out as described previously (S. Du et al., 2022; Pan et al., 2021). Briefly, a dorsal midline incision was made in the lower lumbar region. Unilateral L3/4 articular processes were exposed and then removed. After the DRG was exposed, the adeno-associated virus 5 (AAV5) viral solution (1 μl, 2-6 × 10¹² GC/mL) was injected into the exposed L3/L4 DRGs with a glass micropipette connected to a Hamilton syringe. The pipette was removed 10 min after injection. The surgical field was irrigated with sterile saline and the skin incision closed with wound clips.

2.5. Cell culture and transfection

DRG neuronal cultures were prepared according to previously described methods (S. Du et al., 2022; Pan et al., 2021). For primary DRG neuronal cultures, 4-week-old CD1 mice were euthanized with isoflurane and all DRGs were collected in cold Neurobasal Medium (Gibco/ ThermoFisher Scientific) with 10% fetal bovine serum (JR Scientific, Woodland, CA), 100 units/ml Penicillin, 100 μg/ml Streptomycin (Quality Biological, Gaithersburg, MD) and then treated with enzyme solution (5 mg/ml dispase, 1 mg/ml collagenase type I in Hanks’ balanced salt solution (HBSS) without Ca²⁺ and Mg²⁺ (Gibco/ThermoFisher Scientific)). After trituration and centrifugation, dissociated cells were resuspended in mixed Neurobasal Medium and plated in a six-well plate coated with 50 μg/ml poly-D-lysine (Sigma, St. Louis, MO). The cells were incubated at 95% O₂, 5% CO₂, and 37 °C. About 8-10 μl of AAV5 solution (2-6 × 10¹² GC/mL) or siRNA (100 nM; mixed with lipofectamine 3000) were added to 2 ml medium in each well after 24 hours. The cells were collected 2 or 3 days later.

2.6. Quantitative real-time RT-PCR assay

Total RNA extraction and quantitative real-time RT-PCR were carried out as described (S. Du et al., 2022; Pan et al., 2021). Briefly, unilateral L3/L4 DRGs from two adult mice were collected and pooled together to achieve enough RNA. Total RNA was extracted by miRNeasy kit (Qiagen, Valencia, CA) according to manufacturer’s instructions, and reverse-transcribed using the ThermoScript Reverse Transcriptase (Invitrogen/Thermo Fisher Scientific) with oligo (dT) or random primers (Invitrogen/Thermo Fisher Scientific). Template (1 μl) was amplified in a Bio-Rad CFX96 real-time PCR system using specific primers listed on Table 1. Each sample was run in triplicate in a 20μl reaction volume containing 250 nM forward and reverse primers, 10 μl of SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories), and 20 ng of cDNA. The PCR amplification consisted of 30 s at 95°C, 30 s at 60°C, 30 s at 72°C, and 5 min at 72°C for 39 cycles. Ratios of mRNA levels at other time points to those at day 0 were calculated by using the △Ct method (2^−△△Ct) after normalization to the corresponding Tuba-1a as it has been demonstrated to be stable even after peripheral nerve injury insult in mice as shown previously.

Table 1.

All primers used.

Names	Sequences (5’-3’)
Real-time RT-PCR
Raly F	ATTCAGACCAGCAATGTAACCAA
Raly R	CACAGAGCAACCAGCCACT
eIF4G2 F	AGTGCGATTGCAGAAGGGG
eIF4G2 R	GTGCTTCGTGCAGGAATCCA
Tuba1a F	GTGCATCTCCATCCATGTTG
Tuba1a R	GTGGGTTCCAGGTCTACGAA
Single cell RT-PCR
Raly F	GGCTTCCTCCAGACCTCG
Raly R	GCTCATTGGCATACTGGACA
eIF4G2 F	AAGATTCTTCGTTGTCAAGCC
eIG4G2 R	CTGCGGAGTTGTCATCTCGT
Gapdh F	GGTGAAGGTCGGTGTGAACG
Gapdh R	CTCGCTCCTGGAAGATGGTG
NeuN F	AGCCTGGGAACCCATATGCC
NeuN R	CATCCTGATACACGACCGCT
ChIP
eIF4G2 F	CGCTCTGCAAACACTTCTCA
eIF4G2 R	TTTGCTGAAGAGAGGGACGT
Plasmid Construction
Sense shRNA	GATCCATTCAGACCAGCAATGTAAGAAGCTTGTTACATTGCTGGTCTGAATTTTTTTT
Antisense shRNA	CTAGAAAAAAAATTCAGACCAGCAATGTAACAAGCTTCTTACATTGCTGGTCTGAATG
Raly F	ATATCCGGAGCCACCATGTCCTTGAAGATTCAGACC
Raly R	ATAGCGGCCGCTTACTGCAAGGCTCCATCTT
Luciferase assay
eIF4G2 F	CAGGGTACCTGTTCGTTACCAGCAGCACC
eIF4G2 R	GAGCTCGAGAACTTATCACTCTGAGGCGGC

2.7. Single cell real-time RT-PCR assay

Single cell real-time RT-PCR was performed according to manufacturer’s protocol. Briefly, freshly dissociated mouse DRG neurons from adult mice were prepared as described above. Four hours after plating, a single living DRG neuron (large: > 35 μm; medium: 25-35 μm; small: < 25 μm) was collected into a PCR tube containing 10 μl of cell lysis buffer (Signosis, Sunnyvale, CA) under an inverted microscope fit with a micromanipulator and microinjector. After centrifugation, the supernatants were collected and aliquoted into 4 PCR tubes. The real-time RT-PCR was performed by using specific primers (listed in Table 1) with the single-cell RT-PCR assay kit (Signosis). The PCR products were loaded on 2% agarose gels and stained with ethidium bromide.

2.8. Plasmid construction and virus production

A Raly shRNA duplex was designed corresponding to bases 13-36 of the mouse Raly mRNA (GenBank accession number NM_001139511.1). The oligonucleotides harboring the shRNA sequences were synthesized and annealed. A mismatched shRNA with a scrambled sequence and no known homology to a mouse gene (scrambled shRNA) was used as a control. The fragments were ligated into the pro-viral plasmid (pAAV-U6-shRNA) by BamH1/XbaI restriction sites. To construct the plasmid expressing RALY protein, the full-length sequence of Raly mRNA from mouse DRG was reverse-transcribed and amplified by PCR and primers (listed in Table 1). The resulting segment was digested by BspEI and NotI and then inserted into the pro-viral plasmid (pAAV-MCS). All recombinant clones were verified by using DNA sequencing. To produce viral particles, the recombinant viral vectors and packaging vectors were co-transfected into HEK-293T cells. AAV particles were harvested and purified by using AAV pro Purification kit (Takara, CA).

