Lactiplantibacillus plantarum postbiotic protects against Salmonella infection in broilers via modulating NLRP3 inflammasome and gut microbiota

Abstract

Salmonella infection is a major concern in poultry production which poses potential risks to food safety. Our previous study confirmed that Lactiplantibacillus plantarum (LP) postbiotic exhibited a strong antibacterial capacity on Salmonella in vitro. This study aimed to investigate the beneficial effects and underlying mechanism of LP postbiotic on Salmonella-challenged broilers. A total of 240 one-day-old male yellow-feathered broilers were pretreated with 0.8% deMan Rogosa Sharpe (MRS) medium or 0.8% LP postbiotic (LP cell-free culture supernatant, LPC) in drinking water for 28 d, and then challenged with 1×10⁹ CFU Salmonella enterica serovar Enteritidis (SE). Birds were sacrificed 3 d postinfection. Results showed that LPC maintained the growth performance by increasing body weight (BW), average daily gain (ADG), and average daily feed intake (ADFI) in broilers under SE challenge. LPC significantly attenuated SE-induced intestinal mucosal damage. Specifically, it decreased the intestinal injury score, increased villus length and villus/crypt, regulated the expression of intestinal injury-related genes (Villin, matrix metallopeptidase 3 [MMP3], intestinal fatty acid-binding protein [I-FABP]), and enhanced tight junctions (zona occludens-1 [ZO-1] and Claudin-1). SE infection caused a dramatic inflammatory response, as indicated by the up-regulated concentrations of interleukin (IL)-1β, IL-6, TNF-α, and the downregulation of IL-10, while LPC pretreatment markedly reversed this trend. We then found that LPC inhibited the activation of NOD-like receptor thermal protein domain associated protein 3 (NLRP3) inflammasome by decreasing the gene expression of Caspase‐1, IL-lβ, and IL-18. Furthermore, LPC suppressed NLRP3 inflammasome activation by inhibiting nuclear factor-kappa B (NF-κB) signaling pathway (the reduced levels of toll-like receptor 4 [TLR4], myeloid differentiation factor 88 [MyD88], and NF-κB). Finally, our results showed that LPC regulated gut microbiota by enhancing the percentage of Ligilactobacillus and decreasing Alistipes and Barnesiella. In summary, we found that LP postbiotic was effective to protect broilers against Salmonella infection, possibly through suppressing NLRP3 inflammasome and optimizing gut microbiota. Our study provides the potential of postbiotics on prevention of Salmonella infection in poultry.

INTRODUCTION

Salmonella infection is a major concern in poultry production and is frequently associated with foodborne outbreaks of human diseases (Gast and Porter, 2020), causing about 1.3 billion salmonellosis cases annually (Sun et al., 2021). Among about 2,600 serotypes, Salmonella enterica serovar Enteritidis is the most prevalent serotype from poultry products in many countries (Hyeon et al., 2021). It causes symptoms such as inappetence, liver injury, gastrointestinal inflammation, diarrhea, and even death in poultry (Gan et al., 2020; Gast and Porter, 2020; Sarrami et al., 2023). The treatment of Salmonella infection mainly relies on antibiotics. However, the antibiotic abuse results in serious drug resistance and residue (Eng et al., 2015). Therefore, it is essential to find an alternative to antibiotics. Recent studies reported that postbiotics, defined as “preparation of inanimate microorganisms and/or their components that confers a health benefit on the host” (Salminen et al., 2021), are effective on inhibiting pathogens including Salmonella (Humam et al., 2019), but the underlying mechanism warrants further investigation.

Salmonella infection can activate a series of inflammatory responses. Reports revealed that Salmonella-triggered inflammation is mainly driven by NOD-like receptor thermal protein domain associated protein 3 (NLRP3) inflammasome (Fattinger et al., 2021). When Salmonella enters the host intestine, its lipopolysaccharide (LPS) is identified by the toll-like receptor 4 (TLR4) on the cell surface, triggers myeloid differentiation factor 88 (MyD88) dependent- signal, and then initiates the rapid activation of nuclear factor-kappa B (NF-κB) (O’neill et al., 2013; Chen et al., 2021). The activation of NF-κB facilitates the transcription and assembly of NLRP3 inflammasome, which consist of NLRP3, apoptosis-associated speck-like protein containing CARD (ASC) and pro-caspase-1 (He et al., 2016). This formation of NLRP3 protein complex leads to Caspase-1 activation, promoting the maturation of the proinflammatory cytokines IL-1β and IL-18, and eventually causing acute inflammation and tissue damages (Wang and Hauenstein, 2020).

Disturbing the gut microbiota is another manifestation caused by Salmonella infection. Intestinal microbiota is an important determinant of gastrointestinal health (Humam et al., 2019). The intestinal commensal microbes are the first line to protect host against pathogens via competing colonization sites and nutrients, strengthening immunity and producing antimicrobial peptides (He et al., 2020). Salmonella infection in broilers can cause intestinal dysbiosis by reducing the percentage of beneficial microbes and increasing potentially harmful bacteria, leading to the imbalance of gut microbiota and the injury of intestinal mucosal barrier (Shao et al., 2022). Accumulating studies have proved that optimizing gut microbiota is a key way to alleviate Salmonella infection. For instance, acetate regulated gut microbiota by reducing the growth of pathogens and promoting beneficial microorganisms to alleviate pathogen infection (Morrison and Preston, 2016); Lactobacillus regulated the balance of intestinal flora to inhibit Salmonella infection (Chen et al., 2020).