2.9. Chromatin immunoprecipitation (ChIP) assay

ChIP was carried out as described previously (S. Du et al., 2022; Pan et al., 2021) by using the EZ-ChIP kit (Upstate/EMD Millipore) with minor modifications. Briefly, unilateral L3/4 DRGs from two adult mice were collected rapidly and pooled together. Tissues were homogenized in chilled lysis buffer (10 mM Tris, 1 mM phenylmethylsulfonyl fluoride, 5 mM MgCl₂, 5 mM EGTA, 1 mM EDTA, 1 mM DTT, 40 μM leupeptin, 250 mM sucrose) with protease inhibitor cocktail and sonicated until the DNA was broken into fragments with a mean length of 200 to 1000 base pairs. After the lysates were precleared with Protein G-agarose, they (250 μg/sample) were incubated with 1 μg of rabbit anti-RALY (Abcam) or 2 μg of normal rabbit serum at 4°C overnight. About 10-20% of the total lysate was used as input (a positive control). The DNA fragments were purified and identified using PCR with the primers listed in Table 1. The PCR products were identified as described above.

2.10. Luciferase assay

The 1603-bp fragment (−1627 to −24) of the eIF4G2 gene promoter region was amplified based on the genomic DNA using the primers (listed in Table 1) to manufacture reporter plasmid. The PCR products were inserted into the firefly luciferase reporter gene-containing pGL3-Basic vector by adopting Xho-I and Kpn-I restriction sites. DNA sequencing was performed later to confirm recombinant plasmid sequences. The CAD cells were co-transfected with 300 ng of pGL3-Basic vector with or without the sequences of eIF4G2 promoter, 300 ng of Raly overexpression plasmid and 10 ng of the pRL-TK (Promega) by using Lipofectamine 3000 (Invitrogen). The cells were harvested in a passive lysis buffer 48 h after transfection. The luciferase activity was measured by using the Dual-Luciferase Reporter Assay System (Promega). The experiments were carried out in triplicate and repeated with at least 3 separate batches of culture per group. The relative reporter activity was calculated after normalization of the firefly activity to renilla activity.

2.11. Western blot analysis

Western blotting was conducted the experimental detail provided conform with BJP guidelines (Alexander et al., 2018). Two unilateral L3/4 DRGs from two mice were pooled together to achieve enough proteins. The cultured cells or the homogenized tissue from L3/4 DRGs or L3/4 spinal cord were ultrasonicated in chilled lysis buffer (10 mM Tris, 1 mM phenylmethylsulfonyl fluoride, 5 mM MgCl₂, 5 mM EGTA, 1 mM EDTA, 1mM DTT, 40 μM leupeptin, 250 mM sucrose). The lysate was centrifuged at 4 °C for 15 min at 1,000 g. The supernatant was collected for cytosolic/membrane proteins and the pellet for nuclear proteins. After the concentrations of the proteins in the samples were measured using the Bio-Rad protein assay (Bio-Rad), the samples were heated at 99 °C for 5 min and loaded onto a 4-15% stacking/7.5% separating SDS-polyacrylamide gel (Bio-Rad). The proteins were then electrophoretically transferred onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad). Based on the molecular weights of the proteins, some blot membranes were cut into two or three pieces. Each membrane piece was first blocked with 5% nonfat milk in Tris-buffered saline containing 0.1% Tween-20 for 1 h at room temperature and then incubated at 4°C overnight, respectively, with the following primary antibodies: rabbit anti-RALY (Abcam Cat# ab170105, RRID:AB_3065023), rabbit anti-eIF4G2 (Cell Signaling Technology Cat# 2013, RRID:AB_2097363), rabbit anti-GAPDH (Santa Cruz Biotechnology Cat# sc-25778, RRID:AB_10167668), mouse anti-H3 (Santa Cruz Biotechnology Cat# sc-517576, RRID:AB_2848194), mouse anti-GFAP (Abcam Cat# ab279290, RRID:AB_2920668), rabbit anti-phosphorylated ERK1/2 (Cell Signaling Technology Cat# 9101, RRID:AB_331646), rabbit anti-total ERK1/2 (Cell Signaling Technology Cat# 4695, RRID:AB_390779). The proteins were detected by horseradish peroxidase–conjugated anti-mouse or anti-rabbit secondary antibody (1:3,000; Jackson ImmunoResearch) and visualized by western peroxide reagent and luminol/enhancer reagent (Clarity Western ECL Substrate, Bio-Rad) and exposure using ChemiDoc XRS and System with Image Lab software (Bio-Rad). The intensity of blots was quantified with densitometry using Image Lab software (Bio-Rad). All cytosol protein bands were normalized to GAPDH, whereas all nucleus protein to total histone H3.

2.12. Immunohistochemistry

Immunohistochemistry was carried out as previously described (S. Du et al., 2022; Pan et al., 2021) and conducted the experimental detail provided conform with BJP guidelines (Alexander et al., 2018). Briefly, mice were deeply anaesthetized with isoflurane and transcardially perfused with 25-30 ml of 0.1M phosphate-buffered saline (PBS, pH 7.4) followed by 30-50 ml of 4% paraformaldehyde in 0.1 M PBS. Following perfusion, L3/4 DRGs or L3/4 spinal cord were harvested, post-fixed for 4-6 h at 4 °C in the same fixative and cryoprotected in 30% sucrose overnight. A series of 15-μm transverse sections were cut on a cryostat. After being blocked for 1 hour at room temperature in PBS containing 5% goat serum and 0.3% TritonX-100, the sections were incubated with rabbit anti-RALY (1:2,500, Abcam), chicken anti-β-tubulin III (Millipore Cat# AB9354, RRID:AB_570918), rabbit anti-NF200 (Sigma-Aldrich Cat# N4142, RRID:AB_477272), biotinylated IB4 (Sigma-Aldrich Cat# L2140, RRID:AB_2313663), and mouse anti-CGRP (Abcam Cat# ab81887, RRID:AB_1658411), mouse anti-glutamine synthetase (Millipore Cat# MAB302, RRID:AB_2110656), mouse anti-Iba1 (Sigma-Aldrich Cat# SAB2702364, RRID:AB_2820253), rat anti-CD3 (Thermo Fisher Scientific Cat# 14-0032-82, RRID:AB_467053) or rat anti-CD68 (Thermo Fisher Scientific Cat# 14-0681-82, RRID:AB_2572857) at 4°C overnight. The sections were incubated with species-appropriate Cy3-conjucted secondary antibody (1:500, Jackson ImmunoResearch) or with FITC-labeled Avidin D (1:200, Sigma) for 2 hour at room temperature. The sections were finally washed and mounted using VectaMount permanent mounting medium (Vector Laboratories, Burlingame, CA). Images were taken with a Leica DMI4000 fluorescence microscope (Leica) with DFC365 FX camera (Leica) and analyzed using NIH Image J software.

2.13. Statistical analysis

The Studies were designed to generate groups of equal size, using randomization and blinded analysis. All results are given as means ± SEM. The statistical analysis was undertaken only for the studies where each group size was at least n = 5. The paired or unpaired Student’s t-test or one-way, two-way or three-way analysis of variance (ANOVA) followed by the post hoc Tukey testing were applied for normally distributed data and the Mann-Whitney U-test for non-parametric data (SigmaPlot 12.5, San Jose, CA). Significance was set at P < 0.05. The manuscript complies with BJP’s recommendations and requirements on experimental design and analysis (Curtis et al., 2018).

3. RESULTS

3.1. RALY abundance is increased in injured DRG after CCI

We first evaluated whether RALY abundance was altered in two pain-related regions, DRG and spinal cord, after CCI. CCI, but not sham surgery, time-dependently increased the expression of Raly mRNA and protein in the L3/4 DRGs on the ipsilateral side (Fig. 1A and 1B). The ratios of CCI group to sham group of Raly mRNA at the corresponding time points were elevated on days 3, 7 and 14 post-surgery (Fig. 1A). Consistently, RALY protein abundance in the ipsilateral L3/4 DRGs was increased on days 3, 7 and 14 post-CCI compared to those post-sham surgery at the corresponding time points (Fig. 1B). Neither CCI nor sham surgery changed basal amounts of RALY protein in the contralateral L3/4 DRGs and in the ipsilateral L3/4 spinal cord during the observation period (Fig. 1C). We also examined RALY abundance in the ipsilateral L4 DRG after SNL. The level of RALY protein was increased on day 7 post-SNL compared to that post-sham surgery (Fig. 1D). The marked upregulation of Raly mRNA and its protein in injured DRGs after peripheral nerve trauma suggests a possible role of RALY in neuropathic pain.

Figure 1.

Peripheral nerve trauma-induced increases in the expression of Raly mRNA and RALY protein in injured DRG. (A and B) The levels of Raly mRNA (A) and RALY protein (B) in the ipsilateral L3/4 DRGs on days 3, 7 and 14 after CCI and sham surgery. Unilateral L3/4 DRGs from two mice were pooled together to obtain enough RNA or protein. n = 6 mice/time point/group. *P < 0.05 by two-way ANOVA followed by Tukey post hoc test. (C) RALY protein abundance in the contralateral (Con) L3/4 DRGs and in the ipsilateral (Ipsi) L3/4 spinal cord (SC) on days 3, 7 and 14 after CCI. n = 6 mice/time point/group. Two-way ANOVA followed by Tukey post hoc test. (D) RALY protein abundance in the ipsilateral L4 DRG on day 7 after SNL or sham surgery. Unilateral 4 DRGs from 4 mice were pooled together to obtain enough protein. n = 12 mice/group. *P < 0.05 by the two-tailed paired Student’s t-test.

We further examined the distribution pattern of RALY in the DRG. RALY was expressed in cellular nuclei and co-localized with β-tubulin III (a specific neuronal marker), but not with glutamine synthetase (GS, a marker for satellite glial cells), in DRG cells (Fig. 2A and 2B), indicating that RALY expresses exclusively in DRG neurons. Approximately 45% of β-tubulin III-positive neurons are labeled for RALY. A cross-sectional area analysis of neuronal somata showed that about 35% of RALY-labeled neurons were small (< 300 μm² in area), 42% for medium (300 to 600 μm² in area), and 22% for large (> 600 μm² in area) (Fig: 2C). Consistently, approximately 32.37 (± 3.15)% of RALY-labeled neurons were positive for calcitonin gene-related peptide (CGRP, a marker for small peptidergic neurons; Fig. 2D and 2E), 39.43 (± 1.45)% for isolectin B4 (IB4, a marker for small nonpeptidergic neurons; Fig. 2D and 2F) and 25.49 (± 1.34)% for neurofilament 200 (NF200, a marker for medium/large cells and myelinated Aβ fibers; Fig. 2D and 2G). As predicted, the number of RALY-labeled neurons in the ipsilateral L3/4 DRG on day 7 after CCI increased as compared with the corresponding sham group (Fig. 2H and 2I). Additionally, RALY did not co-express with GS (Supplementary Fig. 1), Iba1 (a marker for microglia; Supplementary Fig. 2), CD3 (a marker for T cells; Supplementary Fig. 3) or CD68 (a marker for microphages and monocytes; Supplementary Fig. 4) in the ipsilateral L3/4 DRGs on day 7 post-CCI. These findings further verify RALY upregulation in injured DRG neurons following peripheral nerve trauma.

Figure 2.

Distribution of RALY in the lumbar dorsal root ganglion of naïve mice or CCI/sham mice. (A and B) Double-labeled immunofluorescent staining showed co-localization of RALY (red) with β-tubulin III (green; A), but not with glutamine synthetase (GS; green; B), in the DRG cells. Cellular nuclei were labelled by 4’, 6-diamidino-2- phenylindole (DAPI; blue; B). n = 3 mice. Scale bar: 50 μm. (C) Size distribution of RALY-labeled neuronal somata. Large, 22%; medium, 42%; small, 35%. (D-G) Double-labeled immunofluorescent staining of RALY (red) with calcitonin gene-related peptide (CGRP; green; D), isolectin B4 (IB4; green; E) or neurofilament-200 (NF200; green; F) in the DRG neurons of naïve mice. Representative immunostaining images (D-F) and statistical summary of number of double-labeled neurons of RALY with CGRP, IB4 or NF200 (G). n = 5 mice. Scale bar: 50 μm. (H and I) Number of RALY-labeled neurons in the ipsilateral L3/4 DRGs on day 7 after CCI or sham surgery. Representative immunostaining images (H) and statistical summary of the number of RALY-labeled neurons (I). n = 5 mice/group. *P < 0.05 by the two-tailed paired Student’s t test.