Lactiplantibacillus plantarum (LP) is a common probiotic that is widely applied in animal production. Recent studies showed that its postbiotics, including the bacterial components and metabolites, exert beneficial effects on improving nutrient intake, immune response, and gut microbiota, contributing to the promotion of growth performance and quality of animal products (Chang et al., 2022; Danladi et al., 2022). We previously screened a strain LP HJZW08 and found that its postbiotics exhibited a strong antibacterial capacity on inhibiting Salmonella (Wu et al., 2023), but whether it is effective in vivo and the molecular mechanism remains obscure. Thus, this study aimed to explore the effectiveness of LP postbiotic on alleviating Salmonella infection in broiler chickens, and elucidated the molecular mechanism from the perspective of regulating NLRP3 inflammasome and gut microbiota.

MATERIALS AND METHODS

Preparation of Bacteria and Postbiotic

LP HJZW08, strain number (CGMCC 23777), obtained from Vegamax Biotechnology Co., Ltd. (Huzhou, China), were statically and anaerobically cultivated in deMan Rogosa Sharpe (MRS) medium for 24 h at 37°C. LP postbiotic (LP cell-free culture supernatant, LPC) was prepared via centrifuging at 5,000 × g for 10 min at 4°C and the supernatant was collected by a 0.22-μm filter (Merck Millipore, Billerica, MA) to remove the bacteria. All LP postbiotics used for the animal trial were prepared from the same batch to ensure consistency and then stored as aliquots at −80℃ before use. Through calculated by the lyophilization method, the concentration of LPC was 40 mg/mL. To be detailed, LPC was lyophilized in a vacuum freeze dryer (Hefan, Shanghai, China) at the conditions of freezer temperature −45 to 30℃, vacuum degree 10 Pa for 30 h; the lyophilized powder was weighed, and the concentration was calculated by the powder weight/ lyophilized volume. Salmonella enterica serovar Enteritidis (SE) ATCC 13076 was cultured at 37°C overnight in Luria-Bertani broth, and then expanded to new medium for another 6 h- cultivation. The concentration of SE was adjusted to 1×10⁹ CFU/mL according to the OD₆₀₀-concentration curve, and the OD value was detected in a Multiskan FC microplate reader (Thermo Scientific, Shanghai, China).

Animal Experimental Design

The animal experiments were carried out in accordance with the Guide for the Care and Use of Agricultural Animals in Research and Teaching, and approved by the Animal Ethics Committee of Zhejiang Agriculture and Forestry University. A total of 240 one-day-old male yellow-feathered broilers were randomly distributed to 4 groups: Control, SE, LPC and LPC+SE (N=60 in each group). The trials included 2 stages: the feeding period (1–28 d) and the Salmonella-challenged period (28–31 d). During the feeding period, broilers in LPC and LPC+SE groups were fed with a basal diet and supplemented with 0.8% LPC in drinking water, while Control and SE groups were fed with a basal diet and supplemented with 0.8% MRS medium (as a negative control). The dosage of LPC was chosen based on our previous dosage-exploration feeding trials (data not shown). The feeding period lasted for 28 d, which was in order to investigate the preventive effect and efficiency of LP postbiotic against Salmonella in mature broilers (Marcq et al., 2011). During the challenged period (28–31 d), broilers in SE and LPC+SE groups were intragastrically gavaged with 1 mL SE bacterial suspension (1×10⁹ CFU/mL) using a stainless-steel 8^# gavage needle, while broilers in Control and LPC groups were gavaged with the same volume of PBS. Broilers were sacrificed 3 d postinfection. The broiler management was carried out based on the recommendations of Aviagen (Aviagen, 2014). The basal diet was prepared according to NRC (National Research Council, 1994) and Chinese Chicken Feeding Standard (Ministry of Agriculture of PRC, 2004), and the formula and nutrient concentrations are displayed in Table 1. Broilers were housed in a temperature-controlled room, and feed and water were available ad libitum. The body weight (BW), feed intake and mortality of broilers were recorded during the trials. Then the average daily gain (ADG), average daily feed intake (ADFI), feed:gain ratio (F/G), and mortality rate were calculated.

Table 1.

Ingredients and nutrient levels of the basal diets(Air dry basis, %).

Items	Concentration
Ingredients (%)
Corn	54.4
Soybean meal	23.6
Extruded soybean	5
Rice distiller’s grains	5
Soybean oil	2.2
Limestone	1.3
Fermented soybean meal	2.5
High grade corn gluten meal	2.0
1Premix1	4
Total	100.00
Nutrient levels
ME(kcal/kg)	2983
CP	20.4
Lys	1.18
Met	0.55
Met+Cyst	0.90
Trp	0.22
Tyr	0.88
Ca	0.86
TP	0.59

¹Premix provided per kilogram of diet: vitamin A (transretinyl acetate), 1 500 IU; vitamin D₃ (cholecalciferol), 200 IU; vitamin E (all-rac-α-tocopherol acetate), 10 IU; menadione, 35 g; thiamin, 1.5 mg; riboflavin, 3.5 mg; pyridoxine·HCl, 3 mg; vitamin B12 (cobalamine), 10 μg; Pantothenic acid, 10 mg; niacin, 30 mg; biotin, 0.15 mg; choline chloride, 1,000 mg; Fe, 80 mg; Cu, 8 mg; Mn, 60 mg; Zn, 40 mg; Se, 0.15 mg; I, 0.18 mg.