3.2. Blocking DRG increased RALY alleviates the induction of CCI-induced nociceptive hypersensitivity

To investigate whether DRG RALY upregulation participated in neuropathic pain induction, we blocked the CCI-induced increase in DRG RALY through microinjection of AAV5 expressing Raly-shRNA (AAV5-Raly shRNA) into the ipsilateral L3/L4 DRGs of adult male mice 28 days before CCI or sham surgery, because AAV5 takes 4 weeks to be expressed (S. Du et al., 2022; Li et al., 2020; Pan et al., 2021). The AAV5 harboring scrambled shRNA (AAV5-scrambled shRNA) was used as a control. Consistent with the observations above, the amount of RALY protein was elevated in the ipsilateral L3/4 DRGs of the AAV5-scrambled shRNA-microinjected CCI male mice on day 14 post-CCI as compared to that in naïve male mice (Fig. 3A). This elevation was substantially blocked in the AAV5-Raly shRNA-microinjected CCI male mice (Fig. 3A). No significant reduction in the basal level of RALY protein was observed in the ipsilateral L3/4 DRGs of the AAV5-Raly shRNA- or AAV5-scarmbled shRNA-microinjected sham male mice on day 14 post-surgery (Fig. 3A). As expected, DRG pre-microinjection of AAV5-Raly shRNA did not affect basal expression of RALY in the ipsilateral L3/4 spinal cord dorsal horn 14 days after CCI or sham surgery (Supplemental Fig. 5).

Figure 3.

Blocking the CCI-induced increase in DRG RALY protein mitigated the CCI-induced development of nociceptive hypersensitivity and dorsal horn central sensitization in male mice. (A) Level of RALY protein in the ipsilateral L3/4 DRGs from the AAV5-Raly shRNA (shRNA)- or AAV5-scrambled shRNA (scramble)-microinjected mice on day 14 post-CCI or sham surgery. n = 6 mice/group. *P < 0.05 by two-way ANOVA followed by post hoc Tukey test. (B to H) Paw withdrawal frequency to low (0.07 g; B, F) and median (0.4 g; C, G) force von Frey filament stimuli and paw withdrawal latency to heat (D, H) and cold (E) stimuli on the ipsilateral side (B–E) and contralateral side (F–H) on days −28, −1, 3, 5, 7, 10 and 14 post-CCI or sham surgery in the mice with pre-microinjection (arrows) of AAV5-Raly shRNA (shRNA) or AAV5-scrambled shRNA (scramble) into the ipsilateral L3/4 DRGs for 28 days. n = 10 mice/group. *P< 0.05 vs the AAV5-scrambled shRNA-microinjected sham mice at the corresponding time point. ^#P < 0.05 vs the AAV5-scrambled shRNA-microinjected CCI male mice at the corresponding time point. Three-way ANOVA with repeated measures followed by post hoc Tukey test. (I-J) Levels of phosphorylated ERK1/2 (p-ERK1/2), total ERK1/2 and GFAP in the ipsilateral L3/4 dorsal horn on day 14 post-CCI or sham surgery in the mice with pre-microinjection of AAV5-Raly shRNA (shRNA) or AAV5-scrambled shRNA (scramble) into the ipsilateral L3/4 DRGs for 28 days. n = 6 mice/group. *P < 0.05, by two-way ANOVA followed by Tukey post hoc test.

In line with the previous studies (Yuan et al., 2019; L. Zhang et al., 2022), CCI produced mechanical allodynia as documented by increases in paw withdrawal frequencies in response to mechanical stimuli (0.07 g and 0.4 g von Frey filaments) and heat and cold hyperalgesia as evidenced by reductions in paw withdrawal latencies in response to heat and cold stimuli, respectively, from days 3 to 14 post-CCI surgery on the ipsilateral (but not contralateral) side of the AAV5-scrambled shRNA-microinjected CCI male mice (Fig. 3B-3H). Nevertheless, the CCI mice pre-microinjected with AAV5-Raly shRNA exhibited impaired nociceptive hypersensitivities, particularly from days 5 to 14 post-CCI (Fig. 3B-3E). In addition, CCI produced significant increases in the frequencies of paw lifting and licking/flinching and the duration of licking/flinching on the ipsilateral side 5 and 7 days (not 3 days) after CCI in the AAV5-scrambled shRNA-microinjected mice (Supplementary Fig. 6). These increases were markedly attenuated in the AAV5-Raly shRNA-microinjected mice (Supplementary Fig. 6). Neither AVV5-Raly shRNA nor AAV5-scrambled shRNA altered locomotor functions (Table 2) and basal paw withdrawal responses to mechanical, heat, and cold stimuli on the contralateral side of CCI mice and on both ipsilateral and contralateral sides of sham in male mice (Fig. 3F-3H).

Table 2.

Mean changes in locomotor function.

Treatment groups	Locomotor function test
	Placing	Grasping	Righting
Sham + AAV5-Raly shRNA (Male)	5(0)	5(0)	5(0)
Sham + AAV5-Raly shRNA (Female)	5(0)	5(0)	5(0)
Sham + AAV5-Raly-scramble shRNA (Male)	5(0)	5(0)	5(0)
Sham + AAV5-Raly-scramble shRNA (Female)	5(0)	5(0)	5(0)
CCI + AAV5-Raly shRNA (Male)	5(0)	5(0)	5(0)
CCI + AAV5-Raly shRNA (Female)	5(0)	5(0)	5(0)
CCI + AAV5-scramble shRNA (Male)	5(0)	5(0)	5(0)
CCI +AAV5-scramble shRNA (Female)
AAV5-GFP (Male)	5(0)	5(0)	5(0)
AAV5-GFP (Female)	5(0)	5(0)	5(0)
AAV5-Raly (Male)	5(0)	5(0)	5(0)
AAV5-Raly (Female)	5(0)	5(0)	5(0)

SEM given in parentheses. n=10 mice per group; five trials.

Nerve injury-induced DRG neuronal hyperexcitability causes the hyperactivation of spinal cord dorsal horn neurons and astrocytes by augmenting the release of neurotransmitters/neuromodulators in primary afferents under neuropathic pain conditions (Campbell and Meyer, 2006). To further confirm our behavioral observations above, we also examined whether DRG microinjection of AAV5-Raly shRNA affected the CCI-induced hyperactivities of neurons and astrocytes in the dorsal horn. The levels of phosphorylated extracellular signal-regulated kinase 1 and 2 (p-ERK1/2, a marker for neuronal activation) and glial fibrillary acidic protein (GFAP, a marker for astrocyte activation) were markedly increased in the ipsilateral L3/4 dorsal horn of the AAV5-scrambled shRNA-treated CCI mice compared to those of the AAV5-scrambled shRNA-treated sham in male mice (Fig. 3I-3J). These increases were not seen in the AAV5-Raly shRNA-treated CCI male mice (Fig. 3I-3J). DRG microinjection of neither virus changed basal levels of p-ERK1/2 and GFAP in the ipsilateral L3/4 dorsal horn of sham male mice (Fig. 3I-3J). As expected, no significant differences in basal amounts of total ERK1/2 were seen in the ipsilateral L3/4 dorsal horn among virus microinjected groups (Fig. 3I-3J). The results were consistent with behavioral test results, which provided further evidence for pain hypersensitivities.