Sample Collection

On d 31, ten broilers randomly from each group were weighed and sacrificed. Blood samples were immediately obtained from jugular vein. The thymus, bursal of Fabricius, liver, and spleen were isolated and weighed. The immune organ indexes were calculated as$100\%\times \frac{\text{immune}\text{organ}\text{weight}\left(\mathrm{g}\right)}{\text{body}\text{weight}\left(\mathrm{g}\right)}$. The serum from blood samples were collected by centrifuging at 6,000 × g for 10 min at 4°C. One centimeter of intestinal segments (jejunum and ileum) was gently taken out and immediately fixed in 10% formalin. The remaining segments were opened longitudinally, and the contents were washed with PBS. After taken pictures by a camera, mucosa samples were collected by gently scraping the mucosal surface using a sterile glass. Cecal contents were immediately sampled for microbial analysis. All samples were stored at −80°C before measurement.

Analysis of Intestinal Morphology

Jejunal and ileal segments were maintained in 10% buffered formalin saline and dehydrated in a gradient concentration of ethanol solution. Then samples were cleaned with xylol, embedded in paraffin, and then sliced into 5 μm-thick paraffin sections by a microtome (Leica, Wetzlar, Germany). Thereafter, each section was stained with hematoxylin–eosin (H&E) according to the manufacturer's instructions (Servicebio, Wuhan, China). Images of the intestinal structure were captured by a microscope system (Nikon, Tokyo, Japan). Villus length and crypt depth were measured from six fields per slide and eight slides per group, and the villus/crypt ratio was calculated.

RNA Extraction and Real-Time Quantitative PCR

Total RNA was extracted from intestinal mucosal samples using RNAiso reagent (ABClonal, Wuhan, China). The RNA concentration was detected by a NanoDrop (Allsheng, Hangzhou, China). Then, reverse transcription of total RNA was carried out using ABScript III RT Master Mix for qPCR with gDNA remover (ABClonal, Wuhan, China). The Q-PCR assay was accomplished using a CFX96 Real-Time PCR system (Bio-Rad, Hercules, CA) and 2× Universal SYBR Green Fast qPCR Mix (ABClonal, Wuhan, China) according to the protocol. Sequences for all primers are displayed in Table 2. The relative quantitation of genes was analyzed according to the 2^-∆∆CT method and β-actin acted as the control gene (Livak and Schmittgen, 2001).

Table 2.

Primers of the target genes.

Target genes1	Accession No.	Forward primers (5′—3′)	Reverse primers (5′—3′)
β-actin	NM_205518	CCGCTCTATGAAGGCTACGC	CTCTCGGCTGTGGTGGTGAA
NLRP3	XM_046918112	GAGGTCCTCTACAGCTTGTG	ACATGATCATCTGTGTGGTG
Caspase-1	AF031351.1	GTGCTGCCGTGGAGACAACATAG	AGGAGACAGTATCAGGCGTGGAAG
IL-1β	XM_46931582	ACGTGGCAGCTTTTGAAGAT	GCGGTGGTTTTGTAACAGTG
IL-18	XM_046932263	ACGTGGCAGCTTTTGAAGAT	GCGGTGGTTTTGTAACAGTG
ZO-1	XM_046925214.1	CTAAGGGGAAGCCAACTGAT	ATTCTGAGGTGGAGGAGGGT
Occludin	XM_046904540.1	GGTTCCTCATCGTCATCCTG	TTCTTCACCCACTCCTCCAC
Claudin-1	NM_001013611.2	CCGCTGTCCTGAGCAGAGTT	TTTCCAGTGGCGATACCTAC
Villin	NM_205442.2	GGCACCAACGAGTACAACACCA	TGCAGCCCTTCCCATACCAGA
I-FABP	NM_001007923	AGGCTCTTGGAACCTGGAAG	CTTGGCTTCAACTCCTTCGT
MMP3	XM_046909299.1	CAAGCATTTTTGGCGCAAGC	ATGCAGCGTCAACACCAGAT
TLR4	NM_001030693.1	AGGCACCTGAGCTTTTCCTC	TACCAACGTGAGGTTGAGCC
MyD88	NM_001030962.4	TGATGCCTTCATCTGCTACTG	TCCCTCCGACACCTTCTTTCTA
IRAK-4	NM_001389294.2	AGAGTTGTGGGAACAGCAGCCTA	CGTCTACTGGTGGCAGACCTGTTA
NF-κB	NM_205129.1	GTGTGAAGAAACGGGAACTG	GGCACGGTTGTCATAGATGG

¹I-FABP, intestinal fatty acid-binding protein; IRAK-4, interleukin-1 receptor-associated kinase 4; MMP3, matrix metallopeptidase 3; MyD88, myeloid differentiation factor 88; NF-κB, nuclear factor-kappa B;NLRP3, NOD-like receptor thermal protein domain associated protein 3; TLR4, toll-like receptor 4; ZO-1, zona occludens-1.