Similar results were observed in CCI/sham female mice with DRG microinjection of AAV5-Raly shRNA or AAV5-scrambled shRNA (Fig. 4A-4J and Table 2). Our findings strongly suggest that the increased RALY in injured DRG of both male and female mice is required for neuropathic pain induction.

Figure 4.

Blocking the CCI-induced increase in DRG RALY protein mitigated the CCI-induced development of nociceptive hypersensitivity and dorsal horn central sensitization in female mice. (A) Level of RALY protein in the ipsilateral L3/4 DRGs from the AAV5-Raly shRNA (shRNA)- or AAV5-scrambled shRNA (scramble)-microinjected mice on day 14 post-CCI or sham surgery. n = 6 mice/group. *P < 0.05 by two-way ANOVA followed by post hoc Tukey test. (B to H) Paw withdrawal frequency to low (0.07 g; B, F) and median (0.4 g; C, G) force von Frey filament stimuli and paw withdrawal latency to heat (D, H) and cold (E) stimuli on the ipsilateral side (B–E) and contralateral side (F–H) on days −28, −1, 3, 5, 7 and 14 post-CCI or sham surgery in the mice with pre-microinjection (arrows) of AAV5-Raly shRNA (shRNA) or AAV5-scrambled shRNA (scramble) into the ipsilateral L3/4 DRGs for 28 days. n = 10 mice/group. *P< 0.05 vs the AAV5-scrambled shRNA-microinjected sham mice at the corresponding time point. ^#P < 0.05 vs the AAV5-scrambled shRNA-microinjected CCI mice at the corresponding time point. Three-way ANOVA with repeated measures followed by post hoc Tukey test. (I-J) Levels of phosphorylated ERK1/2 (p-ERK1/2), total ERK1/2 and GFAP in the ipsilateral L3/4 dorsal horn on day 14 post-CCI or sham surgery in the mice with pre-microinjection of AAV5-Raly shRNA (shRNA) or AAV5-scrambled shRNA (scramble) into the ipsilateral L3/4 DRGs for 28 days. n = 6 mice/group. *P < 0.05 by two-way ANOVA followed by Tukey post hoc test.

3.3. Blocking DRG increased RALY alleviates the maintenance of CCI-induced nociceptive hypersensitivity

To determine the role of DRG increased RALY in the maintenance of CCI-induced nociceptive hypersensitivities, we microinjected AAV5-Raly shRNA into the ipsilateral L3/4 DRGs 2 weeks (14 days) before surgery in male mice. As AAV5 in microinjected DRG takes 4 weeks to be expressed (S. Du et al., 2022; Li et al., 2020; Pan et al., 2021), a significant increase in the level of RALY protein in the ipsilateral L3/4 DRGs 7 days after CCI (3 weeks after AAV5 microinjection) was observed from both AAV5-Raly shRNA- and AAV5-scrambled shRNA-microinjected male mice (Supplementary Fig. 6A). This increase was still seen on days 14 and 21 post-CCI in the AAV5-scrambled shRNA-microinjected CCI male mice (Fig. 5A), but not in the AAV5-Raly shRNA-microinjected CCI male mice (Fig. 5A; Supplementary Fig. 6B). Consistently, mechanical allodynia and heat and cold hyperalgesia were noticed on days 3, 5 and 7 post-CCI on the ipsilateral (not contralateral) side in both AAV5-Raly shRNA- and AAV5-scrambled shRNA-microinjected male mice (Fig. 5B-5E). Nonetheless, these nociceptive hypersensitivities were substantially diminished on days 14 and 21 post-CCI in the AAV5-Raly shRNA-microinjected CCI male mice, as compared to those in the AAV5-scrambled shRNA-microinjected CCI male mice (Fig. 5B-5E). Basal paw withdrawal responses to mechanical, heat, and cold stimuli applied to the contralateral hind paw were not altered during the observation period in male mice with microinjection of either virus (Fig. 5B-5E). In addition, CCI-induced increases in the levels of p-ERK1/2 (but not total ERK1/2) and GFAP in the ipsilateral L3/4 dorsal horn from the AAV5-scrambled shRNA-microinjected CCI male mice on day 21 post-CCI were not detected in the AAV5-Raly shRNA-microinjected CCI male mice (Fig. 5F). These results suggest the critical role of increased DRG RALY in neuropathic pain maintenance.

Figure 5.

Preventing the CCI-induced increase in DRG RALY alleviated the maintenance of CCI-induced nociceptive hypersensitivity and dorsal horn central sensitization in male mice. (A) Level of RALY protein in the ipsilateral L3/4 DRGs on day 21 post-CCI or sham surgery in the mice with pre-microinjection of AAV5-Raly shRNA (shRNA) or AAV5-scrambled shRNA (Scramble) into the ipsilateral L3/4 DRGs for 14 days. n = 6 mice/group. *P < 0.05, by one-way ANOVA followed by Tukey post hoc test. (B-E) Paw withdrawal frequency to low (0.07 g; B) and median (0.4 g; C) force von Frey filament stimuli and paw withdrawal latency to heat (D) and cold (E) stimuli on both ipsilateral and contralateral sides of male on days −14, −1, 3, 7, 14 and 21 after CCI in the mice with pre-microinjection of AAV5-Raly shRNA or AAV5-scrambled shRNA into the ipsilateral L3/4 DRGs for 14 days. n = 10 mice/group. *P < 0.05 vs the AAV5-scrambled shRNA-microinjected CCI mice at the corresponding time point on the ipsilateral side. Two-way ANOVA with repeated measures followed by post hoc Tukey test. (F) Levels of total ERK1/2, phosphorylated ERK1/2 (p-ERK1/2) and GFAP in the ipsilateral L3/4 dorsal horn on day 21 post-CCI or sham surgery in the mice with pre-microinjection of AAV5-Raly shRNA (shRNA) or AAV5-scrambled shRNA (Scramble) into the ipsilateral L3/4 DRGs for 14 days. n = 6 mice/group. *P < 0.05 by one-way ANOVA followed by Tukey post hoc test.

3.4. Mimicking the CCI-induced DRG RALY increase produces nociceptive hypersensitivity

We further inquired whether DRG increased RALY was sufficient for neuropathic pain. To this end, we microinjected AAV5 expressing full-length Raly mRNA (AAV5-Raly) into unilateral L3/4 DRGs of naïve male mice. AAV5 expressing green fluorescent protein (AAV5-Gfp) was used as a control. The level of RALY protein was increased in the ipsilateral L3/4 DRGs of AAV5-Raly-microinjected male mice as compared to the AAV5-Gfp-microinjected male mice 9 weeks after microinjection (Fig. 6A). DRG microinjection of AAV5-Raly, but not AAV5-Gfp, produced mechanical hypersensitivity evidenced by significant increases in ipsilateral paw withdrawal frequencies in response to 0.07 g and 0.4 g von Frey filament stimuli (Fig. 6B-6C) and heat and cold hyperalgesia documented by marked decreases in ipsilateral paw withdrawal latencies in response to heat (Fig. 6D) and cold (Fig. 6E) stimuli, respectively. These nociceptive hypersensitivities developed between 4-5 weeks and persisted for at least 9 weeks (Fig. 6B-6E). Either viral microinjection did not affect locomotor functions (Table 2) and basal paw responses to mechanical and heat stimuli on the contralateral side (Fig. 6B-6E). In addition to evoked nociceptive hypersensitivities, DRG microinjection of AAV5-Raly produced evoked stimulation-independent nociceptive hypersensitivity evidenced by noticeable preference (that is, spent more time) for the intrathecally injected lidocaine-paired chamber on week 7 after viral microinjection in male mice (Fig. 6F-6G). As anticipated, male mice with DRG microinjection of AAV5-Gfp failed to exhibit significant preference toward either the intrathecally injected saline- or lidocaine-paired chamber (Fig. 6F-6G), indicating no spontaneous pain. DRG microinjection of AAV5-Raly, but not AAV5-Gfp, also produced the increases in the levels of p-ERK1/2 (but not total ERK1/2) and GFAP in the ipsilateral L3/4 dorsal horn of male mice 9 weeks after microinjection (Fig. 6H-6I). Similar observations were found in naive female mice after DRG microinjection of AAV5-Raly or AAV5-Gfp (Fig. 7A-7I and Table 2). Together, these findings indicate that mimicking the nerve injury-induced RALY increase in the DRG of male and female naive mice produces both spontaneous and evoked nociceptive hypersensitivities.

Figure 6.

DRG RALY overexpression produced the enhanced nociceptive response and dorsal horn central sensitization in naïve male mice. (A) Level of RALY in the ipsilateral L3/4 DRGs 9 weeks after microinjection of AAV5-Raly or control AAV5-Gfp into the unilateral L3/4 DRGs. n = 6 mice/group. *P < 0.05 by 2-tailed, independent Student’s t test. (B-E) Effect of microinjection of AAV5-Raly or AAV5-Gfp into the unilateral L3/4DRGs on paw withdrawal frequencies to low (0.07 g; B) and median (0.4 g; C) force von Frey filament stimuli and paw withdrawal latencies to heat (D) and cold stimuli (E) on the ipsilateral and contralateral sides on weeks 0, 3, 4, 5, 7 and 9 after AAV5 microinjection. n = 10 mice/group. *P < 0.05 vs control AAV5-Gfp group at the corresponding time points on the ipsilateral side. Two-way ANOVA with repeated measures followed by Tukey post hoc test. (F and G) Effect of microinjection of AAV5-Raly or AAV5-Gfp into the unilateral L3/4 DRGs on spontaneous ongoing pain as assessed by the CPP test by observing the time spent on the intrathecal saline or lidocaine-paired chambers 8 weeks after microinjection. n = 10 mice/group. *P < 0.05 by two-way ANOVA with repeated measures followed by Tukey post hoc test (F) or by two-tailed, independent Student’s t-test (G). (H and I) Effect of microinjection of AAV5-Raly or AAV5-Gfp into the unilateral L3/4 DRGs on dorsal horn neuronal and astrocyte hyperactivities evidenced by the increases in the phosphorylated ERK1/2 (p-ERK1/2) and GFAP abundance, respectively, in the ipsilateral L3/4 dorsal horn 9 weeks after viral microinjection. n = 6 mice/group. *P < 0.05 by 2-tailed, independent Student’s t-test.

Figure 7.

DRG RALY overexpression produced the enhanced nociceptive response and dorsal horn central sensitization in naïve female mice. (A) Level of RALY in the ipsilateral L3/4 DRGs 8 weeks after microinjection of AAV5-Raly or control AAV5-Gfp into the unilateral L3/4 DRGs. n = 6 mice/group. *P < 0.05 by 2-tailed, independent Student’s t test. (B-E) Effect of microinjection of AAV5-Raly or AAV5-Gfp into the unilateral L3/4DRGs on paw withdrawal frequencies to low (0.07 g; B) and median (0.4 g; C) force von Frey filament stimuli and paw withdrawal latencies to heat (D) and cold stimuli (E) on the ipsilateral and contralateral sides on weeks 0, 2, 3, 4, 5, 6 and 8 after AAV5 microinjection. n = 10 mice/group. *P < 0.05 vs control AAV5-Gfp group at the corresponding time points on the ipsilateral side. Two-way ANOVA with repeated measures followed by Tukey post hoc test. (F and G) Effect of microinjection of AAV5-Raly or AAV5-Gfp into the unilateral L3/4 DRGs on spontaneous ongoing pain as assessed by the CPP test by observing the time spent on the intrathecal saline or lidocaine-paired chambers 7 weeks after microinjection. n = 10 mice/group. *P < 0.05 by two-way ANOVA with repeated measures followed by Tukey post hoc test (F) or by two-tailed, independent Student’s t-test (G). (H and I) Effect of microinjection of AAV5-Raly or AAV5-Gfp into the unilateral L3/4 DRGs on dorsal horn neuronal and astrocyte hyperactivities evidenced by the increases in the phosphorylated ERK1/2 (p-ERK1/2) and GFAP abundance, respectively, in the ipsilateral L3/4 dorsal horn 8 weeks after viral microinjection in female mice. n = 6 mice/group. *P < 0.05 by 2-tailed, independent Student’s t-test.