Analysis of Inflammatory Cytokines by ELISA Assay

The levels of inflammatory cytokines in serum and ileal mucosa samples were examined according to the protocols of commercial ELISA kits including interleukin (IL)-1β (CAS: ANG-E32031C), IL-6 (CAS: ANG-E32013C), tumor necrosis factor (TNF)-α (CAS: ANG-E32030C), and IL-10 (CAS: ANG-E32011C) (Angle Gene Bioengineering, Nanjing, China). All the kits are chicken-specific.

Analysis of Volatile Fatty Acids

The volatile fatty acids (VFA) were detected followed by the method previously described (Jin et al., 1998). In details, cecal contents (approximately 0.5 g) were blended with H₂O at a volume of 1:3 and the supernatant was gained by centrifugation (12,000 × g, 10 min, 4°C). Thereafter, each sample was mixed with 25% metaphosphoric acid (w/v) at 5:1, incubated on ice for 30 min and centrifuged at 12,000 × g for 10 min at 4°C. Finally, one microliter of samples was injected in a GC-MS network system-GC7890 (Agilent Technologies, Wilmington, DE) to analyze the concentrations of VFA.

Analysis of Gut Microbiota

The total genomic DNA of cecal contents was extracted with a E.Z.N.A. soil DNA Kit (Omega Bio-tek, Norcross, GA). The gene fragments of the V3-V4 region of 16S rRNA were amplified with primers 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCT AAT-3′). The PCR products were recovered by agarose electrophoresis and purified using a DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA). Then the purified amplicons were carried out on an Illumina MiSeq platform (Illumina, San Diego, CA) and obeyed the protocols according to Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China).

Raw data were filtered through Trimmomatic and merged by FLASH1.2.11 (https://ccb.jhu.edu/software/FLASH/index.shtml). The RDP Classifier algorithm (http://rdp.cme.msu.edu/) was conducted with the confidence threshold of 70%. Operational taxonomic units (OTUs) were clustered trough UPARSE(version 7.1, http://drive5.com/uparse/) at the threshold of 97% similarity. Data were analyzed on Majorbio Cloud Platform (https://cloud.majorbio.com). The α diversity was conducted using Mothur1.30.2 (https://www.mothur.org/wiki/Download_mothur). The β diversity was performed using QIIME1.9.1(http://qiime.org/install/index.html), calculated according to the unweighted UniFrac distance, and displayed as principal coordinate analysis. Microbiota composition was performed with the use of tax_summary and the R package (version 3.3.1). The differences of microbiota composition between groups were analyzed using STAMP software (version 2.1.3).

Statistical Analysis

Data were shown as mean ± standard deviation and performed by one-way ANOVA with Tukey multiple-range tests with IBM SPSS software (version 21.0, Chicago, IL). Figures were generated by the GraphPad Prism software (version 8.0, Chicago, IL). P < 0.05 was considered statistically significant.

RESULTS

Effects of LP Postbiotic on the Growth Performance and Immune Organ Indexes of Broilers

As shown in Table 3, during the feeding period (1–28 d), F/G in the LPC and LPC+SE groups was markedly decreased (P < 0.05), while BW, ADG ADFI and mortality rate showed no significance (P > 0.05). During the challenged period, SE infection significantly decreased BW, ADG and ADFI (P < 0.05), when compared to the Control group; BW, ADG, and ADFI in LPC+ST group were notably increased in comparison to the SE group (P < 0.05). No significant differences were shown in the index of immune organs (thymus, bursa of Fabricius, liver, and spleen) among all the groups in SE-challenged broilers (P > 0.05) (Figure S1).

Table 3.

Effects of LP postbiotic on growth performance of broilers.

Items	Control	SE	LPC	LPC+SE	P-value
BW(g)
1 d	30.10±0.17	30.11±0.12	30.07±0.36	30.02±0.24	0.969
28 d	678.49±6.66	681.69±10.70	714.66±40.55	709.12±16.73	0.171
31 d	722.32±5.46a	690.67±7.78b	756.28±30.68a	727.96±17.36a	0.005
ADG(g/d)
1–28d	24.01±0.39	24.98±0.44	25.36±1.50	25.15±0.62	0.17
28–31d	14.61±1.89a	2.99±1.49b	13.87±5.99a	6.28±1.82b	0.002
ADFI(g/d)
1–28 d	44.92±0.73	45.24±0.56	43.37±1.03	43.29±1.11	0.056
28–31 d	60.93±8.96a	20.78±5.82c	56.76±4.47a	38.50±12.86b	0.000
F/G
1–28d	1.87±0.03a	1.88±0.04a	1.72±0.08b	1.72±0.08b	0.011
28–31d	4.28±0.97	8.00±2.11	4.96±2.04	6.81±2.95	0.184
Mortality rate (%)
1–28 d	10.00±3.33	8.33±5.52	6.67±4.74	6.67±4.74	0.787
28–31 d	0	0	0	0	None

Different superscripts (a, b, c) in each parameter indicates significant (P < 0.05).

Control: the negative control; SE: challenged with 1 mL 1×10⁹ CFU/mL Salmonella enterica Enteritidis; LPC: pretreated with 0.8% Lactiplantibacillus plantarum postbiotic in drinking water; LPC+SE: pretreated with 0.8% Lactiplantibacillus plantarum postbiotic and infected with 1 mL 1×10⁹ CFU/mL Salmonella enterica Enteritidis.

ADG, average daily gain; ADFI, average daily feed intake; BW, body weight; F/G, feed:gain ratio.

Effects of LP Postbiotic on Intestinal Morphology of Broilers

As indicated in Figure 1A, there were numerous hemorrhagic spots (pointed by red arrows) in the intestinal wall of SE-infected broilers, while LPC pretreatment obviously reduced the numbers. Moreover, dietary LPC markedly decreased the injury score caused by SE infection both in jejunum and ileum (P < 0.01, P < 0.001, respectively) (Figure 1B). SE infection led to apparent villus damage and mucosa erosion, whereas LPC pretreatment could attenuate it (Figures 1C and 1D). By statistical analysis, we found that the jejunal crypt depth was markedly decreased and the villus/crypt was increased in LPC+SE group in comparison to SE group (P < 0.01) (Figure 1E). For the ileum, LPC significantly enhanced the villus length and villus/crypt in comparison to the Control group (P < 0.001) (Figure 1F); under SE challenge, LPC pretreatment markedly increased the villus length and villus/crypt and decreased crypt depth when compared to SE group (P < 0.001, P < 0.01, P < 0.001, respectively). The above results revealed that LP postbiotic alleviated SE-induced intestinal damage in broilers.

Figure 1.

Effect of LP postbiotic on intestinal morphology of broilers. (A) Pictures of the jejunal and ileal lumen. The red arrows indicate the hemorrhagic spots. (B) Intestinal injury score of Jejunum and ileum. (C) and (D) Histomorphometric pictures of jejunum (C) and ileum (D) by Hematoxylin & Eosin (H&E) staining. 100× magnification, scale bar: 200 μm. The villus length and crypt depth are shown by the straight lines. (E) and (F) Statistical analysis of villus length, crypt depth and Villus/crypt ratio of jejunum (E) and ileum (F). The villus height and crypt depth were measured from 6 fields in 8 samples from each group. Data are presented as Mean ± SD and analyzed by one-way ANOVA Tukey test. * P < 0.05, ** P < 0.01, *** P < 0.01, ns, no significance.

Effects of LP Postbiotic on Intestinal Mucosal Functions of Broilers

Figures 2A–2C shows the gene expression of mucosal injury biomarkers of. SE markedly reduced the expression of villin (P < 0.05), and increased matrix metallopeptidase 3 [MMP3] and intestinal fatty acid-binding protein [I-FABP] in jejunum (P < 0.05, P < 0.01, respectively), while LPC pretreatment markedly decreased I-FABP (P < 0.01). Similarly, in ileum, LPC enhanced the expression of villin (P < 0.05); SE obviously increased MMP3 and I-FABP (P < 0.001, P < 0.001), and LPC pretreatment suppressed the increased MMP3 (P < 0.05). The gene expression of tight junctions was displayed in Figures 2D–2F. When compared to the Control, LPC significantly increased the expression of jejunal zona occludens-1 [ZO-1] and Claudin-1 (P < 0.01). Compared with SE group, Claudin-1 expression was markedly increased in LPC+SE group (P < 0.01). No significance was found in Occludin by SE and LPC treatments (P > 0.05). These results showed that LP postbiotic alleviated mucosal injury and enhanced tight junctions in broilers under SE infection.

Figure 2.

Effect of LP postbiotic on intestinal mucosal functions of broilers. The relative gene expression levels of ZO-1, Occludin, Claudin-1, Villin, MMP3, I-FABP in jejunum and ileum. Data are presented as Mean ± SD and analyzed by one-way ANOVA Tukey test. * P < 0.05, ** P < 0.01, ns, no significance.

Effects of LP Postbiotic on Inflammatory Cytokines of Broilers

The concentrations of inflammatory cytokines are presented in Figure 3. In serum, SE markedly increased the levels of IL-1β and TNF-α (P < 0.05), whereas LPC pretreatment significantly decreased IL-1β (P < 0.05). A dramatic reduction of IL-10 was found in SE group (P < 0.01), but this was significantly inhibited by LPC pretreatment (P < 0.05) (Figure 3A). In ileum, IL-1β was significantly decreased and IL-10 was increased in LPC group (P < 0.05, P < 0.001, respectively), while a noticeable upregulation of IL-1β, IL-6, and TNF-α (P < 0.001, P < 0.05, P < 0.001, respectively), and downregulation of IL-10 was found in SE group (P < 0.001) (Figure 3B). Furthermore, IL-1β was evidently decreased and IL-10 was increased in LPS+SE group, when compared with SE group (P < 0.01).

Figure 3.

Effects of LP postbiotic on inflammatory cytokines of broilers. The concentrations of TNF-α, IL-1β, IL-6 and IL-10 in serum (A) and ileum (B) were determined by ELISA assay. Data are presented as Mean ± SD and analyzed by one-way ANOVA Tukey test. * P < 0.05, ** P < 0.01, *** P < 0.01, ns, no significance.

Effects of LP Postbiotic on NLRP3 Inflammasome and the Mediated Signaling Pathways

We then aimed to investigated the underlying mechanisms of LP postbiotic on alleviating Salmonella infection. Figure 4A shows the gene expression of NLRP3 inflammasome biomarkers. NLRP3 and Caspase-1 expressions were significantly increased in ileum of SE-infected broilers (P < 0.01, P < 0.001, respectively); compared with the SE, Caspase-1 was markedly reduced in jejunum of LPC + SE group (P < 0.05). SE challenge notably up-regulated the levels of IL-1β (P < 0.001, P < 0.05, respectively) and IL-18 (P < 0.001, P < 0.01) in both intestines, whereas LPC pretreatment effectively reduced jejunal IL-1β (P < 0.001), and IL-18 in both intestines (P < 0.001, P < 0.05, respectively).