3.5. Increased RALY triggers transcriptional activation of eIF4G2 in injured DRG after CCI

Finally, we investigate how DRG increased RALY contributed to neuropathic pain. A previous RNA sequencing study revealed that RALY overexpression increased the expression of eIF4G2 mRNA in Hela cells (Z. Liang et al., 2022). We recently showed that SNL increased the expression of eIF4G2 mRNA and its protein eIF4G2 (Z. Zhang et al., 2021), a repressor of cap-dependent mRNA translation (Lee & McCormick, 2006; Sugiyama et al., 2017), in injured DRG neurons. Moreover, this increase was required for the development and maintenance of neuropathic pain through suppressing the expression of mu opioid receptor (MOR) and Kv1.2 in injured DRG (Z. Zhang et al., 2021). Therefore, we speculated that RALY likely was implicated in peripheral nerve trauma-triggered transcriptional activation of eIF4g2 gene in injured DRG. To address our speculation, we first carried out the ChIP assay and demonstrated that the fragment of the eIF4G2 promoter could be amplified from the complex immunoprecipitated with RALY antibody in nuclear fraction from L3/4 DRGs of the AAV5-scrambled shRNA-microinjected sham mice (Fig. 8A). This binding activity in the ipsilateral L3/4 DRGs of the AAV5-scrambled shRNA-microinjected CCI mice was markedly increased as compared to that in the AAV5-scrambled shRNA-microinjected sham mice on day 7 post-surgery (Fig. 8A). This increase was due to the CCI-induced upregulation of DRG RALY, as blocking this upregulation through DRG microinjection of AAV5-Raly shRNA abolished this increase (Fig. 8A). Furthermore, the luciferase assay showed that co-transduction of full-length Raly vector (but not control Gfp vector) with eIF4G2 reporter vector dramatically increased the activity of the eIF4G2 promoter in in vitro CAD cells (Fig. 8B). In our in vivo works, CCI increased eIF4G2 abundance at both mRNA and protein levels in the ipsilateral L3/4 DRGs on day 14 post-CCI in the AAV5-scrambled shRNA-microinjected mice (Fig. 8C and 8D). These increases were significantly attenuated in the AAV5-Raly shRNA-microinjected CCI mice (Fig. 8C and 8D). DRG microinjection of AAV5-Raly shRNA also produced the reductions in basal levels of eIF4G2 mRNA and eIF4G2 protein in the ipsilateral L3/4 DRGs of sham mice (Fig. 8C and 8D). As expected, DRG microinjection with AAV5-Raly shRNA also reversed the CCI-induced downregulation of MOR and Kv1.2 proteins, two downstream targets of eIF4G2 (Z. Zhang et al., 2021), in the ipsilateral L3/4 DRGs on day 14 post-CCI (Supplementary Fig. 8 and 9). These effects were selective, because DRG microinjection of AAV5-Raly shRNA did not affect the CCI-induced increases in the levels of E74-like factor 1 and cyclic AMP response element binding protein, two transcription factors that are critical for neuropathic pain (L. Liang et al., 2016; Sun et al., 2019; Yang et al., 2021; L. Zhang et al., 2022), in the ipsilateral L3/4 DRGs (Supplementary Fig. 10). Conversely, significant increases in the levels of eIF4G2 mRNA and eIF4G2 protein and decreases in the amounts of MOR and Kv1.2 were seen in the ipsilateral L3/4DRGs of the AAV5-Raly-microinjected mice, as compared with AAV5-Gfp-microinjeced mice, 9 weeks post-microinjection (Fig. 8E and 8F; Supplementary Fig. 11). In in vitro DRG neuronal culture, co-transduction of AAV5-Raly plus AAV5-scrambled shRNA increased the levels of not only Raly mRNA and RALY protein but also eIF4G2 mRNA and eIF4G2 protein (Fig. 8G and 8H). These increases were not observed in cultured DRG neurons co-transduced with AAV5-Raly plus AAV5-Raly shRNA (Fig. 8G and 8H). Co-transduction of AAV5-Raly shRNA plus AAV5-Gfp also led to the decreases in the expression of RALY protien, eIF4G2 mRNA and eIF4G2 protein in the cultured DRG neurons (Fig. 8G and 8H). Finally, a single cell RT-PCR assay showed that Raly mRNA co-expressed with eIF4G2 mRNA in individual large, medium and small DRG neurons (Fig. 8I). These findings suggest that increased RALY contributed to CCI-induced nociceptive hypersensitivity through transcriptional activation of eIF4G2 gene in injured DRG.

Figure 8.

Role of increased DRG RALY in CCI-induced upregulation of eIF4G2 in injured DRG of male mice. (A) The eIF4G2 promoter fragment immunoprecipitated by anti-RALY antibody in the ipsilateral L3/4 DRGs on day 7 post-CCI or sham surgery in the mice with pre-microinjection with AAV5-Raly-shRNA (shRNA) or AAV5-Scrambled-shRNA (Scr) for 28 days. Input: total purified fragments. M: ladder marker. Representative blots (left) and a summary of densitometric analysis (right) are shown. n = 9 mice/group. *P < 0.05 by two-way ANOVA followed by Tukey post hoc test. (B) eIF4G2 gene promoter activity in CAD cells transfected with the vectors and transduced with virus as shown. Control: empty pGL3-Basic. eIF4G2: pGL3-eIF4G2 report vector. GFP: AAV5-Gfp. RALY: AAV5-Raly. n = 6 experimental repeats/group. *P < 0.05 by one-way ANOVA followed by Tukey post hoc test. (C and D) Expression of Raly and eIF4G2 mRNAs (C) and eIF4G2 protein (D) in the ipsilateral L3/4 DRGs on day 14 after CCI or sham surgery in mice pre-microinjected with AAV5-Raly shRNA (shRNA) or negative control AAV5-scrambled shRNA (Scr) for 28 days. n = 6 mice/group. *P < 0.05 by two-way ANOVA followed by post hoc Tukey test. (E and F) Expression of eIF4G2 mRNA (E) and eIF4G2 protein (F) in the ipsilateral L3/4 DRGs 7 or 9 weeks after microinjection of AAV5-Raly or control AAV5-Gfp into unilateral L3/4 DRGs in naïve mice. n = 6 mice/group. *P < 0.05 by two-tailed unpaired Student’s t test. (G and H) Expression of RALY and eIF4G2 proteins (G) and Raly and eIF4G2 mRNAs (H) in mouse cultured DRG neurons 3 days after transfection of AAV5-Raly-shRNA (shRNA)/AAV5-Scramble-shRNA (Scr) or AAV5-Raly/AAV5-Gfp. n = 5 experimental repeats/group. *P < 0.05 by one-way ANOVA followed by Tukey post hoc test. (I) Co-expression analysis of Raly mRNA and eIF4G2 mRNA in individual large (> 35 μm in diameter), medium (25-35 μm in diameter) and small (< 25 μm in diameter) DRG neurons from naïve mice. NeuN mRNA is used as a marker for DRG neurons. Gapdh mRNA is used as a loading control. Number 1–5: five different neurons. M: DNA ladder marker. H₂O: no cDNA. n = 5 neurons/size.