Figure 4.

Effect of LP postbiotic on NLRP3 inflammasome and the mediated signaling pathways. (A) The relative gene expression levels of NLRP3, Caspase-1, IL-1β and IL-18 in jejunum and ileum. (B) The relative gene expression levels of TLR4, MYD88, IRAK4 and NF-ΚB in jejunum and ileum. Data are presented as Mean ± SD and analyzed by one-way ANOVA Tukey test. * P < 0.05, ** P < 0.01, *** P < 0.01, ns, no significance.

Figure 4B displays the gene expression of the upstream signaling pathways of NLRP3 inflammasome. In jejunum, SE infection dramatically increased the expression of TLR4, MYD88, interleukin receptor-associated kinase 4 (IRAK4) and NF-κB (P < 0.001, P < 0.001, P < 0.05, P < 0.01, respectively), while LPC pretreatment significantly suppressed the upregulation of TLR4, MYD88, and NF-κB caused by SE challenge (P < 0.05, P < 0.001, P < 0.05, respectively). In ileum, SE significantly increased TLR4, MYD88, and IRAK4 (P < 0.05), while pretreated with LPC showed the reversed trend but with no significance (P > 0.05).

Effects of LP Postbiotic on Intestinal Volatile Fatty Acids of Broilers

We further focused on the gut microbiota to elucidate the underlying mechanism. Figure 5 shows the concentration of VFAs, the primary microbial metabolites, in the cecal contents. Surprisingly no significant differences of all VFAs including acetic acid, propionic acid, butyric acid, isobutyric acid, valerate acid and isovaleric acid were found in SE group in comparison to the Control (P > 0.05), and only propionic acid experienced a marked decrease in LPC group (P < 0.05). When compared with SE group, the concentration of VFAs was also not significant in LPC+SE group (P < 0.05).

Figure 5.

Effect of LP postbiotic on intestinal volatile fatty acids of broilers. The concentration of volatile fatty acids (acetic acid, propionic acid, butyric acid, isobutyric acid, valerate and isovalerate) in cecal contents were determined by GC/MS. Data are presented as Mean ± SD and analyzed by one-way ANOVA Tukey test. * P < 0.05.

Effects of LP Postbiotic on the Gut Microbiota of Broilers

Finally, we analyzed the composition of gut microbiota. As shown in Figure 6A, the total OTUs in the Control, SE, LPC and LPC + SE groups were 2749, 2417, 2979 and 2729, and there was a higher unique OTUs in LPC group. Figure 6B shows the parameters representing alpha diversity, and LPC pretreatment had a trend to increase ACE, Sobs and Shannon indexes but with no significance (P > 0.05). β diversity presenting in a PCoA scatterplot showed an apparent shift in SE group, and LPC pretreatment significantly restored it to the normal state (P < 0.01) (Figure 6C).

Figure 6.

Effect of LP postbiotic on the diversity of gut microbiota of broilers. (A) Venn diagram showing the operational taxonomic units (OTUs) in each group. (B) The indexes representing α diversity at the OTU level. (C) The β-diversity displayed in a principal coordinate analysis (PCoA) scatterplot.

As showed in Figure7A, SE decreased Firmicutes and increased Bacteroidota and Actinobateriota, while LPC pretreatment significantly reversed this trend. At the genus level, the percentage of microbes significantly differed by SE and LPC treatments, and the TOP10 significant and dominant genuses were Lighilactobacillus, Alistipes, norank_f__norank_o__Clostridia_UCG-014, Barnesiella, norank_f__n orank_o__Clostridia _vadinBB60_group, Ruminococcus_torques_gro up, UGC-005, Ruminococcus_torques_group, unclassified_f__Oscillospiraceae, Incertae_Sedis (Figures 7B and 7C). Specifically, as displayed in Figure 7D, LPC pretreatment remarkably upregulated the richness of Ligilactobacillus (P < 0.05), while SE infection notably reduced it (P < 0.05). A marked reduction of Alistipes was found in LPC group (P < 0.05). The percentage of norank_f__norank_o__Clostridia_UCG-014 was significantly upregulated in LPC and LPC+SE groups (P < 0.05). LPC pretreatment notably inhibited the increased abundance of Barnesiella cause by SE challenge (P < 0.05). The above results showed that LP postbiotic modulated the composition of gut microbiota by increasing Ligilactobacillus, and decreasing Alistipes and Barnesiella.

Figure 7.

Effect of LP postbiotic on the composition of gut microbiota of broilers. (A) Bar plot of microbiota composition at the phylum level. (B) Bar plot of microbiota composition at the genus level. (C) Bar chart representing the top 10 significant genera by STAMP analysis with Kruskal-Wallis test. (D) Box plot of the significant genera among groups. Data are presented as Mean ± SD and analyzed by one-way ANOVA Tukey test. * P < 0.05, ** P < 0.01, *** P < 0.01, ns, no significance.

DISCUSSION

Salmonella is one of the main food-borne pathogens worldwide. In China, it was found that retail chickens were frequently contaminated with Salmonella, and SE was the most common serotype, accounting for 32.9% (Sun et al., 2021). Antibiotics are the main strategy for Salmonella treatment, whereas problems by long-term extensive use of antibiotics are becoming more and more serious (Eng et al., 2015). It is well-accepted that some probiotic strains can protect host against Salmonella infection. However, probiotics also have certain limitations, such as the intolerance to extreme conditions, the low survival rate in the gastrointestinal tract, and some strains may even have safety issue by producing endotoxins and having resistance genes (Markowiak and Śliżewska, 2018). Recent studies reported that postbiotics (the bacteria components or metabolites) exerted similar or even superior effects to their live probiotics (Salminen et al., 2021). In our study, we found that LP postbiotic (the cell-free supernatant of LP) was effective to alleviate Salmonella infection and the mediated inflammatory response in broilers.

Our study demonstrated that LP postbiotic markedly enhanced the growth performance and alleviated Salmonella-induced intestinal injuries in broilers. Reduced growth is one of the most prominent signs of salmonellosis. In our study, LP postbiotic exerted a significant effect on maintaining the growth performance via increasing BW, ADG and ADFI, suggesting the alleviated symptoms caused by SE challenge. Similarly, the maintenance of growth performance by L. plantarum postbiotics has also been reported by another study (Humam et al., 2019). Salmonella infection commonly causes symptoms including diarrhea, intestinal inflammation and hyperemia in broilers (El-Sharkawy et al., 2017). We found that SE infection led to numerous hemorrhagic spots in the intestinal wall and the increased intestine injury scores, while LPC pretreatment could significantly decrease it, suggesting the decreased injury by LPC pretreatment. Differently, it was reposted that supplemented with postbiotic had no effect on the gut histopathology of pathogen-infected chicks (Abd El-Ghany et al., 2022). This confirms the view that probiotics or postbiotics drive functions in a strain-specific manner. The structure of villus and crypt reflects intestinal health status and nutrient absorptive property (Zhang et al., 2022). It is commonly accepted that longer intestinal villi indicate the better ability of the intestine to absorb nutrients, deeper villus crypts indicate a stronger capacity for villus regeneration, whereas lower villus/crypt ratio means the reduced absorption of nutrients (Caspary, 1992). We found that SE challenge led to the damaged villi and mucosa erosion, and the decrease of villus length and villus/crypt, while LPC supplementation markedly reversed these negative effects. Consistently, it was reported that postbiotics enhanced growth performance by optimizing intestinal morphology (Hu et al., 2023). These results revealed that LP postbiotic showed a strong ability to protect broilers for Salmonella-induced intestinal damages.

Furthermore, LP postbiotic improved the functions of intestinal mucosal barrier. It modulated the levels of integrity biomarkers for epithelial cells (Villin, MMP3 and I-FABP). Villin is an anti-apoptotic protein associated with actin (O'Reilly et al., 2016). Studies showed that significant changes in Villin after Salmonella infection increased intestinal epithelial cell apoptosis and affected cytoskeleton remodeling (Wang et al., 2012). The decrease of Villin in SE group revealed the damages in epithelial cells, while LPC significantly increased it, indicating a protected role. MMP-3 belongs to a class of zinc-endopeptidases that is pivotal in connective tissue remodeling (Nidamanuri et al., 2019). MMP-3 expression is normally increased in inflammatory environment. In our study, MMP-3 was markedly rised in SE-infected broilers, but this was inhibited by LPC pretreatment. Similarly, it was found that L. rhamnosus decreased the elevated expression of MMP3 caused by inflammation by altering the intestinal environment (Jhun et al., 2021). I-FABP is a biomarker of intestinal injury (López-Colom et al., 2019), which is acutely released in the circulation when tissue is damaged and the increased expression of I-FABP indicates the decreased absorption area caused by intestinal injury (Feng et al., 2012). We found that SE challenge obviously upregulated I-FABP expression, whereas LPC pretreatment markedly inhibited it, suggesting the decreased injury of LP postbiotic on epithelial cells. Tight junctions are fundamental components of gut mucosal barrier. Impairment of tight junctions causes intestinal barrier disruption and increases permeability, which leads to the diffusion of pathogens, antigens, and endotoxins from intestinal lumen into blood (Zhang et al., 2012). ZO-1, Occludin and Claudin-1 are key tight junction proteins that maintain gut barrier functions (Gao et al., 2023). We found that LPC pretreatment markedly inhibited the decrease of ZO-1 and Claudin-1 caused by SE challenge. Consistently, previous study showed that Salmonella infection resulted in intestinal injury, elevated permeability, and downregulation of Occludin and Claudin (Dong et al., 2019). Consistently, L. plantarum ZLP001 protected intestinal epithelial cells from pathogens by improving the expression of tight junctions (Wang et al., 2018). In conclusion, LP postbiotic enhanced the mucosal barrier of broilers under Salmonella infection.

Our findings showed that LP postbiotic markedly inhibited Salmonella- induced inflammation. Salmonella infection causes a series of proinflammatory pathways, and eventually leads to cytokine release (Jung et al., 1995). IL-1β, IL-6, and TNF-α are proinflammatory cytokines, while IL-10 is a regulatory cytokine with anti-inflammatory and immunoregulatory functions (Wang et al., 2019). We found that SE infection markedly increased IL-1β, IL-6, and TNF-α, and reduced IL-10 in both serum and ileum, indicating the acute inflammatory responses. Nevertheless, LPC pretreatment significantly suppressed the inflammatory response via decreasing IL-1β, and increasing IL-10. Consistently with our results, the metabolites of Bifidobacterium breve exerted anti-inflammatory effects through decreasing IL-6 and TNF-α, and increasing IL-10 (Bermudez-Brito et al., 2013).