4. DISCUSSION

Peripheral nerve trauma caused by CCI or SNL leads to long-lasting nociceptive hypersensitivities including spontaneous ongoing pain, mechanical allodynia, heat hyperalgesia and cold hyperalgesia. These two preclinical mouse models mimic neuropathic pain often occurring after limb amputation, thoracotomy, breast surgery and cardiac surgery in clinic. Although preclinical and clinical studies on nerve trauma-induced neuropathic pain have been taken for several decades, molecular and cellular mechanisms underlying this disorder are still unclear. Nerve injury-induced changes of pain-associated genes at transcriptional level in DRG likely is molecular basis for neuropathic pain genesis (Campbell & Meyer, 2006; Costigan, Scholz, & Woolf, 2009; L. Liang et al., 2015; Lutz et al., 2014). RNA-binding proteins are implicated in gene transcription (X. Du & Xiao, 2020; Turner & Diaz-Munoz, 2018). In this study, we demonstrated that CCI/SNL produced an increase in the expression of Raly mRNA and RALY protein in injured DRG. This increase participated in the development and maintenance of CCI-induced nociceptive hypersensitivity through its triggered transcriptional activation of eIF4G2 in injured DRG. Our findings suggest that RALY is a key player in nerve trauma-induced neuropathic pain.

RALY, like other RNA-binding proteins FUS (S. Du et al., 2022) and HuR (Borgonetti & Galeotti, 2021), can be upregulated in injured DRG under neuropathic pain conditions. The present study showed that RALY was detected exclusively in the nuclei of DRG neurons. CCI time-dependently elevated the abundances of Raly mRNA and RALY protein in the ipsilateral L3/4 DRGs. This elevation may occur in most small-diameter and medium-diameter DRG neurons, as RALY is distributed primarily in these neurons. Given that this elevation is correlated to the induction and maintenance of CCI-induced nociceptive hypersensitivity and that small-diameter and medium-diameter DRG neurons are implicated in nerve trauma-induced neuropathic pain (Gong, Kung, Magni, Bhargava, & Jasmin, 2014; Sakai et al., 2013; Shin et al., 2022), DRG increased RALY likely contributes to neuropathic pain. The present study also indicates that Raly gene is transcriptionally activated in injured DRG following peripheral nerve trauma. How this activation is caused is still unknown, but it may be related to the activation of transcription factors, changes of epigenetic modifications or increases in RNA stability, which will be investigated in our future work.

eIF4G2, also known as DAP-5, p97 and NAT1, is one of the scaffolding protein eIF4G subunits (Hinnebusch & Lorsch, 2012; Prevot, Darlix, & Ohlmann, 2003) and functions as a general repressor of cap-dependent translation of most RNAs by forming translationally inactive complexes (Lee & McCormick, 2006; Sugiyama et al., 2017). Our previous study revealed that eIF4G2 was co-expressed with mu opioid receptor (MOR) and Kv1.2 in DRG neurons (Z. Zhang et al., 2021). Peripheral nerve trauma time-dependently increased the expression of eIF4G2 mRNA and eIF4G2 protein in injured DRG neurons (Z. Zhang et al., 2021). Blocking this increase rescued the downregulation of MOR and Kv1.2 in injured DRG and attenuated the development and maintenance of nociceptive hypersensitivities following peripheral nerve trauma (Z. Zhang et al., 2021). Mimicking this increase reduced DRG MOR and Kv1.2 expression and produced the enhanced responses to mechanical, heat and cold stimuli in naïve mice (Z. Zhang et al., 2021). It appears that DRG increased eIF4G2 acts as a critical participant to contribute to neuropathic pain through its participation in never trauma-induced Kv1.2 and MOR downregulation in injured DRG.

DRG increased RALY participates in the nerve trauma-induced nociceptive hypersensitivity through upregulating eIF4G2 abundance in injured DRG. The present study showed that RALY transcriptionally activated eIF4G2 gene in injured DRG after CCI. DRG microinjection of AAV5-Raly shRNA prevented not only the CCI-induced nociceptive hypersensitivity but also the CCI-induced increases in the levels of eIF4G2 mRNA and eIF4G2 protein in the ipsilateral L3/4 DRGs from both male and female mice. Conversely, DRG overexpression of AAV5-Raly elevated basal amounts of eIF4G mRNA and eIF4G2 protein in the ipsilateral L3/4 DRGs and produced both stimulation-dependent and -independent nociceptive hypersensitivities in male or female mice. Moreover, the binding activity of RALY to the eIF4G2 promoter was significantly increased in injured DRG after CCI. In vitro experiment showed direct activation of eIF4G2 promoter activity by RALY overexpression. Nuclear transcription factor Y may involve in this transcription activation, as a previous study reported that RALY directly bound to nuclear transcription factor Y to impact cholesterogenic gene expression (Z. Zhang et al., 2020). Given that Raly mRNA and eIF4G2 mRNA co-existed in individual DRG neurons, the antinociceptive effect caused by blocking the CCI-induced increase of DRG RALY likely results from the failure to transcriptionally activate eIF4G2 gene in injured DRG after CCI. Without an increase in eIF4G2 protein, no alternations would occur in the downregulation of MOR and Kv1.2 and Kv1.2 downregulation-caused hyperexcitability in injured DRG neurons, MOR-gated enhanced release of primary afferent neurotransmitters/neuromodulators, and subsequent central sensitization in the ipsilateral dorsal horn. Indeed, blocking or preventing the CCI-induced increase in DRG RALY abolished the CCI-induced elevations in markers for hyperactivation in dorsal horn neurons and astrocytes. Thus, we conclude that DRG RALY contributes to nerve trauma-induced nociceptive hypersensitivity at least in part through the eIF4G2-mediated mechanism. In addition to eIF4G2, RALY may transcriptionally regulate other genes (Z. Liang et al., 2022), for example, Ehmt2 gene (Pan et al., 2021). Other potential mechanisms by which increased DRG RALY participate in neuropathic pain cannot be excluded.

5. CONCLUSIONS

In conclusion, we reported an RALY-triggered transcriptional mechanism by which peripheral nerve trauma induced DRG eIF4G2 upregulation. Because blocking DRG increased RALY mitigated nerve trauma-induced nociceptive hypersensitivities without changing acute/basal pain and locomotor function, RALY may be a potential new target for therapeutic management of neuropathic pain through intrathecal or systemic injection of AAV5-Raly shRNA, as AAV has been used as a delivered vehicle for COVID-19 vaccine. However, potential side effects produced by Raly shRNA should be taken into consideration, as RALY is widely expressed in body tissues.

The bulleted point summary.

What is already known:

Nerve trauma-induced dysregulation of pain-associated genes in primary sensory neurons are molecular basis for neuropathic pain genesis.

What does this study add:

This study demonstrated that RALY contributed to nerve trauma-induced nociceptive hypersensitivity through transcriptionally triggering eIF4G2 expression in injured dorsal root ganglion neurons.

What is the clinical significance:

This study indicates that RALY may be a potential target in neuropathic pain management.

DATA AVAILABILITY STATEMENT

All data generated or analyzed during this study are included in this published article (and its supplementary information files), are available from the corresponding authors upon reasonable request.