We then further found that LP postbiotic might alleviate Salmonella-induced inflammation by suppressing NLRP3 inflammasome and the upstream NF-κB signaling pathway. NLRP3 inflammasome is the intracellular sensor that is pivotal in the immune response to pathogens whereas the overexpression of NLRP3 will lead to serious inflammation (Kelley et al., 2019). Accumulating studies proved that Salmonella infection is closely linked in the activation of NLRP3 inflammasome, and causes the release of IL-1β and IL-18 (Wang and Hauenstein, 2020). Differently with the mammals, ASC is not expressed in chickens (Shi et al., 2022). In our study, SE challenge markedly rose the concentrations of Caspase-1, IL-1β and IL-18, and LPC pretreatment could reverse this trend, suggesting its capacity to suppress NLRP3 activation. Accordingly, recent research showed that L. johnsonii L531 pretreatment suppressed NLRP3 inflammasome and decreased IL-1β and IL-18 (Chen et al., 2021). NF-κB is the upstream signaling pathway to trigger NLRP3 inflammasome. We found that LPC pretreatment markedly reduced the levels of TLR4, MYD88 and NF-ΚB caused by SE infection. Similarly, the modulation of NF-kB pathway to inhibit inflammation by postbiotics has been reported in previous studies. For instance, L. rhamnosus postbiotic blocked the interaction of LPS and TLR4 (Kwon et al., 2020), and inhibited the transduction of MyD88-NF-κB to play anti-inflammatory effects (Li et al., 2020); the bacterial compounds of L. acidophilus CICC 6074 suppressed the activation of TLR4/MyD88 and NF-κB signaling pathway (Cai et al., 2018).

Finally, we demonstrated that modulation of gut microbiota might also contribute to LP postbiotic-mediated protection against Salmonella infection. Gut microbiota is an important determinant of gastrointestinal health in shaping intestinal morphology, and maintaining the integrity of gut barrier, thereby helping to protect host from pathogens (Buffie and Pamer, 2013). In this study, LP postbiotic exhibited a strong capacity to optimize microbiota in Salmonella-infected broilers. LPC pretreatment exerted a significant shift of β diversity when compared to the Salmonella-infected group. PCoA scatter plots presenting β diversity indicates that the closer the samples are, the smaller the difference in community composition structure is (Jiang et al., 2013). Thus, this suggested that LPC supplementation restored the microbiota caused by Salmonella challenge. LPC treatments notably increased the percentage of the phyla Firmicutes and reduced Bacteriodota. Reports showed that in the cecal microbiota of broilers, Firmicutes are the dominant phylum, followed by Bacteroidetes (Azcarate-Peril et al., 2018). Firmicutes include Ruminococcaceae and Lachnospiraceae, a family that mainly produce butyric acid, which may inhibit the pathogens including Salmonella to invade the host (Joat et al., 2021). Bacteroidota is a kind of gram-negative bacteria, and some Bacteroides can produce LPS to induce an inflammatory response, leading to the impairment of intestinal barrier function (Shi et al., 2023). Thus, the increase of Firmicutes and the decrease of Bacteroidota indicated the optimization of microbiota by LPC. At the genus level, SE challenge markedly reduced the richness of Ligilactobacillus and increased Barnesiella and Alistipes, while LPC pretreatment significantly reversed this trend. Ligilactobacillus is well-known as a kind of probiotic, and many of its strains exhibit antimicrobial capacity, immune effects, and microbiota modulation (Guerrero Sanchez et al., 2022). Therefore, the significant increase of Ligilactobacillus by LPC pretreatment might help to protect against Salmonella. Accordingly, Ligilactobacillus strains were reported to protect chickens from SE colonization, possibly due to the capacity of Ligilactobacillus to bind epithelial cells and its ability to produce salivaricin (Pascual et al., 1999; Piazentin et al., 2022). Barnesiella, belonging to Bacteroides, is generally considered to be closely associated with pro-inflammatory responses in chickens (Wu et al., 2021). Our results revealed that LPC pretreatment markedly reduced the abundance of Barnesiella caused by SE infection. Similar to our findings, studies showed that Salmonella infection dramatically upregulated the abundance of Barnesiella, whereas probiotic administration inhibited this trend (Shao et al., 2022). Alistipes is a genus of Bacteroidetes, gram-negative, obligate anaerobes that have been shown to be linked with various diseases, including colorectal cancer and segmental ileitis (Hasan et al., 2022; Parker et al., 2020). Consistently with our results, LP reduced the abundance of Alistipes to alleviate gut dysbiosis in a mouse model (Guo et al., 2022). All findings revealed that LP postbiotic optimized the gut microbiota which possibly contribute to protect against Salmonella in broilers.

CONCLUSION

In conclusion, LP postbiotic enhanced the growth performance, and alleviated intestinal mucosal damages and inflammatory response in SE- challenged broilers. Furthermore, it exerted a marked effect on suppressing the activation of NLRP3 inflammasome and optimizing the composition of gut microbiota. Our study provides the potential of postbiotics on the prevention of Salmonella infection in poultry.